The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	41523	87414	4638019	holin,terminase,portal,tail,protease,integrase	Enterobacteria_phage(37.25%)	61	41536:41550	87839:87853
WP_000531585.1|41523_42660_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.5	2.5e-29
41536:41550	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_148049176.1|42643_43507_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	8.8e-11
WP_148049177.1|43739_44321_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.6	4.4e-99
WP_000279178.1|44320_47695_-|tail	phage tail protein	tail	A0A0E3GML4	Enterobacteria_phage	35.5	1.4e-11
WP_001233184.1|47759_48359_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	88.9	1.6e-99
WP_125282553.1|48270_48495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515508.1|48426_51915_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.0	0.0e+00
WP_000741577.1|51975_52623_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.1e-111
WP_000140749.1|52520_53264_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	2.2e-151
WP_001152390.1|53269_53968_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	5.6e-133
WP_000447253.1|53977_54307_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372015.1|54306_57372_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|57343_57673_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|57681_58068_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211109.1|58128_58872_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|58883_59285_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677106.1|59281_59860_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|59871_60147_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|60139_60463_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001360054.1|60549_62577_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_015953980.1|62521_64102_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|64029_64242_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934084.1|64238_66341_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.0	0.0e+00
WP_000349509.1|66340_66832_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_148049178.1|66821_67073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072058827.1|67066_67255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032215095.1|67417_67714_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	93.9	3.1e-48
WP_148049179.1|67776_67992_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	63.6	6.3e-19
WP_032084561.1|68035_68257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001305859.1|68614_68728_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	89.2	2.5e-11
WP_047088412.1|68947_69493_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	87.3	5.2e-94
WP_000950579.1|69494_69773_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	85.9	7.3e-36
WP_047088410.1|69762_70152_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	87.7	2.9e-46
WP_148049180.1|70241_71246_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.8	3.6e-173
WP_000917767.1|71396_71594_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_047088408.1|71805_72495_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.4	2.1e-55
WP_001217445.1|72491_72851_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	3.7e-40
WP_052952402.1|72863_73913_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.2	4.6e-115
WP_047088416.1|73914_74187_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_047088407.1|74322_74580_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	2.9e-31
WP_000220600.1|74585_74885_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	99.0	3.9e-51
WP_148049336.1|75089_75323_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	96.1	8.9e-35
WP_069904263.1|75441_75741_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	97.0	1.3e-49
WP_077756511.1|75737_75992_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	67.9	1.7e-23
WP_148049181.1|76048_76810_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	69.4	1.6e-85
WP_112026355.1|76832_77579_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.1	3.6e-114
WP_122990884.1|77585_78551_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	3.7e-58
WP_061355627.1|78571_78997_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_061355628.1|78980_79253_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.4	3.2e-20
WP_000578360.1|79379_79772_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_061355629.1|79818_80178_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	2.1e-59
WP_061355630.1|80180_80483_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_148049182.1|80758_80911_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.6e-07
WP_032215152.1|80922_81297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373330.1|81375_81822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047088400.1|82511_82700_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001373012.1|82696_82888_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_047649205.1|82980_85452_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.4	4.5e-60
WP_000003742.1|85513_85783_+	excisionase	NA	NA	NA	NA	NA
WP_148049183.1|85751_86870_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.7	1.2e-84
WP_001113310.1|86946_87414_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
87839:87853	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	238765	275087	4638019	coat,protease,transposase	Staphylococcus_phage(50.0%)	40	NA	NA
WP_000638294.1|238765_239725_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002431605.1|239721_242109_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000836025.1|242084_242831_-	molecular chaperone	NA	NA	NA	NA	NA
WP_032242962.1|242843_243317_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_001038662.1|243395_243965_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_001098483.1|244234_244729_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_077626858.1|244745_246701_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000796096.1|246705_247620_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000905460.1|247616_248504_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291584.1|248628_249207_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_002431607.1|249209_249560_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000332011.1|250377_250806_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089023.1|250812_252237_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000165652.1|252211_253015_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100214.1|253168_254155_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_002432082.1|254169_255684_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	6.7e-14
WP_000548662.1|255778_256768_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000243183.1|257152_258289_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000541009.1|258445_258679_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_000930861.1|258728_259031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148049190.1|259034_259400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002431609.1|259704_259926_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_104917567.1|259983_260298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000466515.1|260313_260619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184451.1|261692_261995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246690.1|263217_263721_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000706231.1|263866_264202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000909918.1|264331_264829_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000094892.1|264866_265106_-	YecH family protein	NA	NA	NA	NA	NA
WP_071985852.1|265083_265347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024256713.1|265300_266512_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_001091689.1|266551_267217_-	YecA family protein	NA	NA	NA	NA	NA
WP_000004913.1|267310_268165_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063963.1|268161_268560_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003624.1|268556_269144_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186414.1|269140_269848_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107370.1|269866_271660_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_002431613.1|271656_272775_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_148049191.1|273084_273840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000375136.1|274427_275087_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 3
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	287547	411201	4638019	tRNA,lysis,plate,capsid,holin,head,terminase,tail,portal,transposase,protease,integrase	Escherichia_phage(28.81%)	109	301021:301037	391504:391520
