The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	1473563	1538712	8999201	integrase,transposase	Bacillus_phage(25.0%)	51	1471248:1471273	1486682:1486707
1471248:1471273	attL	ATGATTCACTTCCGGTGCTGGTTCTG	NA	NA	NA	NA
WP_109570712.1|1473563_1474692_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_148087621.1|1474759_1474969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087622.1|1475059_1475782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087623.1|1476374_1476767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034371.1|1477252_1477516_-	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	53.1	9.4e-17
WP_148087625.1|1477665_1478937_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_010034368.1|1478993_1479932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034366.1|1479962_1480253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034365.1|1480314_1480698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034364.1|1480756_1481602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034362.1|1481623_1482082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034360.1|1482099_1482324_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010034357.1|1482458_1482938_-	hypothetical protein	NA	A0A1B0T687	Bacillus_phage	31.3	5.2e-05
WP_010034354.1|1482954_1483509_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010034352.1|1484860_1485118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157506521.1|1485265_1485892_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010034343.1|1486681_1487038_+	hypothetical protein	NA	NA	NA	NA	NA
1486682:1486707	attR	ATGATTCACTTCCGGTGCTGGTTCTG	NA	NA	NA	NA
WP_010034341.1|1487409_1488228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034339.1|1488302_1488839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571549.1|1489002_1490106_+	MFS transporter	NA	NA	NA	NA	NA
WP_010034332.1|1490400_1490598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034329.1|1490614_1491877_+	anion transporter	NA	NA	NA	NA	NA
WP_010034326.1|1491892_1493335_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	23.5	4.1e-05
WP_010034325.1|1493331_1494711_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_157506518.1|1495678_1496215_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010034323.1|1496150_1496825_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_029600650.1|1497125_1498109_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	31.1	8.2e-13
WP_010034315.1|1498117_1500769_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_010034311.1|1500901_1501525_+	N-6 DNA methylase	NA	A0A1X9I6H1	Streptococcus_phage	45.4	4.2e-39
WP_010033207.1|1501625_1502783_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010034310.1|1503203_1506101_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_162097337.1|1506335_1509212_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010034307.1|1509334_1512175_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010034300.1|1512345_1515153_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_029600649.1|1515156_1516482_+	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_029600648.1|1516556_1517717_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_157506515.1|1517977_1518241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168217247.1|1518529_1518865_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010034287.1|1518994_1519135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034285.1|1519246_1519423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034279.1|1521872_1523480_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_081471431.1|1523652_1526034_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.5	1.5e-39
WP_010034273.1|1526033_1526750_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_010034268.1|1526848_1527796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034265.1|1527792_1529259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034258.1|1529262_1530633_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_148087628.1|1531237_1531708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034253.1|1531704_1532418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034248.1|1532429_1535516_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.7	8.8e-05
WP_010034247.1|1535515_1536217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034245.1|1537380_1538712_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	1669773	1726677	8999201	transposase,integrase	Virus_Rctr85(14.29%)	44	1680943:1680960	1713076:1713093
WP_109571546.1|1669773_1670793_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	31.7	4.4e-09
WP_010034153.1|1670939_1671197_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010034152.1|1671180_1671570_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_010034150.1|1671806_1672589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034148.1|1672731_1674840_-	hypothetical protein	NA	A0A1V0SLK6	Klosneuvirus	27.6	8.7e-12
WP_010034140.1|1675075_1679218_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010034137.1|1679272_1681069_-	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	40.5	6.3e-19
1680943:1680960	attL	GCCCGACCAGTTCGGCGA	NA	NA	NA	NA
WP_010034134.1|1681206_1681797_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010034131.1|1681987_1682392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034127.1|1682425_1683043_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010034124.1|1683325_1683517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081471425.1|1683684_1684512_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_010034118.1|1684550_1686134_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_010034109.1|1686206_1686653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034107.1|1686734_1687676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034105.1|1687672_1688533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034102.1|1688532_1688721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034098.1|1688727_1688907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034095.1|1688951_1689224_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_109571233.1|1689934_1690534_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_148087637.1|1691340_1692063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034082.1|1692086_1693433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087638.1|1693499_1694309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571232.1|1694305_1694836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087639.1|1694990_1695707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034073.1|1695881_1697780_+	Possible biopolymer transport protein, ExbB family	NA	NA	NA	NA	NA
