The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	0	2533	4090308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004249862.1|574_2533_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
>prophage 2
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	7881	55342	4090308	transposase,integrase,tRNA	Virus_Rctr41k(20.0%)	41	19404:19418	57236:57250
WP_147715593.1|7881_8298_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	2.0e-45
WP_012368603.1|8384_9077_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_004246616.1|9080_10499_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_017628596.1|10489_11227_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004249867.1|17230_17917_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071425458.1|17997_19395_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
19404:19418	attL	GATATAAAAATAAAA	NA	NA	NA	NA
WP_004246607.1|19476_20403_-	ribokinase	NA	NA	NA	NA	NA
WP_017827657.1|20683_22183_+	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	37.3	1.1e-21
WP_046335304.1|22190_23648_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004246604.1|23648_24641_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246603.1|24801_25263_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_004249871.1|25363_25804_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_049199593.1|26183_28082_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_049196595.1|28078_28705_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246598.1|29319_29697_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|29728_30553_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|30598_30838_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|30899_31370_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|31382_31916_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246592.1|31930_33472_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|33529_34393_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|34427_35810_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|35831_36248_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004246587.1|36398_37772_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_049196597.1|37929_39756_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	43.9	4.1e-127
WP_132587779.1|39915_40737_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|40723_42832_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|42828_44496_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|44498_46025_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000251879.1|46025_47642_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001271300.1|47872_48250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001334979.1|48303_48627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|48659_49031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|49091_49589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|49664_50453_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|50510_51035_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|51129_51603_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000071896.1|51934_52471_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|52585_52912_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|53099_53339_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_049196599.1|54265_55342_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.1e-26
57236:57250	attR	GATATAAAAATAAAA	NA	NA	NA	NA
>prophage 3
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	75772	76177	4090308		Stx_converting_phage(100.0%)	1	NA	NA
WP_004249797.1|75772_76177_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.3	1.4e-22
>prophage 4
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	89667	90630	4090308		Bacillus_phage(100.0%)	1	NA	NA
WP_004249967.1|89667_90630_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.1	1.5e-59
>prophage 5
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	93637	95500	4090308		Tupanvirus(100.0%)	1	NA	NA
WP_071425881.1|93637_95500_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.0	1.1e-13
>prophage 6
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	123955	131466	4090308		Staphylococcus_phage(33.33%)	7	NA	NA
WP_012368639.1|123955_124216_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.3	3.5e-16
WP_004246510.1|124179_124539_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004246509.1|124556_124700_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004246507.1|125422_126823_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004246506.1|126827_127931_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.1	3.8e-51
WP_004246505.1|127942_129031_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004246504.1|129051_131466_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	55.4	4.5e-12
>prophage 7
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	137217	137601	4090308		Escherichia_phage(100.0%)	1	NA	NA
WP_017826987.1|137217_137601_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	55.5	1.0e-27
>prophage 8
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	141516	144125	4090308		Xanthomonas_phage(33.33%)	3	NA	NA
WP_004246490.1|141516_141975_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	6.0e-51
WP_036919447.1|141958_143167_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	5.6e-48
WP_049201524.1|143453_144125_+	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	27.1	4.0e-19
>prophage 9
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	150872	152179	4090308		Bacillus_phage(50.0%)	2	NA	NA
WP_004249751.1|150872_151697_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	32.4	5.6e-23
WP_071425569.1|151693_152179_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.9	2.3e-24
>prophage 10
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	160794	167883	4090308		Synechococcus_phage(25.0%)	6	NA	NA
WP_071425572.1|160794_161733_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.4	8.3e-31
WP_017628701.1|162000_163200_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	3.8e-36
WP_071425573.1|163209_164235_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	8.0e-19
WP_132587683.1|164316_165375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071425319.1|165622_166588_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_071425320.1|166590_167883_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	36.6	7.7e-11
>prophage 11
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	173911	176114	4090308		Tupanvirus(50.0%)	2	NA	NA
WP_071425323.1|173911_174922_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	31.0	2.6e-38
WP_036971909.1|174947_176114_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	57.4	4.5e-119
>prophage 12
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	182959	186367	4090308		Moumouvirus(50.0%)	3	NA	NA
WP_132587691.1|182959_184063_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	29.9	1.8e-24
WP_132587692.1|184055_185498_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_071425764.1|185503_186367_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	2.7e-108
>prophage 13
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	189670	191773	4090308		Bacillus_phage(50.0%)	2	NA	NA
WP_004249722.1|189670_191062_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	3.4e-20
WP_004246432.1|191074_191773_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
>prophage 14
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	195641	196634	4090308		Catovirus(100.0%)	1	NA	NA
WP_132587702.1|195641_196634_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	29.1	2.2e-13
>prophage 15
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	206417	213718	4090308		Salmonella_phage(33.33%)	7	NA	NA
WP_004246423.1|206417_207602_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.2	2.0e-13
WP_071425260.1|207711_209244_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246421.1|209286_210102_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
WP_012368679.1|210398_210641_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_004246419.1|210734_211253_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_020946557.1|211361_212279_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004246417.1|212377_213718_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
>prophage 16
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	229407	232351	4090308		Hokovirus(50.0%)	2	NA	NA
WP_060555804.1|229407_230838_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.4	2.8e-62
WP_004246398.1|230848_232351_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	4.8e-57
>prophage 17
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	237222	238947	4090308		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_004246391.1|237222_238947_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.5	6.2e-24
>prophage 18
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	250282	252136	4090308		Acinetobacter_phage(100.0%)	1	NA	NA
WP_049199245.1|250282_252136_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	25.5	1.4e-08
>prophage 19
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	261132	264238	4090308		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_004246971.1|261132_262080_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.5	4.2e-30
WP_017827660.1|262192_262390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368688.1|263053_264238_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.1e-06
>prophage 20
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	283543	287466	4090308	tRNA	Prochlorococcus_phage(25.0%)	5	NA	NA
WP_004246934.1|283543_284494_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.5	2.8e-10
WP_004246933.1|284520_285036_-	peptide deformylase	NA	A0A2I7R586	Vibrio_phage	39.6	1.4e-16
WP_012368692.1|285167_286328_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	31.5	4.2e-32
WP_017827503.1|286346_286904_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_071425352.1|286896_287466_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	27.6	3.2e-09
>prophage 21
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	298982	300632	4090308		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_004246367.1|298982_300632_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.3	5.0e-63
>prophage 22
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	308811	314164	4090308		Bacillus_phage(33.33%)	4	NA	NA
WP_004249673.1|308811_310833_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	6.2e-116
WP_004246357.1|310907_312416_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004246356.1|312419_313718_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	28.7	2.2e-34
WP_004246355.1|313837_314164_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.4	6.6e-20
>prophage 23
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	318682	324859	4090308		Catovirus(20.0%)	6	NA	NA
WP_004246349.1|318682_319813_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.2	1.1e-29
WP_004246348.1|319809_321072_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	26.1	1.3e-23
WP_036908853.1|321068_322136_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	53.3	5.4e-103
WP_004249667.1|322154_323036_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	8.4e-110
WP_004246344.1|323013_323727_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_004246343.1|323728_324859_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	37.8	1.2e-20
>prophage 24
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	341303	345245	4090308		Brevibacillus_phage(50.0%)	3	NA	NA
WP_004246325.1|341303_342227_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	25.8	9.7e-24
WP_071425922.1|342226_342943_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_004246323.1|343088_345245_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.4	1.3e-116
>prophage 25
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	348532	350362	4090308		Catovirus(100.0%)	1	NA	NA
WP_004246318.1|348532_350362_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.1	7.9e-86
>prophage 26
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	365071	365617	4090308		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004253041.1|365071_365617_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.5	1.3e-28
>prophage 27
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	369622	372970	4090308		Vibrio_phage(50.0%)	2	NA	NA
WP_004253037.1|369622_370939_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	33.3	6.2e-16
WP_004253034.1|370960_372970_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	3.3e-61
>prophage 28
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	378482	383163	4090308		Cedratvirus(50.0%)	3	NA	NA
WP_004249629.1|378482_379781_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.5	1.4e-65
WP_004249627.1|380206_380635_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_049256053.1|380673_383163_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.9	1.5e-66
>prophage 29
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	387907	389555	4090308	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_147715595.1|387907_388324_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	2.0e-45
WP_147715596.1|388346_389555_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.8	2.3e-190
>prophage 30
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	405420	407155	4090308		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_004246260.1|405420_405948_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	4.2e-56
WP_004249610.1|406147_407155_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	44.4	4.4e-70
>prophage 31
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	410728	413041	4090308		Vibrio_phage(25.0%)	4	NA	NA
WP_004246255.1|410728_410995_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.2	8.6e-18
WP_004246254.1|411180_411528_+	putative DNA-binding transcriptional regulator	NA	A0A1C6ZDN4	Pseudomonas_phage	50.0	1.2e-06
WP_004246253.1|411606_412023_+	putative DNA-binding transcriptional regulator	NA	C9DGL1	Escherichia_phage	53.8	3.9e-09
WP_004246252.1|412069_413041_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.4	1.4e-09
>prophage 32
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	418880	421745	4090308	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_113707125.1|418880_420821_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.8	8.3e-118
WP_004246242.1|420902_421745_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	1.8e-16
>prophage 33
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	426084	428835	4090308		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004246237.1|426084_428835_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.8	2.1e-26
>prophage 34
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	434464	436300	4090308		Catovirus(100.0%)	1	NA	NA
WP_004246232.1|434464_436300_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A1V0SBR7	Catovirus	34.1	7.2e-55
>prophage 35
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	441955	443659	4090308		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004246222.1|441955_443659_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	69.7	5.4e-214
>prophage 36
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	457048	464297	4090308		Trichoplusia_ni_ascovirus(25.0%)	11	NA	NA
WP_004246208.1|457048_457330_-	GIY-YIG nuclease family protein	NA	Q06VJ4	Trichoplusia_ni_ascovirus	47.8	6.1e-14
WP_004246207.1|457616_457868_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004246206.1|457983_458424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246205.1|458432_458810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249586.1|458976_459186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246203.1|459212_459677_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2H5BH04	Vibrio_virus	60.4	5.0e-53
WP_004246202.1|459681_461820_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.8	1.6e-263
WP_017628758.1|461809_462124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246200.1|462165_462552_-	RidA family protein	NA	NA	NA	NA	NA
WP_004246198.1|462889_463348_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_004246197.1|463361_464297_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	2.9e-52
>prophage 37
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	469031	473972	4090308	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_071425868.1|469031_471920_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.0	2.8e-146
WP_004246185.1|471933_472383_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004246183.1|472463_473972_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	8.3e-49
>prophage 38
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	498950	501350	4090308		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_071425528.1|498950_501350_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.8	1.3e-14
>prophage 39
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	505515	508185	4090308		Cronobacter_phage(100.0%)	1	NA	NA
WP_071425453.1|505515_508185_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	1.8e-94
>prophage 40
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	517202	518351	4090308		Mycobacterium_phage(100.0%)	1	NA	NA
WP_017628751.1|517202_518351_-	RNA ligase RtcB family protein	NA	R4TNH6	Mycobacterium_phage	27.1	3.1e-27
>prophage 41
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	525851	532983	4090308		Micromonas_sp._RCC1109_virus(33.33%)	6	NA	NA
WP_071425791.1|525851_527546_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.4	1.2e-59
WP_063215746.1|527549_527834_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_004249537.1|527888_528785_-	cation transporter	NA	NA	NA	NA	NA
WP_004246138.1|528861_529440_-	helix-turn-helix transcriptional regulator	NA	A0A0K2FLD1	Brevibacillus_phage	41.7	8.2e-05
WP_012368785.1|529678_530866_+	MFS transporter	NA	NA	NA	NA	NA
WP_004246136.1|531636_532983_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.7	4.4e-158
>prophage 42
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	546795	550148	4090308		Micromonas_pusilla_virus(50.0%)	4	NA	NA
WP_004252913.1|546795_548433_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4QMK7	Micromonas_pusilla_virus	33.8	7.7e-40
WP_004246118.1|548558_548825_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_004249526.1|548828_549359_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004249525.1|549362_550148_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.2	3.6e-27
>prophage 43
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	559126	559747	4090308		Streptococcus_phage(100.0%)	1	NA	NA
WP_004249519.1|559126_559747_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.1	5.7e-20
>prophage 44
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	575407	576796	4090308		Leptospira_phage(100.0%)	1	NA	NA
WP_017827249.1|575407_576796_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	30.9	9.6e-60