WP_000156541.1|287547_289308_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227930.1|289376_289895_+	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_000828648.1|289961_290129_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759109.1|290384_290948_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000444390.1|290944_292585_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333185.1|292589_293837_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053107.1|293966_295874_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	7.5e-55
WP_001086504.1|295885_297994_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224279.1|298091_299201_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001220658.1|299197_299740_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002431618.1|299913_300924_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
301021:301037	attL	TTCTTATTGCGCTTTTT	NA	NA	NA	NA
WP_071599583.1|301026_301242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001263932.1|301160_301736_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001204684.1|301728_302688_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000055971.1|302684_303830_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235190.1|303841_304633_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090471.1|304629_305397_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	9.8e-30
WP_000193862.1|305439_308052_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_000191397.1|308317_309520_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.6	2.1e-42
WP_000117877.1|309685_311086_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.3	3.1e-82
WP_000977935.1|311695_312766_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.6	4.3e-100
WP_000462632.1|312949_314140_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109460.1|314188_314836_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_002431619.1|314862_315414_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.1e-06
WP_000926112.1|315594_317442_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572702.1|317684_322145_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_024256410.1|322144_322849_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288847.1|322829_324152_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_002431621.1|324148_324934_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899578.1|325069_325849_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436939.1|325825_326719_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011563.1|326871_327618_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350053.1|327614_327797_-	protein YcaR	NA	NA	NA	NA	NA
WP_000058083.1|327849_329082_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000572825.1|329118_330105_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551253.1|330101_331850_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	1.4e-60
WP_000167338.1|334353_334638_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
WP_000140320.1|334797_336471_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125009.1|336581_337265_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000445218.1|337451_338729_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000079581.1|338798_339887_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	3.2e-82
WP_000642852.1|340076_340769_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_148049195.1|340898_342659_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_002431623.1|343063_343921_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292806.1|343976_346259_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	2.0e-163
WP_000468308.1|346578_346797_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001572678.1|346878_348042_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000978908.1|348041_348521_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_115245073.1|348535_350983_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.9	0.0e+00
WP_000785970.1|350975_351095_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|351127_351403_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|351459_351978_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_115245074.1|351990_353181_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	8.1e-225
WP_001461859.1|353479_354007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680509.1|354396_354924_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	95.4	1.8e-91
WP_115245075.1|354927_357222_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	62.1	1.1e-182
WP_021548487.1|357232_357763_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	2.3e-102
WP_115245076.1|357755_358664_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	9.8e-162
WP_000127164.1|358668_359016_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_089643754.1|359012_359648_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	3.8e-112
WP_089643753.1|359730_361257_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_115245081.1|361372_361822_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	96.6	1.1e-73
WP_000917141.1|361814_362282_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	2.3e-82
WP_072275434.1|362244_362418_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.0e-23
WP_024174452.1|362389_362815_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	6.1e-66
WP_115245029.1|362802_363228_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	95.7	6.1e-58
WP_001144101.1|363242_363740_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|363739_364021_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|364024_364228_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988639.1|364227_364737_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_001516662.1|364836_365580_-|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	99.2	2.3e-121
WP_001248555.1|365583_366657_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.2	3.3e-201
WP_001085952.1|366715_367570_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156861.1|367743_369516_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_089643750.1|369515_370550_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	2.7e-200
WP_001607698.1|370880_372233_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024248662.1|372234_373224_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_089643749.1|373550_375821_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	95.3	0.0e+00
WP_000027664.1|375810_376086_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113269.1|376082_376307_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	5.0e-35
WP_021500267.1|376309_376609_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	1.9e-45
WP_000557703.1|376608_376833_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217679.1|376896_377397_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_148049196.1|377574_377946_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.0e-64
WP_001389238.1|378039_378339_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_089643746.1|378432_379428_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	9.3e-190
WP_000067979.1|379459_380257_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000113474.1|380466_381897_-	amino acid permease	NA	NA	NA	NA	NA
WP_000029922.1|382104_383253_-	MFS transporter	NA	NA	NA	NA	NA
WP_000198078.1|383565_384192_+	hydrolase	NA	NA	NA	NA	NA
WP_000886674.1|384249_385542_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	3.3e-94
WP_000067755.1|385632_386976_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_002431628.1|386986_387598_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000076978.1|387756_391602_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	4.0e-87
391504:391520	attR	AAAAAGCGCAATAAGAA	NA	NA	NA	NA
WP_000228473.1|391736_392231_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537409.1|392763_393729_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	6.5e-63
WP_001043633.1|393851_395618_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	2.4e-23
WP_001202206.1|395618_397340_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	3.8e-21
WP_001241690.1|397381_398086_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|398370_398589_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934073.1|399333_401613_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	8.7e-167
WP_000047741.1|401643_401964_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	1.6e-13
WP_000410783.1|402286_402508_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	2.3e-16
WP_000188207.1|402728_404675_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.8	1.1e-40