WP_010034072.1|1697815_1698331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034070.1|1698646_1699771_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010041184.1|1700652_1701900_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.6	8.4e-31
WP_010034066.1|1702084_1702471_+	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010034062.1|1702927_1703947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034058.1|1704417_1706469_+	protein kinase	NA	Q91BL2	Spodoptera_litura_multicapsid_nucleopolyhedrovirus	24.9	2.0e-05
WP_148087640.1|1707233_1710542_+	TolC family protein	NA	NA	NA	NA	NA
WP_148087641.1|1710429_1712511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034564.1|1712690_1713407_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	8.8e-33
1713076:1713093	attR	TCGCCGAACTGGTCGGGC	NA	NA	NA	NA
WP_010034563.1|1713465_1714368_+	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
WP_033197798.1|1714678_1715980_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010034561.1|1716248_1717358_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_010034553.1|1717461_1718529_+	WD-40 repeat protein	NA	NA	NA	NA	NA
WP_085948010.1|1718629_1720135_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	31.6	8.9e-43
WP_010034546.1|1720213_1722130_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010034542.1|1722441_1723773_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010034543.1|1724539_1725349_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_010034542.1|1725345_1726677_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	2840122	2887594	8999201	tRNA,integrase,transposase,protease	Tupanvirus(50.0%)	42	2874015:2874058	2888556:2888599
WP_010044138.1|2840122_2841985_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.4	1.6e-102
WP_010049029.1|2843059_2843290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010049031.1|2843303_2844611_-	Na-Ca exchanger/integrin-beta4	NA	NA	NA	NA	NA
WP_148087704.1|2844896_2845697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010049035.1|2845856_2846615_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_010049036.1|2846618_2847554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157507032.1|2847550_2848636_-	DUF3419 family protein	NA	A0A2K9L408	Tupanvirus	24.2	1.0e-11
WP_010049040.1|2848766_2849231_-	response regulator	NA	NA	NA	NA	NA
WP_109571526.1|2849337_2850801_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010046324.1|2850941_2854046_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_010046327.1|2854163_2855537_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010046330.1|2855633_2856461_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_010046332.1|2856677_2857568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010046334.1|2857656_2858529_-	site-specific DNA-methyltransferase	NA	A0A0M4JJT6	Mollivirus	33.2	3.7e-33
WP_010046336.1|2858788_2859595_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010046338.1|2859690_2860467_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	9.0e-07
WP_010046340.1|2860482_2861673_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_148087705.1|2861794_2862856_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_109571134.1|2863034_2865356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010050895.1|2865761_2867975_-	DUF4139 domain-containing protein	NA	NA	NA	NA	NA
WP_010050892.1|2868139_2869396_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_010050889.1|2869537_2869954_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_010043115.1|2870161_2871871_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071529302.1|2871917_2872397_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_010033957.1|2872488_2873634_-|transposase	ISAs1-like element ISGob5 family transposase	transposase	NA	NA	NA	NA
2874015:2874058	attL	AGTCGGGCTGATAGGATTTGAACCTACGACCTCTTGGTCCCGAA	NA	NA	NA	NA
WP_162097345.1|2874212_2875646_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010043107.1|2875949_2876438_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_010043105.1|2876447_2876924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043102.1|2876988_2877390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043099.1|2877496_2877982_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_168217252.1|2878240_2878396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010043093.1|2878380_2878596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087706.1|2878650_2879040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157506806.1|2879084_2879591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043087.1|2879766_2880204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087708.1|2880358_2880835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087709.1|2880815_2881325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081471739.1|2881997_2882726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010040951.1|2883072_2883936_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_162097374.1|2883963_2885421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029600604.1|2885591_2887034_-|transposase	IS66-like element ISGob4 family transposase	transposase	NA	NA	NA	NA