>prophage 45
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	580175	580838	4090308		Bacillus_phage(100.0%)	1	NA	NA
WP_004245430.1|580175_580838_-	two-component system response regulator NarL	NA	W8CYM9	Bacillus_phage	28.3	5.9e-07
>prophage 46
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	588162	589716	4090308		Escherichia_phage(100.0%)	1	NA	NA
WP_004245426.1|588162_589716_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	33.3	2.4e-19
>prophage 47
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	606414	608733	4090308		Tupanvirus(50.0%)	2	NA	NA
WP_004245408.1|606414_607392_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	20.8	2.1e-05
WP_004245407.1|607653_608733_-	glycerophosphodiester phosphodiesterase	NA	A0A0U1WFD7	Staphylococcus_phage	38.1	1.6e-09
>prophage 48
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	616325	617465	4090308		Vibrio_phage(50.0%)	3	NA	NA
WP_004245400.1|616325_617000_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	58.9	3.6e-60
WP_004245398.1|617016_617214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245397.1|617210_617465_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	75.0	4.1e-09
>prophage 49
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	622562	625750	4090308		Streptococcus_phage(50.0%)	2	NA	NA
WP_017628206.1|622562_624953_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	39.7	2.8e-131
WP_004248875.1|625123_625750_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	44.2	5.0e-16
>prophage 50
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	629163	633238	4090308		Staphylococcus_phage(33.33%)	4	NA	NA
WP_004245385.1|629163_629829_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	9.4e-13
WP_004248880.1|629821_630799_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004245383.1|631140_631995_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.4	2.5e-42
WP_004245382.1|632089_633238_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.5	1.4e-43
>prophage 51
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	636699	637794	4090308		Planktothrix_phage(100.0%)	1	NA	NA
WP_017827053.1|636699_637794_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.6	2.0e-20
>prophage 52
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	654504	655548	4090308		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004245330.1|654504_655548_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.8	5.1e-05
>prophage 53
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	669442	678307	4090308		Thermobifida_phage(20.0%)	11	NA	NA
WP_004245308.1|669442_670297_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
WP_004245307.1|670381_670849_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004248916.1|671004_671292_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004248917.1|671315_672791_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004245304.1|672850_673576_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_004245303.1|673582_674116_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004245302.1|674096_674675_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_071425939.1|674692_675250_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.1	1.1e-51
WP_036971302.1|675277_676252_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	7.3e-38
WP_004252691.1|676270_677251_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004245298.1|677494_678307_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.2	3.0e-21
>prophage 54
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	683629	686283	4090308		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_004245290.1|683629_684700_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	36.5	3.4e-12
WP_004248924.1|684891_686283_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	3.2e-23
>prophage 55
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	690799	691309	4090308	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_004245280.1|690799_691309_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.2	2.0e-23
>prophage 56
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	702174	704511	4090308		Hokovirus(100.0%)	1	NA	NA
WP_004245272.1|702174_704511_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	29.0	4.0e-42
>prophage 57
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	713200	717008	4090308		Caulobacter_phage(50.0%)	4	NA	NA
WP_004245257.1|713200_713791_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	33.3	5.6e-09
WP_004245256.1|713813_714191_-	YraN family protein	NA	NA	NA	NA	NA
WP_071425589.1|714295_716068_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_004245252.1|716129_717008_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.9	1.8e-51
>prophage 58
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	729548	731258	4090308		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_071425368.1|729548_731258_-	ABC transporter ATP-binding protein/permease	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.0	1.1e-07
>prophage 59
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	736785	743401	4090308		Klosneuvirus(33.33%)	6	NA	NA
WP_004248950.1|736785_738453_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	25.6	1.9e-41
WP_071425367.1|738794_740714_+	murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	38.3	1.8e-08
WP_004248952.1|740815_741127_+	trp operon repressor	NA	NA	NA	NA	NA
WP_004248953.1|741216_741756_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_004245229.1|741807_742455_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_049256134.1|742498_743401_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	D0R0F8	Streptococcus_phage	35.2	1.5e-08
>prophage 60
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	760166	761120	4090308		Cyanophage(100.0%)	1	NA	NA
WP_004248961.1|760166_761120_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	8.8e-12
>prophage 61
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	772366	782904	4090308	tRNA	Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_017827374.1|772366_774292_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.2	1.6e-145
WP_071425924.1|774398_775535_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	30.2	2.8e-17
WP_004245211.1|776073_777252_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.9	1.9e-85
WP_004245210.1|777440_778358_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_004248964.1|778431_778692_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_004245208.1|779122_780064_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_071425468.1|780093_782904_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.5	1.7e-87
>prophage 62
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	786396	787560	4090308		Halovirus(100.0%)	1	NA	NA
WP_071425496.1|786396_787560_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.4	1.5e-50
>prophage 63
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	798875	799706	4090308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004245195.1|798875_799706_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.9	2.3e-64
>prophage 64
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	802834	804028	4090308		Orpheovirus(100.0%)	1	NA	NA
WP_004245190.1|802834_804028_-	cystathionine beta-lyase	NA	A0A2I2L687	Orpheovirus	22.1	4.6e-10
>prophage 65
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	818991	819900	4090308		Salmonella_phage(100.0%)	1	NA	NA
WP_004245172.1|818991_819900_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	56.2	2.4e-91
>prophage 66
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	827994	835176	4090308		Bacillus_phage(66.67%)	4	NA	NA
WP_071425652.1|827994_831720_-	AAA family ATPase	NA	G3MAB6	Bacillus_virus	24.2	6.5e-10
WP_071425651.1|831716_832949_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_004249004.1|833170_833860_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	40.7	6.1e-39
WP_004245160.1|833883_835176_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.5	3.4e-27
>prophage 67
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	855677	862558	4090308	tRNA	uncultured_Mediterranean_phage(60.0%)	7	NA	NA
WP_004245143.1|855677_856820_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.2	4.2e-93
WP_004245142.1|856906_857242_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.9e-10
WP_012367466.1|857274_859122_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004247209.1|859132_860101_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.1	2.0e-48
WP_004245139.1|860219_860669_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_012367467.1|860717_861875_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.8e-51
WP_004245137.1|862087_862558_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.7	1.6e-30
>prophage 68
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	869599	871108	4090308		Bacillus_virus(100.0%)	1	NA	NA
WP_071425391.1|869599_871108_-	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	9.3e-16
>prophage 69
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	888102	889476	4090308		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_071425677.1|888102_889476_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.0	1.7e-61
>prophage 70
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	894261	899410	4090308	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_004245088.1|894261_894885_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	64.1	2.9e-64
WP_004245087.1|895029_896301_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.8	7.3e-131
WP_004245086.1|896558_898913_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	5.2e-223
WP_004245085.1|899119_899410_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	60.7	2.4e-21
>prophage 71
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	903396	908290	4090308		Bacillus_phage(66.67%)	4	NA	NA
WP_004252552.1|903396_904095_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	65.6	2.4e-83
WP_004245080.1|904252_904714_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071425608.1|904770_906516_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.3	1.3e-53
WP_071425609.1|906502_908290_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	2.8e-43
>prophage 72
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	923070	925826	4090308		Klosneuvirus(50.0%)	2	NA	NA
WP_012367485.1|923070_923622_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.8	9.5e-27
WP_004247250.1|923849_925826_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.8	3.0e-46
>prophage 73
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	946980	951765	4090308		Mamastrovirus(33.33%)	4	NA	NA
WP_004245040.1|946980_948561_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	53.2	3.6e-18
WP_004245039.1|948719_949262_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.3	1.7e-15
WP_004245038.1|949321_949975_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_071425556.1|950823_951765_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	2.7e-21
>prophage 74
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	956938	957490	4090308		Escherichia_phage(100.0%)	1	NA	NA
WP_004245030.1|956938_957490_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.2	7.2e-35
>prophage 75
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	965096	965393	4090308		Morganella_phage(100.0%)	1	NA	NA
WP_004245017.1|965096_965393_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	41.4	1.4e-05
>prophage 76
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	971956	972997	4090308		Bacillus_virus(100.0%)	1	NA	NA
WP_004245012.1|971956_972997_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.1e-31
>prophage 77
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	982945	988885	4090308		unidentified_phage(50.0%)	5	NA	NA
WP_071531022.1|982945_984529_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.3	7.4e-24
WP_004244999.1|984616_984946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244998.1|985007_985463_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004244997.1|985659_986370_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_012367502.1|986455_988885_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	31.7	4.5e-44
>prophage 78
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	992992	993337	4090308		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004244992.1|992992_993337_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	2.0e-27
>prophage 79
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	997155	998481	4090308		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004247291.1|997155_998481_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.0	4.6e-35
>prophage 80
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1002196	1005200	4090308		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_004244983.1|1002196_1003834_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	9.7e-152
WP_004244982.1|1003898_1005200_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	58.2	6.8e-132
>prophage 81
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1008813	1013056	4090308		Lactobacillus_virus(33.33%)	5	NA	NA
WP_004247297.1|1008813_1010148_-	murein transglycosylase D	NA	C1KFN7	Lactobacillus_virus	37.4	1.4e-07
WP_004252479.1|1010221_1010977_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004244976.1|1011014_1011728_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004244975.1|1011752_1012232_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.4	1.2e-49
WP_004247299.1|1012297_1013056_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.4	5.5e-41
>prophage 82
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1020672	1021467	4090308		Bacillus_virus(100.0%)	1	NA	NA
WP_071425296.1|1020672_1021467_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	8.6e-13
>prophage 83
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1026604	1029036	4090308		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_071425423.1|1026604_1028008_+	Y4yA family PLP-dependent enzyme	NA	A0A0P0YN97	Yellowstone_lake_phycodnavirus	25.5	6.9e-05
WP_004244961.1|1028019_1029036_+	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	33.8	6.0e-35
>prophage 84
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1039100	1039313	4090308		Enterococcus_phage(100.0%)	1	NA	NA
WP_004244951.1|1039100_1039313_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	62.2	1.0e-05
>prophage 85
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1043281	1045285	4090308		Vibrio_phage(100.0%)	1	NA	NA
WP_004244946.1|1043281_1045285_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.0	8.0e-23
>prophage 86
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1056224	1057676	4090308		Morganella_phage(50.0%)	2	NA	NA
WP_004244929.1|1056224_1056545_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	41.8	1.1e-06
WP_004247323.1|1057109_1057676_-	phase variation DNA invertase MrpI	NA	A0A2L1IV36	Escherichia_phage	52.4	2.0e-51
>prophage 87
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1065466	1065790	4090308		Morganella_phage(100.0%)	1	NA	NA
WP_004244917.1|1065466_1065790_+	transcriptional regulator MrpJ	NA	A0A1W6JNW5	Morganella_phage	55.3	1.6e-05
>prophage 88
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1074071	1117032	4090308	transposase,protease	Bacillus_phage(66.67%)	35	NA	NA
WP_004252439.1|1074071_1075811_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.0	1.4e-28
WP_004247335.1|1075973_1077449_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_132587856.1|1078091_1080155_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_132587854.1|1080383_1082348_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_087726703.1|1082654_1084619_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_132587862.1|1084775_1085192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147715600.1|1085265_1087188_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_004244894.1|1087654_1088539_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004247342.1|1088532_1089789_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_004247343.1|1090157_1091543_-	glycoporin	NA	NA	NA	NA	NA
WP_004252426.1|1091597_1092242_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_071425871.1|1092234_1094952_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_004247346.1|1094977_1096399_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_004244888.1|1096517_1097486_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_004244887.1|1097648_1098101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132587753.1|1098097_1098922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247348.1|1099562_1099847_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247349.1|1099991_1100552_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_036919880.1|1100740_1101313_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004247351.1|1101373_1103896_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_004247352.1|1103931_1104663_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004247353.1|1104694_1105123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004252417.1|1105115_1105649_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004247355.1|1105648_1106185_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_132587755.1|1106197_1107349_+	adhesin	NA	NA	NA	NA	NA
WP_071425598.1|1107467_1108160_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004247370.1|1108289_1109618_-	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_036905869.1|1109681_1111844_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_107034653.1|1112218_1112326_-	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_004252397.1|1112684_1113425_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_036919898.1|1113473_1114052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244841.1|1114055_1114325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132587757.1|1114551_1114725_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004247373.1|1115042_1115291_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
WP_049210102.1|1115961_1117032_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A1P8CWQ1	Bacillus_phage	38.1	4.9e-11
>prophage 89
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1123833	1124427	4090308		Ugandan_cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_060555290.1|1123833_1124427_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	33.0	4.8e-16
>prophage 90
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1138995	1139574	4090308		Caulobacter_phage(100.0%)	1	NA	NA
WP_004244807.1|1138995_1139574_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.5e-14
>prophage 91
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1158176	1160545	4090308		Streptococcus_phage(100.0%)	2	NA	NA
WP_004247396.1|1158176_1159280_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.0	9.7e-63
WP_004244786.1|1159291_1160545_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.9	1.6e-98