WP_001242896.1|404671_405787_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_002431630.1|405948_406899_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599778.1|406895_408554_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488715.1|408975_409671_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000868863.1|410175_411201_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	906525	999440	4638019	tRNA,plate,holin,terminase,portal,tail,transposase,protease,integrase	Enterobacteria_phage(27.59%)	102	978657:978676	994150:994169
WP_001353022.1|906525_907263_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219194.1|907394_908729_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000627804.1|909207_909591_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262705.1|909897_910587_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.3	5.5e-56
WP_000997417.1|910634_911672_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|911878_912298_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_002431674.1|912366_913065_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082989.1|913096_915757_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|915870_917226_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002431675.1|917271_917595_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841110.1|917591_918890_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	2.2e-45
WP_002431841.1|924681_927255_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040132.1|927384_928116_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079086.1|928112_929093_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197657.1|929227_929965_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000214362.1|930232_930577_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_012599914.1|930680_930728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200131.1|930826_931990_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225205.1|932032_933154_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168024.1|933164_934235_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	1.8e-90
WP_000696055.1|934450_934825_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_000065253.1|935027_935375_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264781.1|935416_936184_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|936214_936763_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|936781_937030_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|937166_938528_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002431842.1|938694_939486_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626305.1|939506_940793_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|940847_941441_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|941564_942443_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880949.1|942528_944190_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|944338_944680_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117830.1|944741_945032_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|945021_945498_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|945629_946112_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_096937451.1|946971_947700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148049210.1|948357_948942_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.5	3.0e-71
WP_148049211.1|948941_950639_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	36.5	7.4e-62
WP_000130019.1|950631_951195_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	41.7	1.1e-27
WP_046082609.1|951184_952105_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	51.7	6.8e-70
WP_046082610.1|952088_952442_-|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	5.9e-22
WP_148049212.1|952482_953634_-	late control protein D	NA	D4HTW7	Vibrio_phage	34.7	1.4e-32
WP_046076954.1|953602_953818_-|tail	tail protein	tail	NA	NA	NA	NA
WP_114091456.1|953792_954263_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	34.8	5.8e-17
WP_046082612.1|954259_956170_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	32.0	1.3e-25
WP_046082613.1|956272_956572_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001280988.1|956630_957137_-|tail	tail protein	tail	NA	NA	NA	NA
WP_046082614.1|957133_958603_-|tail	tail protein	tail	R9TMQ0	Vibrio_phage	38.0	3.5e-76
WP_046082615.1|958640_959258_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	35.4	1.9e-12
WP_046082616.1|959250_959802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077872549.1|959812_960562_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	33.8	1.3e-15
WP_077872548.1|960470_960881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046082619.1|960826_961156_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_046082620.1|961226_963305_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	54.0	7.6e-202
WP_046082621.1|963261_964773_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.2	9.9e-151
WP_000167306.1|964781_964997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046082622.1|964993_967111_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	71.4	1.4e-307
WP_000368263.1|967114_967621_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	64.6	6.9e-48
WP_148049213.1|967822_968167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148049214.1|968237_968507_-	peptidase	NA	Q8SBD8	Shigella_phage	77.1	6.0e-27
WP_046082624.1|968391_968784_-	DUF2570 domain-containing protein	NA	S5FKR3	Shigella_phage	86.0	6.7e-51
WP_046082625.1|968767_969244_-	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	96.2	2.1e-86
WP_046082626.1|969247_969583_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	98.2	5.7e-59
WP_039022671.1|969824_970337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039022685.1|970333_970564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046082627.1|970641_971694_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.0	8.3e-205
WP_001355891.1|971843_972038_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_046082628.1|972310_973642_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.4	3.2e-20
WP_097339664.1|973670_974039_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	84.2	1.0e-53
WP_060765537.1|974053_975043_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	4.7e-194
WP_060765536.1|975050_975860_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	93.7	5.0e-141
WP_000767113.1|975879_976269_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210175.1|976265_976592_-	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	98.1	4.5e-53
WP_046083235.1|976591_977080_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	94.4	7.5e-84
WP_046083234.1|977082_977901_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.5	4.4e-121
WP_000620683.1|977897_978122_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_046083233.1|978118_979270_-	peptidase	NA	K7PLX4	Enterobacteria_phage	97.4	4.6e-209
978657:978676	attL	GTAGCCATGATGGCAGCCTC	NA	NA	NA	NA
WP_060765554.1|979266_979818_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	96.2	3.9e-97
WP_060765555.1|979810_980071_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.8e-40
WP_023141118.1|980042_980195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088144942.1|980168_980861_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	7.5e-122
WP_046083435.1|980940_981195_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	1.0e-12
WP_046083436.1|981583_981946_+	hypothetical protein	NA	U5P4J6	Shigella_phage	98.3	2.1e-59
WP_000081280.1|982011_982836_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_148049215.1|982964_983165_+	hypothetical protein	NA	S5MW55	Escherichia_phage	90.3	4.9e-26
WP_001339197.1|983234_984443_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_046083100.1|984935_985802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|985843_986050_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_115197983.1|986010_987189_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.0	1.7e-145
WP_001565737.1|987478_988672_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.0	3.1e-107
WP_148049337.1|988699_990787_-	zinc chelation protein SecC	NA	NA	NA	NA	NA
WP_148049216.1|991067_991640_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.1e-94
WP_148049217.1|991713_992214_-	transactivation protein	NA	NA	NA	NA	NA
WP_097338938.1|992210_992945_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.4	1.8e-129
WP_001330887.1|993292_993484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001149160.1|993496_993763_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_097760546.1|993759_994359_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.9e-49
994150:994169	attR	GAGGCTGCCATCATGGCTAC	NA	NA	NA	NA
WP_001244665.1|994351_994639_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459322.1|994631_995087_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	2.8e-64