WP_162542167.1|2887237_2887594_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2888556:2888599	attR	AGTCGGGCTGATAGGATTTGAACCTACGACCTCTTGGTCCCGAA	NA	NA	NA	NA
>prophage 4
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	2967443	3007010	8999201	integrase,transposase	Bacillus_phage(33.33%)	35	2963084:2963098	3011578:3011592
2963084:2963098	attL	CGCGACGCGGCCATG	NA	NA	NA	NA
WP_081471666.1|2967443_2967656_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010040951.1|2967627_2968491_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_010040953.1|2968844_2970041_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010040955.1|2970130_2973391_-	helicase-like protein	NA	NA	NA	NA	NA
WP_010040957.1|2973387_2975241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600930.1|2975244_2976432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600931.1|2976591_2977065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040963.1|2977061_2978243_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_010040965.1|2978217_2978940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040968.1|2979148_2982532_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	25.6	1.1e-45
WP_010040974.1|2982528_2983158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087715.1|2983154_2983925_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010040977.1|2984076_2984850_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_010040979.1|2985241_2987932_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_010040982.1|2987928_2988345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029600932.1|2989080_2990025_-	DUF932 domain-containing protein	NA	A0A1B1INA2	uncultured_Mediterranean_phage	30.5	1.6e-21
WP_071529320.1|2991504_2991732_+	hypothetical protein	NA	E5E420	Acinetobacter_phage	55.2	7.4e-10
WP_010044770.1|2992371_2992773_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_010044772.1|2992772_2993048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010044774.1|2993318_2993822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033199039.1|2993818_2994049_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010044779.1|2994185_2994326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087716.1|2994892_2995666_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_081471800.1|2995757_2996627_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_010044786.1|2996651_2997266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010044788.1|2997397_2997628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087717.1|2997982_2998726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033997.1|2998677_2999673_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157506873.1|3000085_3001390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044795.1|3001386_3002706_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_010044797.1|3002877_3003783_-	DMT family transporter	NA	NA	NA	NA	NA
WP_010044799.1|3003877_3004375_-	Dna2/Cas4 domain-containing protein	NA	NA	NA	NA	NA
WP_010044802.1|3004374_3004632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087718.1|3004869_3005994_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_081471802.1|3006014_3007010_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3011578:3011592	attR	CGCGACGCGGCCATG	NA	NA	NA	NA
>prophage 5
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	3191048	3235830	8999201	integrase,transposase,protease	Erwinia_phage(25.0%)	38	3182558:3182575	3240756:3240773
3182558:3182575	attL	GCTCGTCGGTGGCGTTCA	NA	NA	NA	NA
WP_010033548.1|3191048_3191744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010037885.1|3191713_3192184_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010037889.1|3192487_3193612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010047500.1|3193971_3194316_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010047502.1|3194455_3197332_+	TIGR03009 domain-containing protein	NA	NA	NA	NA	NA
WP_010035719.1|3197299_3198460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035721.1|3198548_3198929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010047504.1|3199020_3199350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010047506.1|3199435_3200695_-	amidohydrolase	NA	NA	NA	NA	NA
WP_010047508.1|3201446_3201935_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_010047511.1|3202122_3203034_+	thiamine-monophosphate kinase	NA	NA	NA	NA	NA
WP_010047513.1|3203163_3204195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010047515.1|3204558_3204855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048911.1|3205199_3205526_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
WP_010048913.1|3205713_3207498_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_010048915.1|3207706_3207979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048917.1|3208132_3208708_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010048919.1|3208701_3209454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048921.1|3209480_3211193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029601253.1|3211267_3211453_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_109571111.1|3211459_3213721_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_109571110.1|3213786_3214023_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_109571521.1|3214029_3214254_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_010047030.1|3214779_3215751_-	PhoH family protein	NA	W8D063	Erwinia_phage	44.7	1.5e-43
WP_010047032.1|3215889_3216744_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010047033.1|3216780_3217554_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	40.2	2.2e-21
WP_010047034.1|3217652_3218930_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	32.8	5.2e-60
WP_010047037.1|3219592_3220342_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010047039.1|3220857_3222420_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_010047041.1|3222873_3223851_+	glycoside hydrolase family 16 protein	NA	M1I6I5	Paramecium_bursaria_Chlorella_virus	29.6	1.4e-20