>prophage 92
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1164699	1170316	4090308	tRNA	Pseudomonas_phage(25.0%)	4	NA	NA
WP_004244782.1|1164699_1165206_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	43.4	3.9e-27
WP_004247401.1|1165313_1166381_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.5	1.8e-114
WP_071425780.1|1167282_1169910_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.0	9.9e-82
WP_004244778.1|1170127_1170316_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	63.2	1.3e-12
>prophage 93
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1180194	1181289	4090308		Klebsiella_phage(100.0%)	1	NA	NA
WP_004247405.1|1180194_1181289_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	51.7	1.0e-88
>prophage 94
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1189525	1192102	4090308		Cronobacter_phage(100.0%)	1	NA	NA
WP_004244758.1|1189525_1192102_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	38.0	5.8e-127
>prophage 95
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1219481	1231990	4090308		Mycobacterium_phage(22.22%)	13	NA	NA
WP_004246075.1|1219481_1220681_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|1221290_1222259_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_071425933.1|1222284_1224411_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.2	5.8e-205
WP_071425934.1|1224439_1224844_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A076GDF1	Bacillus_phage	35.3	8.5e-09
WP_004246071.1|1224855_1225080_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1225362_1225836_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1226033_1226243_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246058.1|1226701_1227076_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1227091_1228057_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_036908311.1|1228158_1228803_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1229164_1229428_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1229626_1230838_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
WP_147715601.1|1230964_1231990_-	endolytic peptidoglycan transglycosylase RlpA	NA	H2BCY4	Synechococcus_phage	45.5	2.0e-06
>prophage 96
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1239265	1242933	4090308	tRNA	Staphylococcus_phage(50.0%)	2	NA	NA
WP_071425442.1|1239265_1241848_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.2	8.3e-190
WP_004246043.1|1242207_1242933_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.6e-29
>prophage 97
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1248953	1249457	4090308		Streptomyces_phage(100.0%)	1	NA	NA
WP_004252236.1|1248953_1249457_+	protein disulfide oxidoreductase	NA	A0A1J0GW78	Streptomyces_phage	36.8	9.3e-05
>prophage 98
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1253168	1254230	4090308		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004246031.1|1253168_1254230_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.2	2.5e-47
>prophage 99
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1258021	1259134	4090308		Synechococcus_phage(100.0%)	1	NA	NA
WP_004246024.1|1258021_1259134_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	7.3e-34
>prophage 100
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1266785	1313374	4090308	integrase,terminase,tail,lysis	Morganella_phage(46.67%)	63	1266699:1266717	1320281:1320299
1266699:1266717	attL	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
WP_026090525.1|1266785_1267787_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	9.7e-70
WP_004247454.1|1267743_1267989_-	excisionase	NA	NA	NA	NA	NA
WP_017628832.1|1267985_1268324_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	44.0	2.1e-13
WP_017628830.1|1268650_1268911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628829.1|1268962_1269415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049237126.1|1269488_1269668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628827.1|1269697_1269964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049237122.1|1270014_1270554_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	59.7	3.0e-57
WP_017628825.1|1270543_1271428_-	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	52.0	1.9e-61
WP_017628824.1|1271429_1271750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628822.1|1271895_1272150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628820.1|1272366_1272627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628819.1|1272826_1273324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049256529.1|1273345_1273663_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	5.5e-19
WP_004247474.1|1274083_1274593_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_004247475.1|1274589_1275714_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_004245991.1|1275839_1276181_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	62.8	2.1e-37
WP_004247476.1|1276189_1276834_-	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	64.5	9.6e-79
WP_004247477.1|1276939_1277149_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_004247478.1|1277294_1277642_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_012367617.1|1277907_1278675_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_012367618.1|1278674_1280060_+	helicase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_049195179.1|1280085_1280535_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|1280613_1280904_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1280900_1281257_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004247487.1|1281256_1281889_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	7.3e-23
WP_004247148.1|1282199_1282721_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_135090782.1|1282879_1283302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334538.1|1283355_1283625_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_036976681.1|1283624_1284095_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	2.6e-49
WP_132587802.1|1284237_1284699_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	1.3e-24
WP_004247494.1|1285046_1285631_+	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_004245979.1|1285627_1285834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245977.1|1286016_1286625_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.4e-65
WP_132587800.1|1286627_1288112_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	88.1	6.7e-269
WP_017628802.1|1288113_1289490_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.6	9.1e-212
WP_017628801.1|1289498_1290563_+	hypothetical protein	NA	A0A1W6JNT7	Morganella_phage	51.4	9.2e-103
WP_017628800.1|1290637_1291324_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
WP_017827430.1|1291329_1292280_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.1	1.3e-153
WP_017628798.1|1292322_1292700_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
WP_017628797.1|1292701_1293043_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	79.6	1.2e-51
WP_087726542.1|1293045_1293414_+	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	83.6	3.3e-52
WP_017628795.1|1293410_1293782_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	1.5e-47
WP_017628794.1|1293846_1294602_+	hypothetical protein	NA	A0A1W6JNT1	Morganella_phage	81.7	4.7e-109
WP_063109153.1|1294651_1295344_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.5	4.4e-90
WP_017628792.1|1295386_1295758_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	65.7	3.4e-36
WP_004247510.1|1295771_1295954_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
WP_132587798.1|1296333_1297704_+	Fic family protein	NA	NA	NA	NA	NA
WP_132587796.1|1297879_1298563_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	32.1	8.7e-30
WP_132587794.1|1298572_1299028_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	50.4	1.5e-22
WP_109395733.1|1299157_1299334_+	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	69.2	1.1e-13
WP_132587792.1|1299375_1299948_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	54.0	3.6e-29
WP_132587804.1|1300067_1300820_+	phage antirepressor protein	NA	A0A2I7RX10	Vibrio_phage	41.6	5.4e-41
WP_060556273.1|1300942_1301665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132587788.1|1301732_1304882_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	51.0	1.3e-99
WP_017628783.1|1305690_1306020_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
WP_036908262.1|1306016_1306715_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.2	3.1e-115
WP_017628781.1|1306718_1307438_+	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.9	2.8e-111
WP_017628780.1|1307374_1307941_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	76.7	3.1e-49
WP_132587786.1|1307940_1312086_+	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.3	0.0e+00
WP_004245936.1|1312079_1312448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367646.1|1312449_1313064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|1313113_1313374_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
1320281:1320299	attR	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
>prophage 101
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1319951	1322004	4090308	tRNA	Proteus_phage(50.0%)	2	NA	NA
WP_004244376.1|1319951_1320092_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	89.1	4.7e-15
WP_012367653.1|1320336_1322004_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
>prophage 102
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1326308	1330467	4090308		Mycobacterium_phage(50.0%)	4	NA	NA
WP_017628481.1|1326308_1327094_-	esterase	NA	A0A1L5C1K3	Mycobacterium_phage	36.1	1.3e-05
WP_004244392.1|1327558_1328110_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_036919970.1|1328184_1329828_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_012367657.1|1329984_1330467_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	52.4	9.4e-39
>prophage 103
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1334861	1336016	4090308		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004244403.1|1334861_1336016_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	43.0	1.0e-62
>prophage 104
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1348632	1350399	4090308		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004244416.1|1348632_1350399_+	succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.5	5.8e-17
>prophage 105
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1372431	1384220	4090308		Vibrio_phage(25.0%)	6	NA	NA
WP_004244441.1|1372431_1373160_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	34.0	1.1e-22
WP_004244442.1|1373403_1374462_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.3	5.2e-82
WP_004244443.1|1374534_1375287_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004247554.1|1375637_1377104_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	27.6	7.9e-12
WP_129623709.1|1377279_1378839_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_132587831.1|1378853_1384220_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	38.9	6.2e-06
>prophage 106
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1389394	1393817	4090308		Planktothrix_phage(50.0%)	4	NA	NA
WP_004244454.1|1389394_1390459_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	31.7	6.3e-19
WP_012367674.1|1390523_1391345_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_071425545.1|1391493_1392483_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_017827749.1|1392539_1393817_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.2	6.4e-18
>prophage 107
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1401289	1402225	4090308		Streptococcus_phage(100.0%)	1	NA	NA
WP_060554565.1|1401289_1402225_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.0	5.2e-25
>prophage 108
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1408176	1413377	4090308		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_004247572.1|1408176_1409946_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	4.1e-23
WP_004247573.1|1409966_1410953_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_004247574.1|1410970_1411669_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_012367680.1|1411979_1413377_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.2	2.9e-56
>prophage 109
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1423965	1428736	4090308		Bacillus_phage(33.33%)	4	NA	NA
WP_071425826.1|1423965_1426074_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.6	5.8e-48
WP_004244496.1|1426134_1426641_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YTY5	Streptomyces_phage	26.3	2.6e-07
WP_004244497.1|1426918_1427809_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_004244498.1|1428157_1428736_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	37.1	4.5e-19
>prophage 110
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1434775	1435438	4090308		Vibrio_phage(100.0%)	1	NA	NA
WP_004244504.1|1434775_1435438_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	56.4	7.6e-55
>prophage 111
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1441773	1446630	4090308	tRNA	Catovirus(66.67%)	4	NA	NA
WP_071425301.1|1441773_1443801_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.0	6.0e-26
WP_004247590.1|1444005_1445118_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004247591.1|1445330_1445972_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	2.0e-36
WP_004244515.1|1446048_1446630_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
>prophage 112
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1450557	1456640	4090308	tRNA	Moraxella_phage(33.33%)	5	NA	NA
WP_004247594.1|1450557_1452138_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.3	3.8e-36
WP_004247595.1|1452382_1453789_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.7	8.6e-32
WP_036894512.1|1453908_1454415_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_004244521.1|1454728_1455880_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_004247598.1|1456022_1456640_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.1	1.6e-14
>prophage 113
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1462252	1466456	4090308		Cellulophaga_phage(50.0%)	5	NA	NA
WP_004252065.1|1462252_1463152_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	86.8	5.0e-09
WP_113707127.1|1463303_1463351_-	his operon leader peptide	NA	NA	NA	NA	NA
WP_004247604.1|1463657_1464479_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004244532.1|1464475_1465096_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004247605.1|1465253_1466456_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	50.1	4.0e-102
>prophage 114
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1473840	1479436	4090308		Vibrio_phage(33.33%)	8	NA	NA
WP_004244541.1|1473840_1474104_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	6.5e-26
WP_004247610.1|1474274_1474577_+	YbjC family protein	NA	NA	NA	NA	NA
WP_004244546.1|1474747_1475251_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_036971346.1|1475279_1476413_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.2	3.5e-23
WP_004244548.1|1476555_1477224_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_036971348.1|1477223_1477928_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004244550.1|1477958_1478693_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012367698.1|1478707_1479436_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	8.4e-31
>prophage 115
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1485229	1504955	4090308	tRNA,protease	uncultured_Mediterranean_phage(20.0%)	14	NA	NA
WP_049203580.1|1485229_1487173_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	6.5e-38
WP_004244557.1|1487335_1487545_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	1.4e-15
WP_004244558.1|1487834_1488149_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_071425474.1|1488179_1490474_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.7e-170
WP_004244560.1|1490593_1490812_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_049203584.1|1491131_1491824_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244562.1|1491825_1493577_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_017628444.1|1493579_1495349_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004244564.1|1495487_1496447_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	9.0e-65
WP_004244566.1|1496989_1497484_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_147715602.1|1497611_1501454_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1501566_1502172_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|1502182_1503532_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|1503665_1504955_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
>prophage 116
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1508252	1511383	4090308		Tetraselmis_virus(100.0%)	2	NA	NA
WP_004244575.1|1508252_1508993_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1509100_1511383_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
>prophage 117
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1517460	1520116	4090308		Mycobacterium_phage(50.0%)	2	NA	NA
WP_004247627.1|1517460_1518891_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.6	2.0e-07
WP_004244582.1|1519027_1520116_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
>prophage 118
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1524484	1529364	4090308		Bacillus_phage(66.67%)	4	NA	NA
WP_004244587.1|1524484_1524772_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_132587563.1|1524828_1525008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132587565.1|1525212_1527582_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	2.7e-22
WP_004244589.1|1527618_1529364_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
>prophage 119
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1541321	1541975	4090308		Escherichia_phage(100.0%)	1	NA	NA
WP_060554589.1|1541321_1541975_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.9	2.4e-101
>prophage 120
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1548723	1556035	4090308	tRNA	Enterobacteria_phage(25.0%)	5	NA	NA
WP_147715606.1|1548723_1549839_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.2	3.3e-95
WP_004244664.1|1550183_1551584_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.4	1.5e-81
WP_004244665.1|1551657_1551849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244666.1|1551863_1553078_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.7	1.6e-42
WP_071425420.1|1553419_1556035_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.6	7.5e-21
>prophage 121
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1562999	1564931	4090308		Tupanvirus(100.0%)	1	NA	NA
WP_004244674.1|1562999_1564931_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	4.3e-50
>prophage 122
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1578582	1580634	4090308		Bacillus_phage(100.0%)	1	NA	NA