WP_000856729.1|995222_995543_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_148049218.1|995557_997891_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000497434.1|999197_999440_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	79.2	1.5e-29
>prophage 5
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	1445475	1520989	4638019	tRNA,holin,terminase,portal,tail,protease,integrase	Enterobacteria_phage(40.74%)	92	1446169:1446183	1521183:1521197
WP_001241205.1|1445475_1446162_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
1446169:1446183	attL	GCTCTTTTACTCTTT	NA	NA	NA	NA
WP_001541509.1|1446559_1446700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|1446795_1447512_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000946446.1|1447577_1448936_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219549.1|1448993_1450418_-	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_001188059.1|1450417_1451107_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_000875492.1|1451119_1451593_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|1451803_1452673_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942355.1|1452669_1453317_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_022646480.1|1453368_1453884_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068675.1|1453877_1454204_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000046749.1|1456440_1458108_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000007436.1|1458163_1458448_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000513551.1|1458449_1458782_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000093825.1|1458873_1460106_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.3	4.7e-82
WP_001029698.1|1460126_1461509_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132947.1|1461557_1462526_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124606.1|1462631_1463276_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105839.1|1463303_1464320_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566247.1|1464351_1464615_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224875.1|1464775_1465495_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|1465551_1466775_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477829.1|1466826_1468149_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	5.2e-79
WP_001295412.1|1468226_1469006_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143212.1|1469263_1470814_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088431.1|1470785_1471649_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563022.1|1471778_1472561_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002431697.1|1472557_1473631_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|1473752_1473914_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295410.1|1474040_1474646_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|1475038_1476625_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217539.1|1476844_1477093_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001372053.1|1477519_1477633_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_000836769.1|1477701_1477935_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_000086511.1|1478314_1478905_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	6.2e-24
WP_000874134.1|1479002_1479578_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.1	1.7e-98
WP_000279178.1|1479577_1482952_-|tail	phage tail protein	tail	A0A0E3GML4	Enterobacteria_phage	35.5	1.4e-11
WP_001233184.1|1483016_1483616_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	88.9	1.6e-99
WP_125282553.1|1483527_1483752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515508.1|1483683_1487172_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.0	0.0e+00
WP_000741577.1|1487232_1487880_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.1e-111
WP_000140749.1|1487777_1488521_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	2.2e-151
WP_001152390.1|1488526_1489225_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	5.6e-133
WP_000447253.1|1489234_1489564_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372015.1|1489563_1492629_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|1492600_1492930_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|1492938_1493325_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211109.1|1493385_1494129_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|1494140_1494542_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677106.1|1494538_1495117_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|1495128_1495404_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|1495396_1495720_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001360054.1|1495806_1497834_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_148049235.1|1497778_1499359_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.8	4.8e-289
WP_001072975.1|1499286_1499499_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934084.1|1499495_1501598_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.0	0.0e+00
WP_000349509.1|1501597_1502089_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_032243018.1|1502078_1502357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000548593.1|1502641_1502848_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|1503143_1503317_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|1503489_1503645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|1503792_1503981_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066496.1|1503991_1504204_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|1504568_1505066_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|1505062_1505596_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001306174.1|1505709_1505970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189907.1|1505917_1506469_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.4	1.9e-35
WP_000839581.1|1506473_1506689_-|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000066482.1|1507441_1507657_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000087756.1|1507957_1508170_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122985741.1|1508224_1508314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047104.1|1508585_1509338_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	6.9e-137
WP_002431700.1|1509351_1510341_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	2.1e-194
WP_001061444.1|1510348_1511158_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|1511177_1511567_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210185.1|1511563_1511890_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	4.5e-53
WP_002431701.1|1511889_1512384_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	3.6e-86
WP_000104979.1|1512380_1513322_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
WP_001250269.1|1513311_1513491_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515828.1|1513666_1514218_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	2.6e-101
WP_000649477.1|1514261_1514462_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|1514552_1515227_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549623.1|1515461_1515668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|1515639_1516074_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_077632131.1|1515992_1516196_-	hypothetical protein	NA	U5P0J5	Shigella_phage	95.5	4.0e-31
WP_000135674.1|1516542_1516905_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.1e-60
WP_000081304.1|1516970_1517795_+	YfdQ family protein	NA	U5P439	Shigella_phage	98.9	9.5e-148
WP_000008231.1|1517923_1518460_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.3e-99
WP_024195021.1|1518494_1518689_+	hypothetical protein	NA	A5LH59	Enterobacteria_phage	95.3	2.2e-31
WP_071821821.1|1518694_1518970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|1519172_1519505_+	protein flxA	NA	NA	NA	NA	NA
WP_001218281.1|1519765_1520989_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.0	9.5e-237
1521183:1521197	attR	AAAGAGTAAAAGAGC	NA	NA	NA	NA
>prophage 6
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	1793302	1884119	4638019	tRNA,lysis,plate,capsid,holin,head,terminase,tail,portal,protease,integrase	Enterobacteria_phage(48.28%)	121	1819542:1819558	1872359:1872375
WP_148049245.1|1793302_1794304_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000426182.1|1794468_1794984_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030605.1|1795034_1795244_-	CsbD family protein	NA	NA	NA	NA	NA
WP_000874980.1|1795375_1796701_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646099.1|1796773_1797382_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002903.1|1797491_1797860_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017352.1|1798030_1800451_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455219.1|1800506_1801379_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019213.1|1801391_1801889_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782489.1|1802066_1802999_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000989132.1|1803105_1804446_-	maltoporin	NA	NA	NA	NA	NA