WP_033199433.1|3225512_3225806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033200040.1|3226342_3226813_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081471997.1|3226809_3228819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010050494.1|3228837_3229395_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_109571109.1|3229984_3231076_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_010033997.1|3231541_3232537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148087726.1|3234538_3235060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010039137.1|3235287_3235830_+|transposase	transposase	transposase	NA	NA	NA	NA
3240756:3240773	attR	TGAACGCCACCGACGAGC	NA	NA	NA	NA
>prophage 6
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	3462054	3526607	8999201	tRNA,transposase,protease	Bacillus_phage(33.33%)	48	NA	NA
WP_010039701.1|3462054_3464004_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_010039704.1|3464118_3464322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010039706.1|3464325_3464949_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_010039708.1|3465064_3465421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010039710.1|3465665_3468524_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_010039712.1|3468805_3471547_+	peptidase	NA	NA	NA	NA	NA
WP_109571092.1|3471742_3472678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168217254.1|3472595_3473123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010039714.1|3473260_3474079_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_010039720.1|3474171_3474987_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_010039722.1|3475106_3475595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087741.1|3475649_3475973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010039724.1|3476079_3479100_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_033198293.1|3479282_3480464_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010033207.1|3482121_3483279_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168217255.1|3483342_3484503_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_010039730.1|3484834_3485536_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_029600877.1|3485652_3486072_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_081471947.1|3486632_3487169_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033199793.1|3488547_3490011_-|transposase	IS66-like element ISGob3 family transposase	transposase	NA	NA	NA	NA
WP_109571516.1|3491017_3492397_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010048975.1|3492509_3492752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507029.1|3493427_3493823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570712.1|3494150_3495279_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010044538.1|3495861_3497103_+	protein kinase	NA	A0A291AU40	Pandoravirus	29.6	1.6e-13
WP_010044539.1|3497178_3497421_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010034542.1|3500053_3501385_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010044549.1|3501451_3501964_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010034520.1|3502011_3502533_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010033103.1|3502705_3502888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081471794.1|3502891_3503842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044560.1|3504307_3505051_-	RraA family protein	NA	NA	NA	NA	NA
WP_010044561.1|3505210_3506569_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010037885.1|3507020_3507491_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010033548.1|3507460_3508156_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109571090.1|3508321_3509254_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_010044567.1|3512404_3512995_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_109571089.1|3513567_3514272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571088.1|3514659_3515205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048029.1|3515399_3518483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048030.1|3518685_3519657_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_010048031.1|3519671_3520502_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_148087743.1|3520531_3521824_-	oxidoreductase	NA	NA	NA	NA	NA
WP_010048035.1|3521942_3523046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048166.1|3523868_3524447_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_010048167.1|3524549_3525131_-	single-stranded DNA-binding protein	NA	D7RWG9	Brochothrix_phage	33.6	6.1e-08
WP_010048168.1|3525292_3525841_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_010048169.1|3525965_3526607_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	3843133	3976911	8999201	transposase,protease	Shigella_phage(25.0%)	109	NA	NA
WP_010045444.1|3843133_3844321_+|protease	serine protease	protease	NA	NA	NA	NA
WP_109571067.1|3844368_3846594_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_010036516.1|3846708_3847344_-	HNH endonuclease	NA	M4NMF0	Synechococcus_phage	49.1	5.1e-08
WP_010036518.1|3847578_3848736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087759.1|3848732_3850193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600736.1|3850448_3852650_-	DUF2461 family protein	NA	K4I1H4	Acidithiobacillus_phage	32.3	1.0e-26
WP_010036522.1|3853537_3854293_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_010036523.1|3854294_3855713_-	MFS transporter	NA	NA	NA	NA	NA
WP_010036524.1|3856049_3856424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036525.1|3856549_3857461_-	hypothetical protein	NA	A0A1B1IQW3	uncultured_Mediterranean_phage	42.4	5.1e-17