WP_071425906.1|1578582_1580634_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.4	8.7e-17
>prophage 123
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1585112	1588263	4090308		Indivirus(100.0%)	4	NA	NA
WP_004247010.1|1585112_1586057_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	45.3	1.3e-07
WP_004247011.1|1586056_1586362_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_004251908.1|1586506_1587403_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004247787.1|1587459_1588263_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	39.1	8.1e-43
>prophage 124
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1593547	1595143	4090308		Morganella_phage(100.0%)	2	NA	NA
WP_004247021.1|1593547_1593760_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	81.4	1.1e-26
WP_017827330.1|1594216_1595143_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	65.5	2.7e-98
>prophage 125
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1602665	1640724	4090308	integrase,terminase,head	Burkholderia_phage(25.0%)	49	1594370:1594385	1641322:1641337
1594370:1594385	attL	ATTAAAAGAAGAGTTT	NA	NA	NA	NA
WP_129623475.1|1602665_1603841_-|integrase	site-specific integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	29.2	4.7e-31
WP_036908181.1|1603842_1604055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071425285.1|1604029_1604227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250516.1|1604668_1604848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071425284.1|1604895_1605396_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	57.1	5.6e-42
WP_071425283.1|1605395_1607360_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	38.9	1.3e-118
WP_004250523.1|1607372_1607633_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_036908171.1|1607632_1607965_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	2.1e-05
WP_004250527.1|1608421_1609180_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	39.0	1.5e-27
WP_004250529.1|1609284_1609542_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020945464.1|1609582_1610038_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	9.9e-30
WP_004250533.1|1610055_1610280_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_053087953.1|1610281_1611112_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	59.3	4.4e-36
WP_071425613.1|1611101_1612520_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	60.8	5.8e-169
WP_049211158.1|1612575_1612914_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.0	1.3e-29
WP_049211160.1|1612975_1613839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049211162.1|1613975_1614569_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.2	5.6e-57
WP_071425521.1|1614580_1614892_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	1.0e-33
WP_071425522.1|1614926_1615478_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	42.0	5.0e-28
WP_071425523.1|1615630_1617037_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_036895369.1|1617128_1617398_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	7.4e-17
WP_071425524.1|1617397_1617868_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	58.6	3.4e-49
WP_075206279.1|1618383_1618563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049219151.1|1618613_1619318_+	DUF4145 domain-containing protein	NA	A0A1S5S8Y9	Streptococcus_phage	45.0	1.5e-37
WP_071425525.1|1619391_1620414_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	38.5	4.2e-36
WP_071425526.1|1620535_1621012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071425655.1|1621294_1622692_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	2.5e-84
WP_071425656.1|1622696_1624199_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.8	9.3e-101
WP_036964718.1|1624236_1624950_+|head	head protein	head	A0A2H5BG15	Pseudoalteromonas_phage	34.7	1.5e-32
WP_071425657.1|1624946_1626206_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.2e-45
WP_049209851.1|1626205_1626703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250578.1|1626702_1627770_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
WP_071425658.1|1627839_1628181_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	33.6	2.7e-08
WP_081355097.1|1628183_1628615_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.0	9.7e-11
WP_071425660.1|1628614_1629073_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	37.6	1.4e-12
WP_071425661.1|1629072_1629444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071425662.1|1629430_1629946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071425663.1|1629954_1631442_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.9	6.6e-83
WP_004250586.1|1631452_1631905_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_071425664.1|1631945_1632404_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	8.7e-26
WP_071425665.1|1632487_1634839_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	27.7	2.4e-18
WP_071425666.1|1634835_1635363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020945489.1|1635362_1635680_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	3.3e-08
WP_071425667.1|1635645_1636461_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.0	2.4e-10
WP_071425668.1|1636463_1637156_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	40.1	3.7e-28
WP_004250600.1|1637152_1637497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071425669.1|1637489_1638677_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.6	1.5e-69
WP_071425670.1|1638673_1639330_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	7.5e-39
WP_071425671.1|1639335_1640724_+	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	35.3	1.1e-15
1641322:1641337	attR	AAACTCTTCTTTTAAT	NA	NA	NA	NA
>prophage 126
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1644310	1651369	4090308		Vibrio_phage(50.0%)	7	NA	NA
WP_017827324.1|1644310_1645315_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	1.6e-85
WP_004247799.1|1645398_1645683_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_004251887.1|1645823_1647587_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.2	3.1e-95
WP_004247801.1|1647781_1648486_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_004247802.1|1648521_1649706_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.9	3.6e-23
WP_004247049.1|1650221_1650569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247050.1|1650754_1651369_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A0A8WIF2	Clostridium_phage	33.9	2.0e-09
>prophage 127
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1656568	1657414	4090308		Catovirus(100.0%)	1	NA	NA
WP_036920075.1|1656568_1657414_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.7	9.4e-26
>prophage 128
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1662111	1664118	4090308		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004247813.1|1662111_1664118_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	27.6	3.1e-11
>prophage 129
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1669763	1671413	4090308		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_071425794.1|1669763_1671413_-	alpha-keto acid decarboxylase family protein	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.3	9.2e-17
>prophage 130
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1689525	1690654	4090308		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_004247085.1|1689525_1690260_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	7.2e-14
WP_004247087.1|1690417_1690654_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	50.0	1.5e-10
>prophage 131
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1693984	1694629	4090308		Erwinia_phage(100.0%)	1	NA	NA
WP_004247091.1|1693984_1694629_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	35.9	7.0e-21
>prophage 132
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1708447	1711347	4090308		Planktothrix_phage(50.0%)	3	NA	NA
WP_004247832.1|1708447_1709152_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.8	2.5e-32
WP_004247833.1|1709151_1710399_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_004247834.1|1710489_1711347_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	31.9	1.9e-21
>prophage 133
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1716870	1780288	4090308	integrase,tail,capsid,terminase,tRNA,protease,lysis,transposase,portal,head	Morganella_phage(16.67%)	77	1738923:1738938	1781947:1781962
WP_049208634.1|1716870_1718241_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	2.2e-112
WP_004247840.1|1718273_1718903_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004247117.1|1718905_1720009_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_036918198.1|1720114_1720567_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_071425327.1|1720559_1721189_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|1721327_1722581_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_004251675.1|1722701_1723829_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.6	3.7e-126
WP_004251672.1|1723809_1724052_-	excisionase	NA	NA	NA	NA	NA
WP_004247124.1|1724113_1724644_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
WP_004247125.1|1724700_1725528_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_004247126.1|1725593_1725968_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_004247127.1|1725991_1726174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247128.1|1726616_1727099_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
WP_004247129.1|1727202_1727442_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
WP_004247130.1|1727526_1727985_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
WP_004247132.1|1728273_1728453_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
WP_132587572.1|1728465_1729557_+	replication protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
WP_071425535.1|1729728_1730436_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.3	2.1e-55
WP_004247135.1|1730435_1731461_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247136.1|1731488_1731887_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247137.1|1732229_1732442_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247148.1|1732843_1733365_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|1733688_1734024_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_071425729.1|1734127_1735054_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_036908073.1|1735470_1735899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894738.1|1736051_1736303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905789.1|1736746_1737016_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
WP_036900946.1|1737015_1737486_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_132587821.1|1737628_1738060_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.1	4.7e-21
1738923:1738938	attL	GATAGCCATCAGTTAA	NA	NA	NA	NA
WP_001967215.1|1738986_1739325_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_036905782.1|1739327_1739540_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.1e-07
WP_036905779.1|1739663_1740131_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
WP_012367783.1|1740084_1741818_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.5	6.9e-148
WP_132587819.1|1741817_1743086_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.0	1.5e-200
WP_004251596.1|1743103_1743772_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
WP_004251594.1|1743775_1744942_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	5.6e-170
WP_004251590.1|1744980_1745280_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
WP_004251588.1|1745279_1745609_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_071425492.1|1745598_1746072_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	32.3	1.9e-12
WP_124743708.1|1746077_1746419_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004251580.1|1746428_1747094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132587817.1|1747158_1747575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894769.1|1747571_1747850_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1747874_1748066_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_049200984.1|1748192_1751468_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	45.6	1.1e-53
WP_132587815.1|1751468_1752065_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	1.6e-51
WP_004251564.1|1752064_1752646_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-52
WP_071425311.1|1752657_1752963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251558.1|1752994_1753393_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
WP_017627865.1|1757107_1757440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017627864.1|1757439_1758126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049202079.1|1758122_1758389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726588.1|1758405_1758666_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	56.4	1.6e-16
WP_036905765.1|1759369_1759675_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036905763.1|1760640_1762044_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_132587838.1|1763560_1763725_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.5	1.6e-19
WP_036970219.1|1764021_1765149_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	59.3	3.7e-118
WP_049206746.1|1765129_1765372_-	excisionase	NA	NA	NA	NA	NA
WP_108717285.1|1765628_1766276_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	44.0	3.7e-46
WP_063073918.1|1766606_1767680_+	hypothetical protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	36.3	6.4e-27
WP_004247847.1|1767692_1768091_+	antitermination protein Q	NA	B6SCZ7	Bacteriophage	55.3	4.6e-31
WP_012367807.1|1768312_1768573_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247849.1|1768727_1768985_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247850.1|1768990_1769263_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	67.2	1.3e-16
WP_132587840.1|1769588_1769777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247854.1|1769914_1770193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109372922.1|1771805_1772000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129623718.1|1772073_1773096_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	70.4	3.1e-132
WP_012367809.1|1773370_1774360_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_041707125.1|1774395_1774977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132587858.1|1775338_1776862_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.9	2.7e-79
WP_132587860.1|1776946_1777291_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.5	3.1e-20
WP_008914069.1|1777287_1777584_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012367812.1|1778213_1778795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132587620.1|1779182_1779680_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_129623719.1|1779808_1779973_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.3e-21
WP_049210464.1|1780129_1780288_-|transposase	transposase	transposase	NA	NA	NA	NA
1781947:1781962	attR	GATAGCCATCAGTTAA	NA	NA	NA	NA
>prophage 134
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1784630	1784843	4090308		Morganella_phage(100.0%)	1	NA	NA
WP_004247907.1|1784630_1784843_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
>prophage 135
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1790823	1792704	4090308		uncultured_marine_virus(50.0%)	2	NA	NA
WP_049219703.1|1790823_1791465_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	4.2e-50
WP_049210503.1|1791477_1792704_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.2	4.5e-61
>prophage 136
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1799424	1806671	4090308		Morganella_phage(50.0%)	10	NA	NA
WP_004242541.1|1799424_1799985_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	50.6	1.9e-19
WP_004242542.1|1800360_1800558_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_004242544.1|1800575_1801352_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_132587619.1|1801586_1801970_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	48.7	6.2e-25
WP_004247922.1|1802112_1802976_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004247923.1|1803102_1803534_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	38.1	1.8e-20
WP_049203866.1|1803706_1804444_+	phosphatase	NA	NA	NA	NA	NA
WP_062814328.1|1804530_1805079_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_004242555.1|1805530_1805926_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_004242557.1|1806236_1806671_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.5	7.7e-24
>prophage 137
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1809683	1810025	4090308		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004242565.1|1809683_1810025_+	YebY family protein	NA	A0A2H4JCQ9	uncultured_Caudovirales_phage	32.7	1.5e-06
>prophage 138
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1815878	1817939	4090308		Moraxella_phage(100.0%)	1	NA	NA
WP_071425926.1|1815878_1817939_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	2.1e-82
>prophage 139
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1824387	1824954	4090308		Bacillus_phage(100.0%)	1	NA	NA
WP_004242580.1|1824387_1824954_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.8	2.3e-07
>prophage 140
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1829504	1830392	4090308		Klosneuvirus(100.0%)	1	NA	NA
WP_004251467.1|1829504_1830392_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.2	1.4e-08
>prophage 141
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1836588	1850075	4090308	tRNA	Tupanvirus(62.5%)	13	NA	NA
WP_004242605.1|1836588_1838517_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	8.0e-129
WP_012367833.1|1838520_1839060_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	2.8e-15
WP_004242608.1|1839154_1839352_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004242609.1|1839395_1839752_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_120655563.1|1839852_1839900_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004242610.1|1840076_1841060_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	3.8e-34
WP_004247944.1|1841074_1843462_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004242612.1|1843466_1843763_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_071425802.1|1844047_1845082_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004242614.1|1845083_1845833_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.0	3.0e-07
WP_004247945.1|1845967_1847113_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.0	1.9e-37
WP_004242618.1|1847112_1848093_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.1	5.6e-38
WP_071425269.1|1848092_1850075_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.8	1.3e-20
>prophage 142
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1853523	1854015	4090308		Bacillus_phage(100.0%)	1	NA	NA
WP_017628170.1|1853523_1854015_+	membrane protein	NA	S5MM68	Bacillus_phage	40.5	9.1e-13
>prophage 143