WP_000179181.1|1804520_1805636_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	9.6e-18
WP_000695373.1|1806013_1807204_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_002431751.1|1807357_1808902_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252084.1|1808914_1809805_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000107422.1|1810193_1811669_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
WP_000202902.1|1811712_1812123_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000745784.1|1812243_1814340_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000595517.1|1814339_1815077_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_015953922.1|1815073_1815712_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000757333.1|1815826_1816069_-	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_000790006.1|1816423_1818073_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001112915.1|1818365_1819715_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
1819542:1819558	attL	GGTAATGACCTGTCAAA	NA	NA	NA	NA
WP_000212700.1|1819859_1820789_+	zeta toxin; poison-antidote element	NA	NA	NA	NA	NA
WP_000619863.1|1820960_1821305_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	47.6	6.3e-21
WP_000724378.1|1821842_1822130_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.0e-16
WP_000266449.1|1822132_1822738_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	56.6	7.4e-57
WP_000777271.1|1822750_1823065_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.2	7.1e-19
WP_000404766.1|1823182_1823638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875309.1|1823634_1823832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729839.1|1823821_1825243_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.4	1.3e-192
WP_000907501.1|1825242_1825767_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	5.6e-69
WP_000658213.1|1825817_1826135_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015674804.1|1826094_1826223_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262474.1|1826323_1828699_+|tail	tail protein	tail	A4JWL0	Burkholderia_virus	28.0	1.0e-56
WP_000271435.1|1828698_1829652_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001269712.1|1829651_1829861_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_002431753.1|1829848_1830889_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.7	1.4e-74
WP_000679402.1|1830898_1831600_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_001093498.1|1831698_1832058_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_000951748.1|1832048_1833164_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	1.5e-100
WP_000359521.1|1833156_1833876_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	1.9e-22
WP_000135571.1|1833875_1835456_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.5	3.7e-84
WP_001091606.1|1835452_1836160_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_002431754.1|1836156_1836612_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	43.3	2.3e-26
WP_000471230.1|1836825_1837554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122141.1|1837583_1838375_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.9	1.4e-47
WP_000592044.1|1838380_1839508_-	slipin family protein	NA	NA	NA	NA	NA
WP_001207637.1|1840036_1840309_+	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_000227796.1|1841483_1842626_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_001201930.1|1842676_1842901_+	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_000936340.1|1842901_1843774_-	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_148049246.1|1844378_1845557_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.7	8.9e-232
WP_000132739.1|1845537_1845729_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_000545722.1|1845759_1845927_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.4e-26
WP_148049247.1|1845998_1846283_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	6.5e-48
WP_148049248.1|1846282_1846543_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	95.3	1.3e-39
WP_148049249.1|1846539_1847109_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	65.3	1.8e-68
WP_000118152.1|1847110_1847410_-	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_001214453.1|1847406_1847574_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_001111280.1|1847584_1847881_-	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	100.0	2.3e-51
WP_000951325.1|1847904_1848288_-	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_000031367.1|1848287_1848893_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_001243355.1|1849149_1849302_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1849286_1849421_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000597940.1|1849504_1849753_-	hypothetical protein	NA	K7P6N6	Enterobacteria_phage	100.0	1.6e-37
WP_000167595.1|1849937_1850408_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_095784420.1|1850746_1850935_-	hypothetical protein	NA	K7PMF8	Enterobacteria_phage	95.5	2.7e-18
WP_095784419.1|1850994_1851195_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	2.4e-33
WP_001296860.1|1851273_1851600_-	antitermination protein	NA	K7PHQ7	Enterobacteria_phage	100.0	2.0e-53
WP_001515060.1|1852088_1852730_-	LexA family transcriptional regulator	NA	K7PH71	Enterobacterial_phage	100.0	8.5e-120
WP_001515061.1|1852834_1853050_+	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	100.0	1.8e-34
WP_001177653.1|1853169_1853448_+	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_016247475.1|1853482_1854328_+	replication protein	NA	K7PGT1	Enterobacteria_phage	98.6	8.3e-139
WP_049238465.1|1854330_1855224_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	99.7	5.4e-165
WP_000145948.1|1855220_1855511_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_029701290.1|1855583_1855790_+	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	95.6	1.5e-30
WP_089672073.1|1855807_1856128_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	70.8	7.2e-35
WP_063113108.1|1856130_1856316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063113109.1|1856327_1856738_+	recombination protein NinB	NA	K7P6Y3	Enterobacteria_phage	98.5	9.4e-72
WP_001254251.1|1856734_1856917_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_065275667.1|1856913_1857084_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	98.2	9.3e-26
WP_001279421.1|1857076_1857346_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_065275668.1|1857345_1857957_+	recombination protein NinG	NA	A0A2D1GLP2	Escherichia_phage	99.5	6.0e-99
WP_000144614.1|1857953_1858160_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_040063253.1|1858137_1858803_+	serine/threonine protein phosphatase	NA	K7P7K6	Enterobacteria_phage	99.5	1.0e-131
WP_001235461.1|1858799_1859423_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_015980128.1|1859856_1860180_+|holin	phage holin, lambda family	holin	Q9MCT3	Escherichia_phage	100.0	2.9e-52
WP_000229392.1|1860163_1860640_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_148049250.1|1860636_1861074_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	98.6	2.9e-71
WP_148049251.1|1861280_1862009_+	DNA-binding protein	NA	K7PH51	Enterobacterial_phage	99.6	4.0e-142
WP_016063373.1|1862011_1862269_+	hypothetical protein	NA	K7PMB3	Enterobacterial_phage	100.0	5.0e-39
WP_016063049.1|1862661_1863003_+	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	100.0	2.7e-64
WP_016063192.1|1863002_1863206_+	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	100.0	4.7e-32
WP_074152610.1|1863145_1863373_+	hypothetical protein	NA	K7PKP7	Enterobacterial_phage	86.4	9.3e-13
WP_015980098.1|1863390_1863876_+	hypothetical protein	NA	Q77WA1	Escherichia_phage	100.0	7.0e-82
WP_015980155.1|1863882_1865397_+|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	100.0	2.8e-294
WP_148049252.1|1865396_1866671_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	99.5	2.8e-247
WP_015980150.1|1866688_1867366_+|head,protease	HK97 family phage prohead protease	head,protease	Q77W96	Enterobacteria_phage	100.0	3.2e-125
WP_015980102.1|1867368_1868526_+|capsid	phage major capsid protein	capsid	Q77WA0	Escherichia_phage	100.0	1.1e-213
WP_015980103.1|1868559_1868886_+	gp6	NA	Q77W99	Escherichia_phage	100.0	2.8e-55
WP_016063020.1|1868885_1869122_+|head	phage head closure protein	head	K7PJH1	Enterobacteria_phage	100.0	6.7e-38
WP_016063021.1|1869118_1869316_+	hypothetical protein	NA	K7PGR0	Enterobacteria_phage	100.0	1.3e-26
WP_015980106.1|1869317_1869650_+|head	phage head closure protein	head	Q9MCV2	Escherichia_phage	100.0	2.0e-56