WP_010036526.1|3857640_3858360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571066.1|3858525_3859638_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010036529.1|3860039_3860384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036530.1|3860525_3861710_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_010036535.1|3862827_3863781_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_010036536.1|3864092_3865175_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010036538.1|3865199_3866591_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_010036539.1|3866613_3868005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036540.1|3868153_3868420_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_010036544.1|3868561_3869506_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010036545.1|3869505_3869928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036546.1|3869943_3870213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036547.1|3870273_3871620_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_010036548.1|3871607_3872645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033207.1|3873574_3874732_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148087761.1|3875066_3875507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036553.1|3876066_3876270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036554.1|3876255_3876531_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081471506.1|3876534_3877092_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010036558.1|3877061_3877373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036560.1|3877498_3878884_+	DEAD/DEAH box helicase	NA	A7WKN6	Acidianus_filamentous_virus	25.5	1.2e-14
WP_010036563.1|3879008_3880319_+	DUF790 family protein	NA	NA	NA	NA	NA
WP_029600737.1|3880566_3881556_-	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_071529251.1|3881762_3882500_-	ComF family protein	NA	NA	NA	NA	NA
WP_063744571.1|3884605_3886801_+	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_010036579.1|3886807_3887134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036582.1|3887130_3888567_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010036583.1|3888622_3889879_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_010036585.1|3890073_3891492_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010036586.1|3891607_3893002_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010036587.1|3893041_3894322_+	DUF4272 domain-containing protein	NA	NA	NA	NA	NA
WP_010036589.1|3894497_3894737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036597.1|3895215_3896154_-	Beta-ribofuranosylaminobenzene 5'- phosphate synthase (mptG)	NA	NA	NA	NA	NA
WP_109571507.1|3896150_3896720_-	DUF447 family protein	NA	NA	NA	NA	NA
WP_109571065.1|3896806_3898303_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	41.9	6.1e-44
WP_148087762.1|3898363_3899485_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010042997.1|3899998_3900727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010042999.1|3900848_3901607_+	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_148087763.1|3902787_3906240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571506.1|3906861_3908232_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_010043010.1|3908989_3911461_+	DEAD/DEAH box helicase	NA	M1HQH9	Paramecium_bursaria_Chlorella_virus	33.8	5.5e-50
WP_085948063.1|3911582_3912296_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_010043015.1|3912420_3913323_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_010043016.1|3913383_3913689_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.9	1.1e-16
WP_109571064.1|3913746_3915591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571063.1|3915989_3918950_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.9	1.5e-65
WP_010051139.1|3919322_3920060_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_010051141.1|3920056_3920689_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_081472018.1|3920859_3922791_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_109571505.1|3922975_3923659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010042066.1|3923745_3924573_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.3	6.2e-46
WP_010038920.1|3924620_3924917_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	31.9	1.3e-06
WP_010049050.1|3924981_3925389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010049053.1|3925579_3926071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571062.1|3926931_3928060_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	28.6	7.7e-23
WP_010033207.1|3928841_3929999_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_029600695.1|3930206_3931538_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010038920.1|3932865_3933162_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	31.9	1.3e-06
WP_010042066.1|3933209_3934037_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.3	6.2e-46
WP_050790288.1|3934068_3934371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050790289.1|3934452_3935010_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010042070.1|3937590_3938547_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_157506777.1|3939202_3939412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081471704.1|3939597_3939786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081471705.1|3939792_3940260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042080.1|3940202_3940757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570712.1|3941337_3942465_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010042083.1|3942557_3942770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010042085.1|3942766_3943153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087764.1|3943516_3943609_-	TIGR02996 domain-containing protein	NA	NA	NA	NA	NA
WP_010042089.1|3943639_3944068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042091.1|3944563_3945262_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010042093.1|3945263_3945710_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010042099.1|3945995_3946457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042101.1|3946815_3947712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042108.1|3947695_3948049_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010042111.1|3948126_3948465_-	DUF3634 family protein	NA	NA	NA	NA	NA