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1876788	1877736	4090308		Tupanvirus(100.0%)	1	NA	NA
WP_004242665.1|1876788_1877736_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	1.7e-44
>prophage 144
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1880865	1887663	4090308		Pseudomonas_phage(33.33%)	7	NA	NA
WP_004242680.1|1880865_1881948_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	5.1e-08
WP_004251398.1|1881947_1882796_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004242688.1|1882773_1883589_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004242689.1|1883646_1884501_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.1	7.5e-47
WP_004242691.1|1884508_1885438_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_004242693.1|1885516_1885795_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004242694.1|1885962_1887663_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.2	2.7e-32
>prophage 145
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1900232	1901963	4090308	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_071425683.1|1900232_1901963_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.3	4.7e-88
>prophage 146
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1905607	1919440	4090308	tRNA	Tupanvirus(28.57%)	14	NA	NA
WP_049203847.1|1905607_1907170_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	24.5	2.4e-19
WP_004242717.1|1907506_1908481_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_004242718.1|1908483_1909233_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	29.5	4.3e-14
WP_004242719.1|1909417_1909816_-	membrane protein	NA	NA	NA	NA	NA
WP_004247980.1|1910083_1911868_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	38.4	7.1e-07
WP_004242723.1|1911868_1912306_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004242729.1|1912334_1913090_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004242730.1|1913214_1913736_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	29.0	5.3e-11
WP_004242731.1|1913838_1914462_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004242732.1|1914474_1915485_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.8	6.9e-07
WP_004247983.1|1915576_1916362_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004242756.1|1916354_1917080_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	9.9e-16
WP_004242757.1|1917154_1918099_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_004242759.1|1918111_1919440_+	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	38.5	2.8e-16
>prophage 147
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1923480	1933334	4090308	tRNA	Cyanophage(33.33%)	8	NA	NA
WP_036918269.1|1923480_1924956_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.7	5.6e-82
WP_012367881.1|1925538_1925979_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_004247986.1|1925980_1926313_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_004242773.1|1927496_1927841_-	RidA family protein	NA	NA	NA	NA	NA
WP_080985736.1|1927926_1929864_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.6	1.1e-85
WP_017827470.1|1929957_1930659_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_004242776.1|1930749_1931343_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004242778.1|1931645_1933334_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	1.9e-33
>prophage 148
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1940275	1940926	4090308		Bacillus_virus(100.0%)	1	NA	NA
WP_004242790.1|1940275_1940926_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.4	2.7e-20
>prophage 149
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1946255	1947254	4090308		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_012367888.1|1946255_1947254_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	43.6	6.7e-63
>prophage 150
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1957655	1961552	4090308		Catovirus(100.0%)	1	NA	NA
WP_139213803.1|1957655_1961552_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.8	4.3e-57
>prophage 151
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1975540	1978563	4090308		Escherichia_phage(100.0%)	2	NA	NA
WP_036918287.1|1975540_1977937_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	39.2	1.4e-146
WP_004242832.1|1977933_1978563_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	54.1	3.2e-63
>prophage 152
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1987096	1988662	4090308		Bacillus_virus(100.0%)	1	NA	NA
WP_017628129.1|1987096_1988662_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	32.7	8.7e-41
>prophage 153
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	1996793	1997786	4090308	integrase	Thermus_phage(100.0%)	1	1988730:1988744	2001690:2001704
1988730:1988744	attL	AAAACCATCAAAAAG	NA	NA	NA	NA
WP_036971953.1|1996793_1997786_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	28.6	8.2e-13
WP_036971953.1|1996793_1997786_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	28.6	8.2e-13
2001690:2001704	attR	AAAACCATCAAAAAG	NA	NA	NA	NA
>prophage 154
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2008829	2018821	4090308		Escherichia_phage(66.67%)	8	NA	NA
WP_036918301.1|2008829_2010887_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
WP_049210314.1|2010898_2012599_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|2012934_2013621_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|2013620_2014082_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|2014134_2014746_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_004242891.1|2014885_2015746_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
WP_004242892.1|2015747_2016365_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628118.1|2016376_2018821_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 155
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2032003	2035077	4090308		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_071425602.1|2032003_2032867_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.4	2.7e-20
WP_004248055.1|2032911_2033241_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_004248056.1|2033334_2035077_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.2	9.0e-39
>prophage 156
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2045886	2051327	4090308		Mycobacterium_phage(50.0%)	4	NA	NA
WP_071425732.1|2045886_2047389_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.8	4.9e-33
WP_004248066.1|2047543_2048140_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_132587604.1|2048573_2049578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036971971.1|2049728_2051327_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.8	1.4e-57
>prophage 157
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2054531	2058132	4090308		Salmonella_phage(50.0%)	3	NA	NA
WP_049203340.1|2054531_2055716_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	5.2e-14
WP_036918319.1|2055841_2056633_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071425380.1|2056725_2058132_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	23.0	2.2e-11
>prophage 158
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2076937	2081744	4090308		Stenotrophomonas_phage(50.0%)	6	NA	NA
WP_080047847.1|2076937_2077993_-	hypothetical protein	NA	Q4LAU4	Stenotrophomonas_phage	29.6	7.2e-15
WP_036971992.1|2078008_2078296_-	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_132587848.1|2078299_2079751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132587846.1|2079842_2080082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971998.1|2080329_2080602_-	V protein	NA	NA	NA	NA	NA
WP_132587844.1|2080616_2081744_-	replication initiation protein	NA	A0A1W6UG38	Vibrio_phage	36.0	1.2e-52
>prophage 159
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2085977	2090784	4090308		Stenotrophomonas_phage(50.0%)	6	NA	NA
WP_080047847.1|2085977_2087033_-	hypothetical protein	NA	Q4LAU4	Stenotrophomonas_phage	29.6	7.2e-15
WP_036971992.1|2087048_2087336_-	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_132587848.1|2087339_2088791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132587846.1|2088882_2089122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971998.1|2089369_2089642_-	V protein	NA	NA	NA	NA	NA
WP_132587844.1|2089656_2090784_-	replication initiation protein	NA	A0A1W6UG38	Vibrio_phage	36.0	1.2e-52
>prophage 160
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2122492	2124436	4090308		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_071425315.1|2122492_2124436_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	29.5	9.5e-05
>prophage 161
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2128421	2129021	4090308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004243033.1|2128421_2129021_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.3	6.7e-42
>prophage 162
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2137292	2142521	4090308	protease	Salmonella_phage(33.33%)	4	NA	NA
WP_017628093.1|2137292_2137817_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	47.9	4.3e-37
WP_004248126.1|2137990_2140588_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.3	5.4e-88
WP_004243047.1|2140890_2141142_+	YciN family protein	NA	NA	NA	NA	NA
WP_004243049.1|2141474_2142521_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	33.9	1.7e-24
>prophage 163
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2150001	2152974	4090308		Acinetobacter_phage(100.0%)	3	NA	NA
WP_004243061.1|2150001_2150595_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	37.9	5.2e-31
WP_004243063.1|2150596_2151595_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	9.7e-54
WP_004248131.1|2151600_2152974_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.6	1.4e-39
>prophage 164
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2158206	2159991	4090308		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_046334290.1|2158206_2159991_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.6	2.9e-16
>prophage 165
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2164926	2168985	4090308	tRNA	Salmonella_phage(50.0%)	5	NA	NA
WP_132587747.1|2164926_2165463_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.8	6.4e-20
WP_004251044.1|2165815_2166205_+	VOC family protein	NA	NA	NA	NA	NA
WP_071425816.1|2166293_2166596_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_046334762.1|2167115_2167706_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004251032.1|2168064_2168985_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	89.5	1.2e-130
>prophage 166
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2186302	2192273	4090308	tRNA	Planktothrix_phage(66.67%)	6	NA	NA
WP_071425438.1|2186302_2187304_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.0	4.4e-06
WP_004243110.1|2187293_2188103_+	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
WP_004243111.1|2188311_2189100_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_071425437.1|2189318_2189930_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_004248153.1|2190008_2190878_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_004248155.1|2190998_2192273_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.8	3.6e-85
>prophage 167
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2202573	2208051	4090308		Enterobacteria_phage(25.0%)	5	NA	NA
WP_004243141.1|2202573_2203599_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.1	1.7e-32
WP_004243142.1|2203608_2204511_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004248166.1|2204630_2205848_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.0	1.5e-11
WP_004243144.1|2206150_2207305_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	46.6	2.5e-85
WP_004243145.1|2207394_2208051_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.2	3.2e-21
>prophage 168
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2218669	2223873	4090308		environmental_halophage(33.33%)	5	NA	NA
WP_004243160.1|2218669_2219911_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.6	1.7e-84
WP_004243162.1|2219917_2221225_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_004243163.1|2221199_2221946_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	30.9	9.3e-09
WP_071425574.1|2221990_2223487_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004248176.1|2223504_2223873_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	32.7	1.5e-12
>prophage 169
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2230292	2234923	4090308		Hokovirus(50.0%)	3	NA	NA
WP_071425432.1|2230292_2232668_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.2	3.3e-177
WP_004243173.1|2232886_2233753_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_004243174.1|2233873_2234923_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.3	1.4e-82
>prophage 170
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2242706	2243501	4090308		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_004243181.1|2242706_2243501_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.8	6.8e-10
>prophage 171
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2251290	2252076	4090308		Cronobacter_phage(100.0%)	1	NA	NA
WP_012367995.1|2251290_2252076_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	65.2	2.2e-85
>prophage 172
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2259394	2260780	4090308		Morganella_phage(100.0%)	3	NA	NA
WP_004243203.1|2259394_2259832_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.6	2.7e-24
WP_071425684.1|2259898_2260237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243205.1|2260351_2260780_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.7	1.4e-22
>prophage 173
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2264319	2277005	4090308	transposase,holin	Rock_bream_iridovirus(20.0%)	9	NA	NA
WP_036970736.1|2264319_2264784_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	35.8	3.2e-20
WP_147715603.1|2265369_2266578_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.5	3.0e-190
WP_017827793.1|2266617_2267895_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_135090948.1|2267884_2269135_-	cytosine permease	NA	NA	NA	NA	NA
WP_017827792.1|2269520_2271188_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.7	9.5e-54
WP_004243216.1|2271233_2272709_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004248206.1|2272733_2273336_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004248207.1|2273545_2275588_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.6	1.2e-21
WP_071425581.1|2275847_2277005_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X7QHI1	Faustovirus	29.3	4.2e-16
>prophage 174
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2283431	2286559	4090308		Morganella_phage(33.33%)	3	NA	NA
WP_012368005.1|2283431_2283767_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	46.7	3.5e-08
WP_004243227.1|2284565_2285573_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.5	1.1e-15
WP_004243228.1|2285569_2286559_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.8e-15
>prophage 175
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2300809	2302349	4090308		Planktothrix_phage(100.0%)	2	NA	NA
WP_004243241.1|2300809_2301646_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	2.2e-14
WP_071425829.1|2301635_2302349_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.2	2.2e-23
>prophage 176
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2307440	2318609	4090308		Klebsiella_phage(20.0%)	10	NA	NA
WP_004243248.1|2307440_2308037_-	thymidine kinase	NA	A0A2K9V5L3	Klebsiella_phage	59.0	3.6e-56
WP_004243249.1|2308546_2308951_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_017827788.1|2309180_2310188_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.4	1.9e-33
WP_004243251.1|2310443_2311349_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.5	1.9e-64
WP_012368013.1|2311530_2312550_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_004243253.1|2312672_2313164_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004243254.1|2313202_2314051_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.6	1.1e-13
WP_004248225.1|2314436_2315300_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_135090927.1|2315743_2316550_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_049236150.1|2316641_2318609_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.8	8.3e-41
>prophage 177
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2323888	2324530	4090308		Tupanvirus(100.0%)	1	NA	NA
WP_004248237.1|2323888_2324530_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.5	1.5e-23
>prophage 178
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2342674	2343055	4090308		uncultured_virus(100.0%)	1	NA	NA
WP_036907903.1|2342674_2343055_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	66.7	5.0e-19
>prophage 179
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2346467	2348300	4090308		Bacillus_phage(100.0%)	1	NA	NA
WP_004243286.1|2346467_2348300_-	excinuclease ABC subunit UvrC	NA	U5J9C9	Bacillus_phage	34.8	2.4e-05
>prophage 180
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2358042	2363458	4090308		Xanthomonas_phage(25.0%)	7	NA	NA
WP_004243300.1|2358042_2358756_-	RNA ligase family protein	NA	A0A292GKV8	Xanthomonas_phage	33.5	5.0e-20
WP_004248258.1|2359141_2359930_+	glucose 1-dehydrogenase	NA	H2EEJ0	Moumouvirus	25.9	1.7e-08
WP_071425773.1|2360028_2360583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243305.1|2360579_2360987_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_004243308.1|2361757_2362015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243309.1|2362122_2362815_+	helix-turn-helix transcriptional regulator	NA	E5AGE6	Erwinia_phage	46.6	1.1e-56
WP_049211492.1|2362834_2363458_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.5	9.1e-18
>prophage 181
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2367744	2374508	4090308		Caulobacter_phage(25.0%)	5	NA	NA
WP_012368027.1|2367744_2368797_-	nucleotidyltransferase	NA	A0A067XQU1	Caulobacter_phage	23.1	1.6e-06
WP_012368028.1|2368780_2369560_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.3	1.1e-31
WP_004250844.1|2369821_2371399_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004243391.1|2371483_2372950_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
WP_004243392.1|2373119_2374508_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.5	1.2e-38
>prophage 182
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2391921	2392635	4090308		Synechococcus_phage(100.0%)	1	NA	NA
WP_071425377.1|2391921_2392635_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	36.2	2.6e-37
>prophage 183
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2398937	2399294	4090308		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004243423.1|2398937_2399294_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.3	1.7e-13
>prophage 184
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2403871	2407823	4090308		Prochlorococcus_phage(66.67%)	4	NA	NA
WP_036918505.1|2403871_2405173_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	5.7e-62