WP_016063022.1|1869642_1870182_+	HK97 gp10 family phage protein	NA	K7PM60	Enterobacteria_phage	100.0	4.0e-94
WP_015980108.1|1870178_1870544_+	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	100.0	3.1e-66
WP_040091734.1|1870598_1871099_+|tail	phage major tail protein	tail	Q9MCU9	Escherichia_phage	98.8	5.1e-88
WP_015980110.1|1871137_1871623_+	lambda gpG analog	NA	K7PJU9	Enterobacteria_phage	100.0	4.1e-66
WP_016063025.1|1871818_1874239_+|tail	phage tail tape measure protein	tail	K7PGX8	Enterobacteria_phage	100.0	0.0e+00
1872359:1872375	attR	GGTAATGACCTGTCAAA	NA	NA	NA	NA
WP_015980113.1|1874238_1874577_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	100.0	1.0e-63
WP_015980114.1|1874573_1875329_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	100.0	4.8e-146
WP_016063158.1|1875330_1876041_+|tail	minor tail protein K	tail	K7P6F5	Enterobacteria_phage	100.0	2.4e-147
WP_016063027.1|1876070_1876412_+	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	100.0	1.1e-57
WP_016063028.1|1876455_1877061_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	100.0	5.2e-103
WP_148049253.1|1877113_1880665_+	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	99.1	0.0e+00
WP_015980130.1|1880666_1880969_+	hypothetical protein	NA	E4WL40	Enterobacteria_phage	100.0	7.4e-50
WP_015980131.1|1880968_1881607_+	hypothetical protein	NA	K7PJV8	Enterobacteria_phage	100.0	5.5e-119
WP_015980120.1|1881714_1881948_+	cor protein	NA	K7PH20	Enterobacteria_phage	100.0	2.7e-39
WP_148049254.1|1882006_1883296_+|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	69.5	2.5e-155
WP_148049255.1|1883391_1883658_-	DinI-like family protein	NA	K7PKR6	Enterobacteria_phage	93.2	2.6e-38
WP_148049256.1|1883735_1884119_+	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	57.4	6.3e-38
>prophage 7
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	2964118	2974107	4638019	tRNA,transposase	Tupanvirus(16.67%)	9	NA	NA
WP_148049283.1|2964118_2965789_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	3.9e-15
WP_001339197.1|2965757_2966966_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_148049346.1|2967064_2967244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000228925.1|2967561_2968068_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001183952.1|2968124_2968688_-	NADAR family protein	NA	A0A096XTA3	Enterococcus_phage	44.4	2.4e-33
WP_000437387.1|2968747_2970589_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918844.1|2970783_2972529_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.9e-76
WP_001144069.1|2972640_2972856_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264347.1|2973093_2974107_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	3.1e-108
>prophage 8
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	3710496	3719954	4638019		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569379.1|3710496_3711423_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	3.7e-23
WP_000783130.1|3711427_3712159_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3712139_3712247_-	protein YohO	NA	NA	NA	NA	NA
WP_001240384.1|3712306_3713038_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	97.0	2.0e-109
WP_002431447.1|3713259_3714945_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	93.8	3.3e-288
WP_000598631.1|3714941_3715661_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002431448.1|3715707_3716178_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	4.0e-82
WP_000643202.1|3716220_3716679_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.3	3.2e-52
WP_001087238.1|3716826_3718821_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	88.4	0.0e+00
WP_002431449.1|3718817_3719954_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	2.0e-164
>prophage 9
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	3774605	3852613	4638019	tRNA,capsid,holin,head,terminase,tail,portal,transposase,protease,integrase	Enterobacteria_phage(43.08%)	87	3781832:3781847	3817779:3817794
WP_000476004.1|3774605_3775967_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	7.1e-217
WP_000929408.1|3776113_3776446_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137876.1|3776625_3777348_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	34.7	2.9e-31
WP_000675169.1|3777344_3778748_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000130826.1|3778744_3780160_-	MFS transporter	NA	NA	NA	NA	NA
WP_000667571.1|3780160_3783238_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
3781832:3781847	attL	GACAGAAAGCGTCACG	NA	NA	NA	NA
WP_001197846.1|3783238_3786361_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000679021.1|3786360_3787608_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_061360905.1|3787951_3789025_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	95.8	6.7e-194
WP_001303849.1|3789002_3789221_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_032352680.1|3789260_3789428_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	8.3e-27
WP_000002107.1|3789500_3789785_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_097432965.1|3789784_3790006_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	94.5	3.5e-33
WP_001386642.1|3790104_3790386_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|3790396_3790588_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_072146987.1|3790560_3790743_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.6e-28
WP_000186848.1|3790739_3791420_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100845.1|3791416_3792202_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_080075635.1|3792207_3792504_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	4.0e-48
WP_000372937.1|3792578_3792722_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|3792690_3792855_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|3792927_3793296_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000213975.1|3793478_3793679_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|3793945_3794428_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_077764825.1|3794428_3794884_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	96.9	1.8e-63
WP_021526961.1|3795101_3795506_-	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	99.3	1.9e-69
WP_000028393.1|3795502_3796135_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	100.0	5.4e-119
WP_001194218.1|3796238_3796454_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|3796573_3796867_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185433.1|3796899_3797799_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.7	2.5e-173
WP_000788877.1|3797795_3798497_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145933.1|3798493_3798784_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736913.1|3798857_3799298_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_072667037.1|3799294_3799822_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	1.2e-100
WP_001254251.1|3799818_3800001_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000567007.1|3799997_3800168_+	protein ninF	NA	M1FPE8	Enterobacteria_phage	100.0	1.4e-26
WP_001108039.1|3800160_3800772_+	recombination protein NinG	NA	Q716C3	Shigella_phage	100.0	2.7e-99
WP_097432963.1|3800815_3801334_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.3	6.5e-94
WP_000839574.1|3801669_3801885_+|holin	holin	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_097432962.1|3801889_3802108_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	65.2	7.1e-18
WP_064226331.1|3802132_3802429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064226332.1|3802556_3803090_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	92.1	3.8e-97
WP_089592250.1|3803068_3803590_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_097432961.1|3803685_3804378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000867490.1|3804720_3805266_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.4	1.9e-80
WP_074525933.1|3805240_3807166_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|3807162_3807369_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_095885245.1|3807365_3808967_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	3.6e-308
WP_148049306.1|3808947_3810267_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	6.2e-234
WP_021559790.1|3810276_3810609_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
WP_000063273.1|3810664_3811690_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_000158895.1|3811731_3812127_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
WP_137577935.1|3812138_3812492_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	1.3e-61
WP_129942060.1|3812503_3813082_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000683145.1|3813078_3813474_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_115757878.1|3813481_3814222_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.4	9.5e-131