WP_010042113.1|3948933_3950616_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_010042116.1|3950659_3951694_-	general secretion pathway protein GspF	NA	NA	NA	NA	NA
WP_010042118.1|3951781_3952162_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_010042120.1|3952255_3953428_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_109571058.1|3953327_3954449_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010042124.1|3954457_3954634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162097345.1|3954948_3956382_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010033207.1|3957524_3958682_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010045097.1|3958741_3959398_-	TIGR02996 domain-containing protein	NA	NA	NA	NA	NA
WP_029601113.1|3959411_3960029_-	TIGR02996 domain-containing protein	NA	NA	NA	NA	NA
WP_010045105.1|3960458_3960968_+	response regulator	NA	NA	NA	NA	NA
WP_010045107.1|3961162_3961429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029601114.1|3961601_3961820_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010045112.1|3961980_3962265_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_010045114.1|3962478_3962733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010045117.1|3962816_3964247_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010045120.1|3964528_3965272_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_010045123.1|3965424_3965568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010045124.1|3965817_3969381_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010045125.1|3969537_3970779_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_109571056.1|3971147_3974681_+	protein kinase	NA	A0A1V0SBL0	Catovirus	24.6	1.3e-07
WP_010050096.1|3974829_3976911_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	44.0	1.5e-101
>prophage 8
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	3994565	4054111	8999201	transposase	Shigella_phage(33.33%)	48	NA	NA
WP_109571055.1|3994565_3995948_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010038832.1|3995999_3996824_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109570957.1|3996842_3997427_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010038903.1|3997314_3997572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162097345.1|3997621_3999055_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010038906.1|3999163_3999520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038908.1|3999623_4000346_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109571053.1|4000326_4000770_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010033207.1|4000772_4001930_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010038916.1|4002785_4002974_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010038918.1|4002981_4003614_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.4	4.0e-29
WP_010038920.1|4003661_4003958_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	31.9	1.3e-06
WP_010038923.1|4004022_4004922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038926.1|4005386_4005671_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010038927.1|4005677_4006124_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010038931.1|4006170_4007289_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_010038933.1|4007325_4008243_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_010038935.1|4008239_4009178_-	cation transporter	NA	NA	NA	NA	NA
WP_010038937.1|4009718_4010492_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010038940.1|4010564_4011725_-	ATPase	NA	NA	NA	NA	NA
WP_063744589.1|4011847_4013068_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_010038944.1|4013122_4013623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038945.1|4013619_4014717_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_010038947.1|4014948_4015845_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_148087767.1|4016407_4017160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038953.1|4017256_4018186_-	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	29.5	1.3e-20
WP_010038957.1|4018405_4020742_+	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_010038961.1|4020814_4022137_+	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_010038963.1|4022423_4024058_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010038964.1|4024118_4024784_-	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_109571051.1|4024800_4026183_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010048201.1|4026255_4027101_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_010048203.1|4027084_4029970_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	33.3	2.2e-90
WP_010048204.1|4030037_4032623_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_010048206.1|4033315_4034461_-	N-methyl-L-tryptophan oxidase	NA	NA	NA	NA	NA
WP_010050810.1|4035453_4035822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010050815.1|4036021_4036633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081472009.1|4036708_4039363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010050819.1|4039636_4039873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087768.1|4040228_4040492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033197688.1|4040668_4042132_-|transposase	IS66-like element ISGob3 family transposase	transposase	NA	NA	NA	NA
WP_109571050.1|4042311_4044534_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.3	1.6e-69
WP_010039866.1|4045474_4045705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168217258.1|4046115_4047240_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010039874.1|4050347_4051019_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109571048.1|4051031_4051703_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010039875.1|4051764_4052868_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085948050.1|4052942_4054111_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.1	6.0e-55
>prophage 9