WP_004248287.1|2405281_2405908_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004248288.1|2406139_2407180_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.6	3.0e-74
WP_071425374.1|2407193_2407823_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.1	2.8e-30
>prophage 185
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2417387	2418854	4090308		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004243443.1|2417387_2418854_-	dipeptide/tripeptide permease DtpA	NA	A0A0P0IY73	Acinetobacter_phage	30.0	3.7e-54
>prophage 186
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2426861	2430510	4090308	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_004243448.1|2426861_2428238_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	31.6	2.4e-34
WP_036970095.1|2428303_2429011_+	two-component system response regulator BaeR	NA	NA	NA	NA	NA
WP_004243450.1|2429130_2430510_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	82.1	2.7e-179
>prophage 187
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2441206	2447577	4090308		Rhizobium_phage(33.33%)	6	NA	NA
WP_049199184.1|2441206_2442091_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.8	3.3e-13
WP_004243466.1|2442221_2443691_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004243467.1|2445053_2445278_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	70.5	8.9e-16
WP_004248304.1|2445394_2445790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243469.1|2445887_2446070_-	YoaH family protein	NA	NA	NA	NA	NA
WP_012368046.1|2446182_2447577_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	39.6	3.6e-38
>prophage 188
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2452575	2454511	4090308		Morganella_phage(100.0%)	3	NA	NA
WP_004248314.1|2452575_2453019_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	32.0	3.2e-09
WP_017827497.1|2453127_2453946_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004248316.1|2454076_2454511_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	46.5	1.3e-26
>prophage 189
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2458682	2459696	4090308	integrase	Erwinia_phage(100.0%)	1	2454747:2454761	2471310:2471324
2454747:2454761	attL	AATGGTTTAACTCAA	NA	NA	NA	NA
WP_071425786.1|2458682_2459696_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	60.4	2.6e-115
WP_071425786.1|2458682_2459696_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	60.4	2.6e-115
2471310:2471324	attR	TTGAGTTAAACCATT	NA	NA	NA	NA
>prophage 190
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2492758	2493745	4090308		Clostridium_phage(100.0%)	1	NA	NA
WP_004243530.1|2492758_2493745_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RUS8	Clostridium_phage	39.1	3.6e-16
>prophage 191
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2508713	2514517	4090308		Bacillus_thuringiensis_phage(50.0%)	5	NA	NA
WP_004243551.1|2508713_2509103_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	3.5e-07
WP_004243552.1|2509162_2510215_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	35.9	1.2e-06
WP_004243555.1|2510207_2511098_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_071425595.1|2511104_2512751_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.0	5.0e-07
WP_004243557.1|2512810_2514517_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.6	6.8e-15
>prophage 192
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2523978	2525557	4090308		Bacillus_virus(50.0%)	3	NA	NA
WP_004248352.1|2523978_2524677_-	MgtC family protein	NA	G3MA03	Bacillus_virus	47.0	3.3e-16
WP_004243572.1|2525041_2525236_-	protein DsrB	NA	NA	NA	NA	NA
WP_004243573.1|2525344_2525557_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.6	9.9e-25
>prophage 193
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2530767	2533848	4090308		Escherichia_phage(100.0%)	1	NA	NA
WP_071425434.1|2530767_2533848_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	24.6	1.1e-07
>prophage 194
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2538220	2545433	4090308		Morganella_phage(20.0%)	7	NA	NA
WP_004243585.1|2538220_2539162_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	45.2	9.4e-67
WP_004243586.1|2539446_2540655_+	multidrug efflux MFS transporter MdtG	NA	A0A2H4UVM2	Bodo_saltans_virus	25.0	4.5e-05
WP_004250754.1|2541075_2542611_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	56.5	8.5e-158
WP_036895248.1|2542791_2543571_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_004243592.1|2543671_2544094_+	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	39.7	7.3e-11
WP_004243593.1|2544323_2544641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250749.1|2544794_2545433_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.5	7.1e-18
>prophage 195
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2548976	2550380	4090308		Hokovirus(100.0%)	1	NA	NA
WP_071425418.1|2548976_2550380_+	GHKL domain-containing protein	NA	A0A1V0SGX0	Hokovirus	25.0	8.4e-11
>prophage 196
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2556076	2580792	4090308	transposase	Escherichia_phage(66.67%)	24	NA	NA
WP_012368081.1|2556076_2558515_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|2558526_2559144_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|2559147_2559924_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_071425735.1|2560039_2560582_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	7.2e-19
WP_017628013.1|2561150_2561330_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_080985737.1|2561485_2561872_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_104459763.1|2562054_2562477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067856.1|2563347_2564052_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_104470814.1|2564822_2565389_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.9	3.0e-28
WP_000480968.1|2565594_2566431_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2566430_2567234_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_087062816.1|2567333_2568478_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	28.3	1.1e-16
WP_000904906.1|2568584_2569199_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001067856.1|2570434_2571139_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_000902128.1|2572238_2572418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067856.1|2572509_2573214_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_001199192.1|2573327_2574104_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000171321.1|2574124_2574346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000742814.1|2574332_2575358_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|2575779_2576532_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_001043260.1|2578275_2579091_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|2579177_2579480_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|2579373_2579625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001250345.1|2579655_2580792_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 197
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2586398	2633348	4090308	transposase,holin,tRNA,lysis	Escherichia_phage(18.18%)	49	NA	NA
WP_000214119.1|2586398_2587613_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_001447541.1|2587829_2588714_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|2589638_2590343_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_000030933.1|2590427_2590865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005119228.1|2590915_2593834_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000963725.1|2594289_2594820_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_001057867.1|2595052_2595463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000656635.1|2595678_2596101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|2596242_2597079_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2597078_2597882_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_034619196.1|2598114_2598399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005028396.1|2598399_2598630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002093955.1|2598733_2599744_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.6e-26
WP_085940656.1|2600283_2601428_-|transposase	IS3-like element ISAba14 family transposase	transposase	NA	NA	NA	NA
WP_132587825.1|2601464_2601881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046004.1|2602662_2603484_-	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_085940648.1|2603582_2604672_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000904906.1|2604735_2605350_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_000018326.1|2607419_2608235_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067858.1|2608391_2609096_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_052169991.1|2609101_2609464_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.1	2.6e-49
WP_000557452.1|2609641_2610502_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|2610514_2611057_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_040234282.1|2611638_2611830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197549.1|2611993_2612179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002063129.1|2612451_2613003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947932.1|2613070_2613831_-|transposase	IS5-like element ISKpn12 family transposase	transposase	NA	NA	NA	NA
WP_001067858.1|2615645_2616350_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018326.1|2616479_2617295_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000902128.1|2617448_2617628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067856.1|2617719_2618424_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_017628011.1|2619010_2619667_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_071425271.1|2619663_2620851_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.4	1.1e-72
WP_071425272.1|2620843_2621188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|2621184_2621877_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2621879_2622692_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2622660_2622981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|2622993_2623482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071425273.1|2623484_2625788_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	8.3e-16
WP_004243627.1|2625870_2626329_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|2626388_2626841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248362.1|2626851_2628339_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.9e-77
WP_012368090.1|2628347_2628860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049210638.1|2628896_2629346_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|2629342_2629747_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|2629749_2630049_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243640.1|2630430_2631246_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
WP_004243642.1|2631491_2632229_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	44.8	2.6e-56
WP_004243643.1|2632328_2633348_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 198
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2638071	2652881	4090308		Pseudomonas_phage(33.33%)	10	NA	NA
WP_012368095.1|2638071_2640900_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	24.5	3.4e-35
WP_071425287.1|2641100_2643734_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.4	1.4e-104
WP_036905561.1|2643918_2644656_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_071425288.1|2645017_2647309_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	68.2	1.8e-305
WP_004248376.1|2647320_2648451_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	3.4e-172
WP_004248377.1|2648475_2648754_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	60.6	9.0e-18
WP_004243656.1|2648861_2649095_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_036907803.1|2649285_2650497_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004248380.1|2650601_2651144_-	membrane protein	NA	NA	NA	NA	NA
WP_071425289.1|2651426_2652881_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.3	5.5e-98
>prophage 199
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2682641	2684471	4090308		Oenococcus_phage(100.0%)	1	NA	NA
WP_071425298.1|2682641_2684471_-	SLC13 family permease	NA	Q6A201	Oenococcus_phage	32.6	1.9e-15
>prophage 200
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2702276	2703794	4090308		Mollivirus(100.0%)	1	NA	NA
WP_049256227.1|2702276_2703794_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	9.8e-90
>prophage 201
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2710341	2711469	4090308		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_071425852.1|2710341_2711469_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.9	2.6e-23
>prophage 202
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2721379	2722465	4090308		Pandoravirus(100.0%)	1	NA	NA
WP_004243753.1|2721379_2722465_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.5	8.2e-91
>prophage 203
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2741066	2741369	4090308		Morganella_phage(100.0%)	1	NA	NA
WP_004243781.1|2741066_2741369_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	37.9	6.0e-07
>prophage 204
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2749561	2764072	4090308		Streptococcus_phage(33.33%)	14	NA	NA
WP_004248419.1|2749561_2751589_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.9	2.4e-144
WP_017627975.1|2751580_2751775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248420.1|2751763_2752819_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_004248421.1|2753041_2753812_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_004248422.1|2753960_2754914_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.2	1.4e-73
WP_004243798.1|2755244_2755502_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_004243799.1|2755645_2757373_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.4	1.9e-17
WP_004243800.1|2757422_2757932_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004243801.1|2758022_2758904_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	43.5	2.6e-58
WP_020945945.1|2759109_2760198_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	36.8	3.7e-30
WP_004243804.1|2760217_2761060_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_004243805.1|2761059_2761893_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_020945946.1|2761892_2762924_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071425550.1|2763175_2764072_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	32.9	5.5e-24
>prophage 205
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2770651	2771935	4090308	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_004243819.1|2770651_2771935_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	24.9	3.2e-25
>prophage 206
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2776104	2776530	4090308		Anguillid_herpesvirus(100.0%)	1	NA	NA
WP_004243827.1|2776104_2776530_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	36.8	2.1e-18
>prophage 207
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2784941	2791537	4090308		Mycoplasma_phage(20.0%)	8	NA	NA
WP_004243837.1|2784941_2786237_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.6	2.5e-38
WP_004243841.1|2786517_2786712_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004243842.1|2786727_2787063_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004243843.1|2787065_2788916_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	37.4	7.2e-103
WP_004243844.1|2788927_2789449_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004243846.1|2789497_2789821_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	6.3e-23
WP_004243847.1|2789911_2790298_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	5.4e-53
WP_004243849.1|2790322_2791537_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	9.4e-35
>prophage 208
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2797368	2798622	4090308		Aeromonas_phage(100.0%)	1	NA	NA
WP_004243862.1|2797368_2798622_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	9.2e-102
>prophage 209
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2801653	2811731	4090308		Bacillus_phage(50.0%)	5	NA	NA
WP_004248444.1|2801653_2803270_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.6	2.3e-97
WP_004243867.1|2803344_2804682_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	2.6e-09
WP_132587743.1|2804693_2805620_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_103388845.1|2805703_2807143_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	5.4e-13
WP_071425455.1|2807840_2811731_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.9	1.0e-130
>prophage 210
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2819975	2827607	4090308	tRNA	Pandoravirus(25.0%)	9	NA	NA
WP_004248453.1|2819975_2820506_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
WP_004243886.1|2820818_2821079_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	4.6e-16
WP_004243887.1|2821108_2821489_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004243888.1|2821488_2822220_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_071425858.1|2822293_2823031_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004243892.1|2823043_2823952_-	GTPase Era	NA	NA	NA	NA	NA
WP_004248457.1|2823948_2824629_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	31.9	8.1e-20
WP_004248458.1|2824824_2825796_-	signal peptidase I	NA	NA	NA	NA	NA
WP_071425859.1|2825810_2827607_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
>prophage 211
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2831991	2834896	4090308		uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_071425861.1|2831991_2833347_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.4	5.2e-42
WP_004248459.1|2833497_2833881_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	67.0	2.0e-31
WP_017827084.1|2833892_2834117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248460.1|2834215_2834896_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.2	1.3e-57
>prophage 212
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2839832	2842178	4090308	integrase	Staphylococcus_phage(50.0%)	2	2837956:2837970	2857457:2857471
2837956:2837970	attL	ATCAAGCACTCTCTA	NA	NA	NA	NA
WP_004243915.1|2839832_2840315_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	4.3e-31
WP_071425863.1|2840936_2842178_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.3	1.7e-100
2857457:2857471	attR	ATCAAGCACTCTCTA	NA	NA	NA	NA
>prophage 213
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2863351	2863930	4090308		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004243957.1|2863351_2863930_-	hypothetical protein	NA	M1IB93	Acanthocystis_turfacea_Chlorella_virus	35.1	5.1e-31
>prophage 214
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2876835	2880747	4090308		Acinetobacter_phage(50.0%)	2	NA	NA