WP_129942062.1|3814237_3814660_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	3.1e-70
WP_129942063.1|3814641_3815076_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	5.8e-64
WP_148049307.1|3815068_3817648_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.1	0.0e+00
WP_148049308.1|3817644_3817974_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	96.3	5.8e-56
3817779:3817794	attR	CGTGACGCTTTCTGTC	NA	NA	NA	NA
WP_148049309.1|3817973_3818672_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	1.2e-130
WP_148049310.1|3818677_3819421_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.4e-150
WP_148049311.1|3819357_3819990_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.9e-96
WP_148049312.1|3820050_3823539_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	87.0	0.0e+00
WP_125282553.1|3823470_3823695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233185.1|3823606_3824206_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	89.9	1.1e-100
WP_148049313.1|3824270_3827645_+	short-chain fatty acid transporter	NA	A0A0E3GML4	Enterobacteria_phage	35.5	3.1e-11
WP_001824636.1|3827644_3828229_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	4.6e-104
WP_089580352.1|3828201_3828351_+|capsid	nucleocapsid protein	capsid	Q9JFR8	Wheat_rosette_stunt_virus	75.8	1.2e-05
WP_001282653.1|3828600_3829356_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_000447015.1|3829372_3830908_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	8.6e-102
WP_148049314.1|3831283_3832495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089580354.1|3833008_3835126_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_061360812.1|3835298_3836399_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_001386899.1|3837102_3837159_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_010723109.1|3837431_3837491_+	type I toxin-antitoxin system toxin IbsA	NA	NA	NA	NA	NA
WP_000003194.1|3837711_3838371_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000119038.1|3838367_3839129_+	protein-serine/threonine phosphatase PphC	NA	NA	NA	NA	NA
WP_000722360.1|3839193_3839655_-	YegJ family protein	NA	NA	NA	NA	NA
WP_000856095.1|3839855_3841802_+	protein kinase YegI	NA	NA	NA	NA	NA
WP_000469677.1|3841814_3843167_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	2.1e-06
WP_000288366.1|3843300_3844158_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_000042966.1|3844195_3847513_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000132077.1|3847849_3848491_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|3848582_3849164_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252280.1|3849185_3851039_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000868864.1|3851587_3852613_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	3876416	3882712	4638019		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001116074.1|3876416_3877811_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	29.4	2.8e-19
WP_000183028.1|3877978_3878872_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.4	7.9e-47
WP_000699458.1|3879250_3880336_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.2e-99
WP_001023649.1|3880335_3881235_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	6.3e-28
WP_000857515.1|3881292_3882171_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	7.8e-108
WP_001100789.1|3882175_3882712_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	1.3e-52
>prophage 11
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	3910777	3981110	4638019	lysis,capsid,head,holin,terminase,portal,tail,protease,integrase	Enterobacteria_phage(59.15%)	103	3909705:3909719	3948259:3948273
3909705:3909719	attL	TTACCGGAACGGCGG	NA	NA	NA	NA
WP_148049246.1|3910777_3911956_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.7	8.9e-232
WP_000132739.1|3911936_3912128_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_000545722.1|3912158_3912326_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.4e-26
WP_148049247.1|3912398_3912683_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	6.5e-48
WP_148049248.1|3912682_3912943_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	95.3	1.3e-39
WP_148049249.1|3912939_3913509_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	65.3	1.8e-68
WP_000118152.1|3913510_3913810_-	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_001214453.1|3913806_3913974_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_001111280.1|3913984_3914281_-	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	100.0	2.3e-51
WP_000951325.1|3914304_3914688_-	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_000031367.1|3914687_3915293_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_001243355.1|3915549_3915702_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|3915686_3915821_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000597940.1|3915904_3916153_-	hypothetical protein	NA	K7P6N6	Enterobacteria_phage	100.0	1.6e-37
WP_000167595.1|3916337_3916808_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_095784420.1|3917146_3917335_-	hypothetical protein	NA	K7PMF8	Enterobacteria_phage	95.5	2.7e-18
WP_095784419.1|3917394_3917595_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	2.4e-33
WP_148049317.1|3917673_3918054_-	antitermination protein	NA	K7PHQ7	Enterobacteria_phage	99.1	1.2e-52
WP_000026554.1|3918434_3919340_-	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	100.0	6.3e-177
WP_001274763.1|3919426_3920140_-	LexA family transcriptional regulator	NA	A4KWU3	Enterobacteria_phage	100.0	3.1e-131
WP_000437875.1|3920240_3920441_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001177648.1|3920559_3920838_+	transcriptional regulator	NA	A4KWU5	Enterobacteria_phage	100.0	2.1e-43
WP_148049318.1|3921020_3921911_+	DNA replication protein	NA	G5DA89	Enterobacteria_phage	99.0	9.9e-159
WP_000131492.1|3921900_3923337_+	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_000736913.1|3923413_3923854_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_014532161.1|3923850_3924024_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	3.2e-29
WP_000113776.1|3923990_3924167_+	NinE family protein	NA	I6RSI9	Salmonella_phage	75.9	3.3e-18
WP_124835187.1|3924139_3924334_+	protein ninF	NA	A0A0K2FJ27	Escherichia_phage	94.9	8.2e-26
WP_001283996.1|3924326_3924545_+	hypothetical protein	NA	S4TUE0	Salmonella_phage	68.1	4.3e-23
WP_000002243.1|3924545_3924836_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008200.1|3924832_3925195_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000994515.1|3925191_3925380_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001235459.1|3925376_3926000_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_012767708.1|3926111_3926306_+	hypothetical protein	NA	C6ZCW9	Enterobacteria_phage	100.0	1.0e-28
WP_000286100.1|3926678_3926882_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_136430554.1|3926859_3927357_+	lysozyme	NA	I6R0P2	Salmonella_phage	98.8	1.4e-90
WP_148049319.1|3927353_3927791_+|lysis	lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	96.6	9.4e-70
WP_148049251.1|3927997_3928726_+	DNA-binding protein	NA	K7PH51	Enterobacterial_phage	99.6	4.0e-142
WP_016063373.1|3928728_3928986_+	hypothetical protein	NA	K7PMB3	Enterobacterial_phage	100.0	5.0e-39
WP_016063049.1|3929378_3929720_+	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	100.0	2.7e-64
WP_016063192.1|3929719_3929923_+	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	100.0	4.7e-32
WP_074152610.1|3929862_3930090_+	hypothetical protein	NA	K7PKP7	Enterobacterial_phage	86.4	9.3e-13
WP_015980098.1|3930107_3930593_+	hypothetical protein	NA	Q77WA1	Escherichia_phage	100.0	7.0e-82
WP_015980155.1|3930599_3932114_+|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	100.0	2.8e-294
WP_148049252.1|3932113_3933388_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	99.5	2.8e-247
WP_015980150.1|3933405_3934083_+|head,protease	HK97 family phage prohead protease	head,protease	Q77W96	Enterobacteria_phage	100.0	3.2e-125
WP_015980102.1|3934085_3935243_+|capsid	phage major capsid protein	capsid	Q77WA0	Escherichia_phage	100.0	1.1e-213
WP_015980103.1|3935276_3935603_+	gp6	NA	Q77W99	Escherichia_phage	100.0	2.8e-55
WP_016063020.1|3935602_3935839_+|head	phage head closure protein	head	K7PJH1	Enterobacteria_phage	100.0	6.7e-38
WP_016063021.1|3935835_3936033_+	hypothetical protein	NA	K7PGR0	Enterobacteria_phage	100.0	1.3e-26
WP_015980106.1|3936034_3936367_+|head	phage head closure protein	head	Q9MCV2	Escherichia_phage	100.0	2.0e-56
WP_016063022.1|3936359_3936899_+	HK97 gp10 family phage protein	NA	K7PM60	Enterobacteria_phage	100.0	4.0e-94
WP_015980108.1|3936895_3937261_+	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	100.0	3.1e-66
WP_040091734.1|3937315_3937816_+|tail	phage major tail protein	tail	Q9MCU9	Escherichia_phage	98.8	5.1e-88