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	4754951	4823497	8999201	tRNA,integrase,transposase,protease	Ralstonia_phage(16.67%)	43	4773090:4773104	4826322:4826336
WP_157506876.1|4754951_4755491_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010045007.1|4755646_4757197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010045008.1|4757342_4758482_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	47.3	1.4e-96
WP_109571000.1|4758611_4758908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570999.1|4759354_4760815_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010048958.1|4761655_4762288_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_071529347.1|4762505_4762925_+	TIGR02996 domain-containing protein	NA	NA	NA	NA	NA
WP_109570998.1|4763008_4767406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570997.1|4767527_4769147_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_010051646.1|4769246_4769831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010051649.1|4769924_4770506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063744649.1|4770613_4771177_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_109570996.1|4771385_4772993_+	citramalate synthase	NA	NA	NA	NA	NA
4773090:4773104	attL	CGGAGGGGCCGGCGA	NA	NA	NA	NA
WP_109570995.1|4773155_4776290_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	31.5	1.3e-125
WP_148087809.1|4776605_4777481_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_010050293.1|4777491_4777929_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109570993.1|4777950_4778877_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.2	5.7e-16
WP_010050297.1|4778999_4779311_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071529364.1|4779490_4779718_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_010050298.1|4779734_4780652_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_109571490.1|4781067_4782420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570992.1|4782443_4783301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570991.1|4783367_4784351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010045595.1|4784387_4785563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571489.1|4785893_4787951_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	46.5	1.1e-59
WP_010045598.1|4788149_4788704_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010045599.1|4788751_4789939_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_010045600.1|4790268_4790943_+	heavy metal response regulator transcription factor	NA	NA	NA	NA	NA
WP_010045607.1|4792445_4793165_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_162542150.1|4799507_4801109_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_081472011.1|4802015_4803092_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_109571488.1|4803345_4803816_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_010038832.1|4805839_4806664_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_029600695.1|4807214_4808546_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109570989.1|4809317_4809875_-	exonuclease	NA	NA	NA	NA	NA
WP_010052450.1|4810220_4810610_+	SET domain-containing protein	NA	A0A1J0FA09	Only_Syngen_Nebraska_virus	36.1	1.1e-08
WP_109570988.1|4810995_4812591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087810.1|4812895_4815451_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_010051229.1|4815702_4815927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010051231.1|4816200_4816674_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_109570712.1|4816596_4817725_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_162542148.1|4819693_4822231_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_010043789.1|4822459_4823497_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4826322:4826336	attR	CGGAGGGGCCGGCGA	NA	NA	NA	NA
>prophage 10
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	4837380	4895673	8999201	transposase	Gordonia_phage(25.0%)	45	NA	NA
WP_109570720.1|4837380_4837824_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010035860.1|4837804_4838527_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010043829.1|4838869_4839169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010043832.1|4839171_4839720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087814.1|4839729_4840302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570981.1|4840525_4841146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052241.1|4842625_4842853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010052244.1|4843163_4843382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010052245.1|4843411_4845160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087815.1|4845538_4846099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087816.1|4846568_4847477_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_010051105.1|4848077_4848569_+	NUMOD4 domain protein	NA	A0A0E3T8A7	Gordonia_phage	43.4	7.4e-15
WP_010051116.1|4848623_4849277_+	TIGR02996 domain-containing protein	NA	NA	NA	NA	NA
WP_010040542.1|4850817_4851681_-	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_010040545.1|4851685_4852645_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_010040548.1|4852634_4855346_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_010040549.1|4855358_4855880_-	dehydrogenase	NA	NA	NA	NA	NA
WP_010040551.1|4856556_4858086_+	integral membrane sensor signal transduction histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	25.5	5.5e-08