WP_004243977.1|2876835_2878875_-	IreA family TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	31.4	4.8e-15
WP_004243978.1|2879112_2880747_-	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	39.0	7.5e-88
>prophage 215
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2885761	2888169	4090308		Tupanvirus(50.0%)	2	NA	NA
WP_004248507.1|2885761_2886778_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.9	5.7e-86
WP_036895444.1|2887209_2888169_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	25.9	1.1e-17
>prophage 216
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2891657	2891903	4090308		Salmonella_phage(100.0%)	1	NA	NA
WP_012368173.1|2891657_2891903_-	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
>prophage 217
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2900178	2908769	4090308	tRNA	Lactobacillus_phage(20.0%)	8	NA	NA
WP_004244004.1|2900178_2900727_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	2.2e-15
WP_004244005.1|2901226_2901436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244007.1|2901743_2901953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244024.1|2902550_2904065_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
WP_096043105.1|2904073_2905172_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_004248522.1|2905343_2907077_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	3.6e-64
WP_004244030.1|2907086_2907794_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004248523.1|2907827_2908769_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
>prophage 218
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2912459	2915336	4090308		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_004248527.1|2912459_2915336_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.3	9.3e-267
>prophage 219
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2923456	2930360	4090308		Organic_Lake_phycodnavirus(33.33%)	4	NA	NA
WP_063215830.1|2923456_2925529_+	ATP-binding cassette domain-containing protein	NA	F2Y165	Organic_Lake_phycodnavirus	24.6	1.8e-17
WP_004250380.1|2925531_2926896_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_049210256.1|2926909_2929033_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.7	3.1e-41
WP_004248535.1|2929109_2930360_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.3e-103
>prophage 220
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2940484	2955924	4090308		Heterosigma_akashiwo_virus(50.0%)	2	NA	NA
WP_132587592.1|2940484_2954284_+	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	28.0	1.2e-05
WP_004244077.1|2954496_2955924_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	3.2e-42
>prophage 221
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2967499	2967895	4090308		Enterobacteria_phage(100.0%)	1	NA	NA
WP_012368230.1|2967499_2967895_-	8-oxo-dGTP diphosphatase MutT	NA	H6X3M3	Enterobacteria_phage	31.1	3.3e-05
>prophage 222
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	2998301	3004026	4090308		Catovirus(50.0%)	4	NA	NA
WP_004248568.1|2998301_3000110_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.3	5.5e-47
WP_036918822.1|3000639_3001584_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_004244136.1|3001782_3002028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244137.1|3002466_3004026_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	23.3	3.3e-08
>prophage 223
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3010468	3011144	4090308		Brucella_phage(50.0%)	2	NA	NA
WP_004244143.1|3010468_3010813_-	DNA-binding protein	NA	A0A141GEX5	Brucella_phage	38.8	3.7e-05
WP_004244144.1|3010802_3011144_-	addiction module killer protein	NA	A4JWV2	Burkholderia_virus	36.7	9.4e-09
>prophage 224
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3016052	3017207	4090308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_071425644.1|3016052_3017207_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.5	7.6e-127
>prophage 225
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3047761	3048517	4090308		Edwardsiella_phage(100.0%)	1	NA	NA
WP_049213433.1|3047761_3048517_+	trimeric autotransporter adhesin AipA	NA	A0A0B6VSQ9	Edwardsiella_phage	32.2	2.6e-06
>prophage 226
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3063040	3063796	4090308		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_004248613.1|3063040_3063796_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	7.9e-16
>prophage 227
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3083204	3086828	4090308		uncultured_Caudovirales_phage(66.67%)	4	NA	NA
WP_060555671.1|3083204_3084494_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.3	3.0e-172
WP_004244232.1|3084569_3084905_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	58.5	1.4e-20
WP_004244233.1|3085336_3086047_+	fimbrial protein	NA	NA	NA	NA	NA
WP_060555660.1|3086201_3086828_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	30.4	1.3e-11
>prophage 228
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3090395	3115869	4090308	integrase,tRNA	Morganella_phage(55.56%)	28	3089341:3089360	3111345:3111364
3089341:3089360	attL	ATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
WP_036907530.1|3090395_3090917_-	SocA family protein	NA	D0UIM3	Aggregatibacter_phage	39.6	1.8e-19
WP_036907529.1|3091363_3091651_-	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	78.2	3.9e-32
WP_132587589.1|3092304_3092493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907525.1|3093304_3093733_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	82.6	3.6e-58
WP_036907523.1|3093729_3094701_-	abortive infection protein	NA	NA	NA	NA	NA
WP_036900254.1|3095497_3095866_-	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	66.0	2.8e-27
WP_132587587.1|3095932_3099166_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	40.4	1.5e-100
WP_036900256.1|3099182_3099524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072156938.1|3099523_3099697_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_053828372.1|3099877_3100387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132587585.1|3100461_3100899_-	ProQ/FinO family protein	NA	A0A1W6JPI6	Morganella_phage	55.9	1.6e-13
WP_036907519.1|3101218_3103966_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.7	1.5e-226
WP_036907517.1|3103962_3104307_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.9	3.7e-45
WP_052124628.1|3104321_3104918_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	4.9e-29
WP_132587583.1|3104917_3105103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132587581.1|3105272_3105857_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	58.0	2.4e-28
WP_036900274.1|3105853_3106063_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_036918882.1|3106059_3106239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071843629.1|3106496_3106670_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_132587597.1|3106662_3107622_-	ash family protein	NA	A0A1W6JPK3	Morganella_phage	48.4	7.9e-61
WP_036918887.1|3107626_3108316_-	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	38.0	2.7e-10
WP_036918890.1|3108328_3108724_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	2.1e-28
WP_036918892.1|3108723_3108921_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	46.3	2.3e-07
WP_036900290.1|3110101_3111313_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
WP_017827221.1|3111745_3112618_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.2	1.1e-34
3111345:3111364	attR	ATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
WP_004244244.1|3112621_3112834_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004244246.1|3113470_3114412_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004244247.1|3114477_3115869_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
>prophage 229
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3124240	3132249	4090308	protease	Bacillus_phage(33.33%)	8	NA	NA
WP_004250296.1|3124240_3124927_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	9.4e-08
WP_012368271.1|3124897_3125527_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004244260.1|3125577_3126363_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.9	1.3e-05
WP_004244262.1|3126448_3127306_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004244263.1|3127345_3128269_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004250295.1|3128271_3128793_+	NfeD family protein	NA	NA	NA	NA	NA
WP_004244266.1|3128758_3129160_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_071425476.1|3129294_3132249_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.6	6.9e-116
>prophage 230
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3144773	3146657	4090308		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004244279.1|3144773_3146657_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.7	2.4e-109
>prophage 231
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3172542	3172836	4090308		Morganella_phage(100.0%)	1	NA	NA
WP_004248670.1|3172542_3172836_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	42.6	8.3e-06
>prophage 232
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3192816	3208031	4090308	tRNA	uncultured_Mediterranean_phage(25.0%)	14	NA	NA
WP_004250269.1|3192816_3195381_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.9	2.8e-28
WP_004244343.1|3195446_3196436_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.6e-32
WP_004244344.1|3197110_3198235_-	murein hydrolase activator NlpD	NA	A0A292GJG6	Xanthomonas_phage	45.8	5.5e-13
WP_004244345.1|3198388_3199015_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.2	1.9e-31
WP_004244347.1|3199008_3199773_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.4	2.1e-64
WP_060554848.1|3199750_3200803_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_004248690.1|3200802_3201285_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_004244352.1|3201286_3202033_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_080942617.1|3202072_3202393_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_004248692.1|3202654_3203269_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	40.0	8.1e-27
WP_004244355.1|3203268_3204726_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.0	3.2e-37
WP_004244356.1|3204737_3205646_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_004250264.1|3205657_3207079_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_004244358.1|3207299_3208031_-	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	27.3	2.6e-08
>prophage 233
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3212294	3212966	4090308		Vibrio_phage(100.0%)	1	NA	NA
WP_004248700.1|3212294_3212966_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A088FAQ4	Vibrio_phage	28.0	1.3e-14
>prophage 234
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3225180	3226212	4090308		Planktothrix_phage(100.0%)	1	NA	NA
WP_004245446.1|3225180_3226212_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.5	3.2e-36
>prophage 235
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3233759	3239867	4090308		Mollivirus(33.33%)	4	NA	NA
WP_004250252.1|3233759_3234503_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.8	4.7e-13
WP_004245456.1|3234799_3235759_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_004248711.1|3235771_3239254_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.1	3.4e-202
WP_004245458.1|3239276_3239867_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	44.2	1.4e-31
>prophage 236
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3247867	3249491	4090308		Tupanvirus(50.0%)	2	NA	NA
WP_071425818.1|3247867_3248731_-	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	32.4	2.9e-06
WP_004248717.1|3248732_3249491_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.0	2.7e-24
>prophage 237
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3266274	3269335	4090308		Vibrio_phage(50.0%)	3	NA	NA
WP_004245492.1|3266274_3267120_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	3.8e-43
WP_004249505.1|3267211_3268579_+	LOG family protein	NA	NA	NA	NA	NA
WP_071425909.1|3268585_3269335_+	flap endonuclease Xni	NA	B6V2K6	Bacillus_phage	29.1	1.7e-15
>prophage 238
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3272524	3288931	4090308	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_071425908.1|3272524_3273739_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	32.1	4.9e-60
WP_004245500.1|3273741_3274185_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_004250240.1|3274750_3275599_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	29.1	6.4e-14
WP_004245504.1|3275707_3276802_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_004245505.1|3277558_3278821_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	1.6e-13
WP_004249500.1|3279065_3280400_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_071425519.1|3280498_3282415_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.2	3.4e-23
WP_071425518.1|3282407_3286046_-	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	23.2	1.8e-09
WP_071425517.1|3286042_3288931_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.2	4.6e-72
>prophage 239
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3295308	3299409	4090308		Vibrio_phage(50.0%)	3	NA	NA
WP_004250229.1|3295308_3296160_-	thymidylate synthase	NA	H9EB68	Vibrio_phage	73.5	2.4e-125
WP_004245522.1|3296191_3297076_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_071425515.1|3297162_3299409_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.6	3.9e-10
>prophage 240
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3302802	3310218	4090308		Acidithiobacillus_phage(40.0%)	5	NA	NA
WP_004245527.1|3302802_3303504_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	35.6	4.3e-24
WP_004245528.1|3303631_3304084_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	48.6	5.2e-31
WP_004249488.1|3304083_3304653_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	53.3	7.2e-54
WP_071425514.1|3304768_3307123_+	DNA polymerase II	NA	B3GAM5	uncultured_virus	25.0	8.2e-27
WP_004249485.1|3307314_3310218_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	31.3	2.8e-21
>prophage 241
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3318363	3320047	4090308		Aeromonas_phage(50.0%)	2	NA	NA
WP_004245544.1|3318363_3319185_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A2R4ALY4	Aeromonas_phage	45.6	9.5e-07
WP_004245545.1|3319561_3320047_-	type 3 dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	43.8	1.5e-31
>prophage 242
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3328297	3343708	4090308		Bacillus_virus(28.57%)	12	NA	NA
WP_004245552.1|3328297_3331255_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	28.6	2.9e-82
WP_071233887.1|3331288_3333184_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.1	2.3e-96
WP_004245556.1|3333291_3333882_-	esterase YqiA	NA	NA	NA	NA	NA
WP_004250217.1|3333885_3334725_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_004245558.1|3334956_3335586_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	36.6	4.3e-23
WP_004245559.1|3335799_3337197_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_004249472.1|3337525_3338254_+	DUF1190 family protein	NA	A0A060ACJ9	Cronobacter_phage	36.1	2.0e-24
WP_004245561.1|3338261_3339425_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.1	3.7e-89
WP_004249471.1|3339564_3340350_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_004245565.1|3340523_3341177_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.0	2.3e-43
WP_004245566.1|3341662_3341971_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_004249466.1|3342283_3343708_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	8.7e-40
>prophage 243
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3348458	3349682	4090308		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_049257384.1|3348458_3349682_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.7	2.2e-92
>prophage 244
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3354423	3359913	4090308	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_004245584.1|3354423_3355446_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.9	3.5e-107
WP_001144069.1|3355788_3356004_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004249459.1|3356117_3357866_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.1	1.0e-74
WP_004245586.1|3358056_3359913_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.2	1.6e-33
>prophage 245
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3369552	3381950	4090308	protease	Caulobacter_phage(37.5%)	12	NA	NA
WP_004249448.1|3369552_3371073_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.6	4.7e-07
WP_004245601.1|3371228_3372797_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3373197_3373878_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3373974_3374550_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3374626_3375205_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3375272_3376298_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3376332_3376788_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_135022198.1|3376812_3377985_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_049257396.1|3377985_3378570_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	9.4e-17
WP_049199390.1|3378962_3380108_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.6e-31
WP_004245612.1|3380100_3380871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245613.1|3380873_3381950_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.1	8.9e-37
>prophage 246
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3387815	3390336	4090308	holin	Bodo_saltans_virus(33.33%)	3	NA	NA
WP_071425332.1|3387815_3389012_+	tetracycline efflux MFS transporter Tet(J)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	5.1e-09
WP_004249433.1|3389278_3389569_-|holin	holin	holin	C7BGD7	Burkholderia_phage	44.7	7.5e-15
WP_004245624.1|3390075_3390336_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	63.1	2.4e-25
>prophage 247
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3395138	3397514	4090308		Hokovirus(100.0%)	1	NA	NA
WP_071425593.1|3395138_3397514_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.5	1.4e-13
>prophage 248
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3402242	3402509	4090308		Pectobacterium_bacteriophage(100.0%)	1	NA	NA
WP_004249427.1|3402242_3402509_+	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	53.9	6.2e-16
>prophage 249
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3408778	3410101	4090308		Geobacillus_virus(100.0%)	1	NA	NA
WP_004245639.1|3408778_3410101_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.3	2.0e-78
>prophage 250
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3415755	3420192	4090308		Streptococcus_phage(25.0%)	5	NA	NA
WP_004249415.1|3415755_3417345_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.1	5.7e-32
WP_000854920.1|3417601_3418249_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	46.5	5.5e-42