WP_015980110.1|3937854_3938340_+	lambda gpG analog	NA	K7PJU9	Enterobacteria_phage	100.0	4.1e-66
WP_016063025.1|3938535_3940956_+|tail	phage tail tape measure protein	tail	K7PGX8	Enterobacteria_phage	100.0	0.0e+00
WP_015980113.1|3940955_3941294_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	100.0	1.0e-63
WP_015980114.1|3941290_3942046_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	100.0	4.8e-146
WP_148049320.1|3942047_3942758_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	97.9	1.7e-145
WP_047357540.1|3942789_3943137_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	47.3	9.0e-07
WP_148049321.1|3943143_3943479_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	49.5	1.9e-22
WP_045261718.1|3943535_3944135_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	78.4	1.1e-79
WP_148049322.1|3944188_3947740_+	DUF1983 domain-containing protein	NA	K7PJL6	Enterobacteria_phage	99.8	0.0e+00
WP_015980130.1|3947741_3948044_+	hypothetical protein	NA	E4WL40	Enterobacteria_phage	100.0	7.4e-50
WP_015980131.1|3948043_3948682_+	hypothetical protein	NA	K7PJV8	Enterobacteria_phage	100.0	5.5e-119
3948259:3948273	attR	TTACCGGAACGGCGG	NA	NA	NA	NA
WP_015980120.1|3948789_3949023_+	cor protein	NA	K7PH20	Enterobacteria_phage	100.0	2.7e-39
WP_148049254.1|3949081_3950371_+|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	69.5	2.5e-155
WP_148049255.1|3950466_3950733_-	DinI-like family protein	NA	K7PKR6	Enterobacteria_phage	93.2	2.6e-38
WP_148049256.1|3950810_3951194_+	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	57.4	6.3e-38
WP_000384318.1|3951560_3952028_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200864.1|3952134_3953193_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000449651.1|3953360_3953696_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_000018486.1|3953805_3955020_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_024256479.1|3955009_3955456_-	EutP/PduV family microcompartment system protein	NA	NA	NA	NA	NA
WP_000431410.1|3955460_3955811_-	propanediol utilization microcompartment protein PduU	NA	NA	NA	NA	NA
WP_000075780.1|3955810_3956365_-	propanediol utilization microcompartment protein PduT	NA	NA	NA	NA	NA
WP_001082438.1|3956367_3957708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847522.1|3957704_3958817_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001097319.1|3958827_3960210_-	CoA-acylating propionaldehyde dehydrogenase PduP	NA	NA	NA	NA	NA
WP_001029494.1|3960206_3961214_-	two-domain cob(I)yrinic acid a,c-diamide adenosyltransferase PduO	NA	NA	NA	NA	NA
WP_000549821.1|3961224_3961500_-	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
WP_001083652.1|3961503_3961995_-	microcompartment protein PduM	NA	NA	NA	NA	NA
WP_000360798.1|3961991_3962624_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_000814169.1|3962623_3963058_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001057752.1|3963083_3963359_-	propanediol utilization microcompartment protein PduJ	NA	NA	NA	NA	NA
WP_000382982.1|3963378_3963729_-	propanediol dehydratase	NA	NA	NA	NA	NA
WP_001268868.1|3963718_3965551_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_001090594.1|3965561_3966086_-	propanediol dehydratase small subunit PduE	NA	NA	NA	NA	NA
WP_000405059.1|3966100_3966763_-	propanediol dehydratase medium subunit PduD	NA	NA	NA	NA	NA
WP_001256900.1|3966773_3968438_-	propanediol dehydratase large subunit PduC	NA	NA	NA	NA	NA
WP_000097503.1|3968456_3969266_-	propanediol utilization microcompartment protein PduB	NA	NA	NA	NA	NA
WP_015953494.1|3969262_3969547_-	propanediol utilization microcompartment protein PduA	NA	NA	NA	NA	NA
WP_024256672.1|3970050_3970842_+	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.0	1.9e-12
WP_000622360.1|3971036_3971954_+	regulatory protein PocR	NA	NA	NA	NA	NA
WP_105223494.1|3972452_3972938_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_000621209.1|3973164_3974091_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000481836.1|3974157_3974487_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000095888.1|3974502_3974904_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000139442.1|3974936_3975602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564322.1|3975613_3976234_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_001086627.1|3976230_3976713_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001275638.1|3976724_3977672_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_000035051.1|3977723_3981110_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 12
NZ_CP042945	Escherichia fergusonii strain ATCC 35471 chromosome, complete genome	4638019	3994569	4056267	4638019	plate,transposase	uncultured_Caudovirales_phage(22.22%)	49	NA	NA
WP_000243185.1|3994569_3995118_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000104379.1|3995368_3995641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534323.1|3995647_4000279_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	36.2	4.7e-26
WP_001106814.1|4000305_4000725_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_001114047.1|4000746_4002693_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	39.4	5.4e-24
WP_001142958.1|4002902_4003421_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002431475.1|4004013_4004613_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000058011.1|4004627_4006109_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000877049.1|4006111_4006549_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000895891.1|4006554_4008387_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000907477.1|4008350_4009388_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000829653.1|4009411_4010692_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_148049349.1|4010718_4011222_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000201155.1|4011224_4012580_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_050541402.1|4012617_4013382_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614294.1|4013390_4016117_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.3e-84
WP_000088869.1|4016113_4016857_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_024256676.1|4016853_4018293_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_148049350.1|4018401_4021833_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000069991.1|4021843_4023202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284966.1|4023219_4023699_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001293297.1|4023890_4024562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157545.1|4024561_4025011_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001252092.1|4025015_4025387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125282644.1|4025801_4026260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013541.1|4026271_4026592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032242811.1|4027177_4027501_-	DUF4102 domain-containing protein	NA	A0A0R6PDI8	Moraxella_phage	37.1	2.2e-07
WP_001011449.1|4028013_4028931_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001010985.1|4029032_4029983_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000598929.1|4030197_4030995_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000218044.1|4031524_4032376_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_002431477.1|4032484_4033942_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001274309.1|4035025_4035340_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000897388.1|4035597_4036017_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.7	1.4e-38
WP_000457675.1|4036016_4037285_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	1.9e-208
WP_000909943.1|4037465_4038284_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_125282640.1|4039306_4039597_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000202574.1|4039642_4040548_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_001227833.1|4040624_4041566_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_002431485.1|4041658_4045621_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000979518.1|4045675_4045885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148049323.1|4046043_4047552_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000497942.1|4047771_4048602_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_000154369.1|4048659_4049787_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199127.1|4049792_4051064_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_002431486.1|4051536_4052460_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.7	9.2e-91
WP_001061086.1|4052500_4052914_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000184889.1|4052915_4054241_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	B9UDL7	Salmonella_phage	32.6	3.8e-05
WP_001339197.1|4055058_4056267_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