WP_004249406.1|3418366_3418618_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	43.9	1.7e-07
WP_004249404.1|3418673_3419543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249403.1|3419529_3420192_+	hypothetical protein	NA	I3PUZ9	Vibrio_phage	39.4	4.5e-39
>prophage 251
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3429651	3442079	4090308		Rhizobium_phage(33.33%)	13	NA	NA
WP_004249392.1|3429651_3431295_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	27.2	9.8e-19
WP_004249391.1|3431314_3432067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249390.1|3432156_3433230_-	primase	NA	NA	NA	NA	NA
WP_004249389.1|3433320_3433662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249388.1|3433661_3434159_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_004249387.1|3434242_3435898_-	VWA domain-containing protein	NA	L7TNG1	Rhizobium_phage	31.0	6.4e-10
WP_004249386.1|3435967_3436408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249385.1|3436469_3437423_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_004249383.1|3437521_3438289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249382.1|3438288_3439248_-	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	35.0	8.5e-31
WP_004249381.1|3439457_3440474_-	endonuclease	NA	U6C712	Ralstonia_phage	37.4	6.9e-07
WP_004249379.1|3440761_3441580_-	phage recombination protein Bet	NA	A0A0N7C1T0	Escherichia_phage	53.5	1.4e-53
WP_004249378.1|3441659_3442079_-	single-stranded DNA-binding protein	NA	V5YTC4	Pseudomonas_phage	46.7	4.2e-19
>prophage 252
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3470721	3473373	4090308		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004249347.1|3470721_3473373_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	25.7	1.7e-44
>prophage 253
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3478338	3481980	4090308		Clostridioides_phage(100.0%)	1	NA	NA
WP_004249344.1|3478338_3481980_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	25.5	4.7e-05
>prophage 254
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3488405	3495087	4090308	integrase	Pseudomonas_phage(25.0%)	7	3472065:3472077	3495357:3495369
3472065:3472077	attL	CATCTTTCTGACC	NA	NA	NA	NA
WP_004249335.1|3488405_3489314_-	DNA polymerase III subunit epsilon	NA	A0A2H4P6W5	Pseudomonas_phage	27.5	2.8e-07
WP_004249334.1|3489953_3490403_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	57.1	4.1e-36
WP_036973679.1|3490410_3491679_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	60.2	1.2e-141
WP_008305549.1|3491689_3492133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497807.1|3492597_3493572_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_004249313.1|3493574_3493844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249312.1|3493845_3495087_+|integrase	integrase family protein	integrase	A0A291AWU1	Escherichia_phage	39.1	3.8e-76
3495357:3495369	attR	GGTCAGAAAGATG	NA	NA	NA	NA
>prophage 255
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3500089	3501733	4090308		Acidithiobacillus_phage(100.0%)	1	NA	NA
WP_071425353.1|3500089_3501733_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	26.9	1.8e-17
>prophage 256
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3512862	3514107	4090308		Enterococcus_phage(100.0%)	1	NA	NA
WP_004249296.1|3512862_3514107_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.9	2.2e-87
>prophage 257
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3524160	3524964	4090308		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_060555705.1|3524160_3524964_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	8.4e-08
>prophage 258
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3555264	3557257	4090308		Vibrio_phage(50.0%)	2	NA	NA
WP_004245716.1|3555264_3556911_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.0	2.4e-190
WP_004249265.1|3556963_3557257_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	35.8	3.3e-10
>prophage 259
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3567301	3568276	4090308		Caulobacter_phage(100.0%)	1	NA	NA
WP_036919076.1|3567301_3568276_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.5	1.2e-45
>prophage 260
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3603562	3624261	4090308		Bacillus_phage(50.0%)	6	NA	NA
WP_132587708.1|3603562_3609667_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	29.0	1.3e-36
WP_071425429.1|3609679_3618895_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	39.7	1.0e-48
WP_000801189.1|3618894_3619983_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004239723.1|3619982_3620756_+	thioesterase	NA	NA	NA	NA	NA
WP_001044024.1|3620774_3622541_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	1.8e-34
WP_000588838.1|3622533_3624261_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	7.8e-35
>prophage 261
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3640685	3645023	4090308	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_036919097.1|3640685_3641597_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	43.1	7.2e-56
WP_000202155.1|3641617_3642085_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_012368444.1|3642068_3642275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000370330.1|3642517_3642718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239734.1|3642968_3645023_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.9	7.4e-40
>prophage 262
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3651846	3653199	4090308		Escherichia_phage(100.0%)	1	NA	NA
WP_000549132.1|3651846_3653199_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	53.5	6.6e-122
>prophage 263
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3672374	3682193	4090308		Vibrio_phage(25.0%)	9	NA	NA
WP_004245792.1|3672374_3673889_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	23.6	7.6e-10
WP_132587732.1|3673931_3675074_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004245794.1|3675143_3676364_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_071425331.1|3676441_3677998_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.0	1.4e-35
WP_004250153.1|3678063_3678849_+	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_004250152.1|3678888_3679482_+	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_004250151.1|3679545_3679938_-	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_071425778.1|3680656_3681319_-	fructose-6-phosphate aldolase	NA	A0A0E3F5V4	Synechococcus_phage	31.3	3.9e-27
WP_017628514.1|3681581_3682193_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	33.8	3.0e-21
>prophage 264
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3687854	3689273	4090308		Pseudomonas_phage(100.0%)	1	NA	NA
WP_036971414.1|3687854_3689273_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	31.5	3.6e-46
>prophage 265
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3698253	3699048	4090308		Planktothrix_phage(100.0%)	1	NA	NA
WP_004249217.1|3698253_3699048_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.3e-16
>prophage 266
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3726868	3729946	4090308		Leptospira_phage(100.0%)	1	NA	NA
WP_071425299.1|3726868_3729946_+	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	6.9e-58
>prophage 267
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3745731	3747006	4090308		Pandoravirus(100.0%)	1	NA	NA
WP_004250120.1|3745731_3747006_-	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.4	2.0e-19
>prophage 268
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3754521	3765762	4090308	tRNA	Morganella_phage(16.67%)	10	NA	NA
WP_004245886.1|3754521_3754839_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	51.6	2.5e-08
WP_004245887.1|3754971_3756015_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_004245888.1|3756131_3756911_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_004250112.1|3756907_3757768_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	5.7e-10
WP_004245891.1|3757751_3758867_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	5.8e-31
WP_020946330.1|3759310_3760648_-	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	29.6	1.3e-29
WP_004249169.1|3760928_3761963_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_004245895.1|3762069_3763053_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
WP_004245896.1|3763220_3764630_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.7	3.3e-193
WP_036907212.1|3764670_3765762_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.3	3.4e-28
>prophage 269
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3770526	3775814	4090308		uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_004249165.1|3770526_3773361_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	0.0e+00
WP_004249162.1|3773613_3774138_+	single-stranded DNA-binding protein SSB1	NA	I3PGW4	Xanthomonas_phage	67.0	7.6e-58
WP_049257468.1|3774479_3775010_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_004245906.1|3775202_3775814_-	repressor LexA	NA	U5P451	Shigella_phage	45.6	2.5e-12
>prophage 270
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3785463	3789135	4090308		Dickeya_phage(100.0%)	1	NA	NA
WP_004250100.1|3785463_3789135_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.0	2.1e-21
>prophage 271
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3807379	3811274	4090308		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_004250094.1|3807379_3808969_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.1	9.3e-67
WP_004249142.1|3808981_3810271_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_004246923.1|3810294_3810987_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_004246922.1|3811001_3811274_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	56.7	8.0e-19
>prophage 272
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3821445	3840678	4090308	transposase	Sodalis_phage(14.29%)	16	NA	NA
WP_004249129.1|3821445_3822414_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	41.6	4.5e-48
WP_004246908.1|3822605_3826835_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	1.1e-66
WP_049202979.1|3826957_3830986_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.2	1.8e-21
WP_004246905.1|3831338_3831704_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004246904.1|3831767_3832265_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004246903.1|3832592_3833294_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004246901.1|3833298_3833727_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004246900.1|3833872_3834418_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	4.5e-13
WP_004246899.1|3834425_3834803_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_004249692.1|3835075_3836260_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.1e-06
WP_004249125.1|3836327_3838442_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	6.2e-58
WP_004246897.1|3838521_3838992_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004246896.1|3839091_3839466_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_004246894.1|3839593_3839887_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_004249124.1|3839917_3840286_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_004246892.1|3840285_3840678_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	41.3	2.4e-16
>prophage 273
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3847781	3855569	4090308		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_004249117.1|3847781_3849713_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.7	1.6e-73
WP_071425706.1|3850039_3851731_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	1.0e-07
WP_012368515.1|3852191_3853919_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	70.0	1.7e-05
WP_071425707.1|3854024_3855569_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	53.3	2.2e-36
>prophage 274
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3861663	3869414	4090308		Klosneuvirus(20.0%)	6	NA	NA
WP_071425381.1|3861663_3862881_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	4.7e-26
WP_004246870.1|3862998_3863574_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	6.8e-68
WP_004246869.1|3863946_3864519_-	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	35.1	1.8e-12
WP_132587638.1|3864793_3865417_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_004246867.1|3865875_3866394_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.0	7.1e-16
WP_012368519.1|3866615_3869414_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.7	9.0e-73
>prophage 275
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3885578	3887556	4090308		Bacillus_virus(50.0%)	2	NA	NA
WP_036895743.1|3885578_3886580_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	2.3e-18
WP_004250066.1|3886572_3887556_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.5e-17
>prophage 276
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3907117	3910227	4090308		Abalone_herpesvirus(50.0%)	3	NA	NA
WP_004246821.1|3907117_3907741_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.2	1.0e-21
WP_004246820.1|3907795_3908071_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_071425739.1|3908100_3910227_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	36.5	2.0e-11
>prophage 277
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3914609	3916001	4090308		environmental_Halophage(100.0%)	1	NA	NA
WP_004246815.1|3914609_3916001_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	77.1	5.1e-53
>prophage 278
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3921765	3926596	4090308		Tupanvirus(50.0%)	3	NA	NA
WP_004246802.1|3921765_3923601_-	ribosome-dependent GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	40.7	1.6e-22
WP_004246801.1|3923960_3925370_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004249083.1|3925549_3926596_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.9	1.7e-08
>prophage 279
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3935599	3943444	4090308		Bacillus_phage(60.0%)	8	NA	NA
WP_004246792.1|3935599_3936322_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	8.3e-31
WP_012368538.1|3936321_3937662_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.2	2.0e-09
WP_004246790.1|3937864_3938905_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	36.3	4.0e-50
WP_004246789.1|3938980_3939940_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004249075.1|3939941_3940844_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004246787.1|3940874_3941651_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	6.9e-15
WP_017628646.1|3941665_3942400_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_004249074.1|3942604_3943444_+	ABC transporter substrate-binding protein	NA	A0A140XBD5	Dickeya_phage	65.7	8.3e-06
>prophage 280
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3960906	3962265	4090308		Moraxella_phage(100.0%)	1	NA	NA
WP_004249062.1|3960906_3962265_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	39.4	3.5e-62
>prophage 281
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3990100	3991699	4090308		Bacillus_phage(50.0%)	2	NA	NA
WP_004246732.1|3990100_3990853_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	1.6e-08
WP_060555769.1|3990889_3991699_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.5	3.1e-10
>prophage 282
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	3997247	3997814	4090308		Escherichia_phage(100.0%)	1	NA	NA
WP_004246725.1|3997247_3997814_+	outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	29.5	6.1e-13
>prophage 283
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	4004696	4007410	4090308		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_004246712.1|4004696_4005659_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.3	2.5e-51
WP_004246711.1|4005645_4006653_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_004246710.1|4006654_4007410_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.9	1.6e-16
>prophage 284
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	4010785	4013841	4090308		Escherichia_phage(100.0%)	2	NA	NA
WP_049201747.1|4010785_4013203_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	37.0	2.4e-138
WP_004246705.1|4013199_4013841_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	3.3e-63
>prophage 285
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	4019475	4020189	4090308		Bacillus_virus(100.0%)	1	NA	NA
WP_071425869.1|4019475_4020189_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	3.6e-18
>prophage 286
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	4024895	4026386	4090308		Aeromonas_phage(100.0%)	1	NA	NA
WP_004246686.1|4024895_4026386_-	sodium:solute symporter	NA	A0A240F3J2	Aeromonas_phage	26.6	2.9e-22
>prophage 287
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	4032342	4035283	4090308		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_004246680.1|4032342_4033713_-	adenylosuccinate lyase family protein	NA	A0A2H4UUU6	Bodo_saltans_virus	23.7	2.1e-06
WP_004246679.1|4033726_4035283_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	33.3	2.8e-07
>prophage 288
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	4048096	4057859	4090308	integrase	Enterobacteria_phage(100.0%)	11	4047780:4047799	4058021:4058040
4047780:4047799	attL	TGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
WP_071425248.1|4048096_4050430_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.2	0.0e+00
WP_071425247.1|4050444_4050765_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_064162286.1|4050761_4050989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071425246.1|4050985_4051537_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	67.2	8.6e-36
WP_071425244.1|4052339_4053077_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	64.9	1.3e-79
WP_007900390.1|4053073_4053319_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	76.5	8.2e-31
WP_064162289.1|4053335_4053902_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	61.1	3.2e-54
WP_101313263.1|4053943_4054051_-	acetyl xylan esterase	NA	NA	NA	NA	NA
WP_071888955.1|4054356_4055844_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_132587622.1|4055844_4056576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071425399.1|4056686_4057859_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.8	6.6e-211
4058021:4058040	attR	TGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
>prophage 289
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	4069185	4070805	4090308		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004246655.1|4069185_4070805_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.4	1.7e-140
>prophage 290
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	4081242	4082358	4090308		Enterobacteria_phage(100.0%)	1	NA	NA
WP_049203837.1|4081242_4082358_+	competence protein E	NA	D0U174	Enterobacteria_phage	24.9	1.7e-11
>prophage 291
NZ_CP042907	Proteus mirabilis strain VAC chromosome, complete genome	4090308	4085787	4086603	4090308		Vibrio_phage(100.0%)	1	NA	NA
WP_004249858.1|4085787_4086603_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	47.1	1.2e-65