WP_010040554.1|4858085_4859558_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_109570979.1|4859661_4863462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040566.1|4863579_4864296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087817.1|4864385_4865432_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010040570.1|4865431_4866385_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010040572.1|4866381_4867233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040574.1|4867269_4868130_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010040578.1|4868133_4869180_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_010040582.1|4870850_4871270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010040584.1|4871241_4871811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570978.1|4872303_4875156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010040590.1|4875244_4875874_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_109570977.1|4875980_4878248_+	protein kinase	NA	A0A1E1EXF7	Acanthamoeba_castellanii_mimivirus	33.3	8.7e-18
WP_010040595.1|4878334_4879351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162542147.1|4879416_4882029_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_029600879.1|4882810_4883425_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_168217254.1|4883560_4884088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162542145.1|4884005_4884941_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_029600880.1|4885286_4886684_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_010039798.1|4886801_4887152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081471624.1|4888121_4888658_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010039803.1|4890491_4891301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010039806.1|4891552_4892512_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_148087819.1|4892564_4893515_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	26.9	1.7e-07
WP_010039810.1|4893918_4894278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010039812.1|4894321_4894705_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010039814.1|4894755_4895673_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	5068289	5117205	8999201	tRNA,transposase	Klosneuvirus(100.0%)	40	NA	NA
WP_029601003.1|5068289_5069639_+|tRNA	tRNA modification GTPase TrmE	tRNA	NA	NA	NA	NA
WP_010042539.1|5069763_5070645_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010042542.1|5070712_5071468_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_010042543.1|5071497_5071971_+	TIGR03067 domain-containing protein	NA	NA	NA	NA	NA
WP_010042544.1|5072392_5074450_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010042545.1|5074521_5076072_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_010042546.1|5076068_5077049_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_010042549.1|5077079_5078408_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_010042551.1|5078443_5078965_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_029601004.1|5079033_5080722_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	30.2	2.5e-38
WP_010042555.1|5080994_5082374_-	arylsulfatase	NA	NA	NA	NA	NA
WP_010042557.1|5082561_5083938_+	UDPGP type 1 family protein	NA	NA	NA	NA	NA
WP_010042560.1|5084160_5085246_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_010042563.1|5085355_5086417_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_010035280.1|5086636_5090860_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010035283.1|5091102_5092611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035289.1|5093332_5093881_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162097341.1|5094026_5094236_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_010035293.1|5094583_5095378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035296.1|5095552_5096038_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_109570958.1|5096244_5097561_-	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_010035300.1|5097547_5098027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162097342.1|5099184_5100117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035303.1|5100163_5101735_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_010035304.1|5101806_5102118_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_050790216.1|5102135_5102522_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_010035309.1|5102587_5102938_-	flagellar biosynthesis protein FlgB	NA	NA	NA	NA	NA
WP_010035314.1|5103057_5104557_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_010035317.1|5104558_5104828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035319.1|5105006_5106191_-	response regulator	NA	NA	NA	NA	NA
WP_050790211.1|5106187_5108086_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_010035324.1|5109829_5110003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035327.1|5110069_5111401_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148087824.1|5111489_5111759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081471463.1|5112149_5112380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571485.1|5112532_5113780_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_162097343.1|5113907_5114948_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_010035390.1|5115215_5116040_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109570957.1|5116058_5116643_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010035343.1|5116530_5117205_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	5127614	5158711	8999201	transposase,integrase	Synechococcus_phage(33.33%)	24	5115215:5115274	5147469:5148317
5115215:5115274	attL	CATGCGAACCCAATCCTACCCGAGCGACGTGACCGACGAGCAGTGGGGGCTCATCGAGCC	NA	NA	NA	NA
WP_010035381.1|5127614_5128142_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_010035386.1|5128400_5129123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035388.1|5129028_5129931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035390.1|5129992_5130817_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010035394.1|5131048_5131999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600693.1|5132391_5133255_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010035405.1|5135022_5136369_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_029600694.1|5136554_5137220_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_010035410.1|5137252_5139058_-	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
WP_029600695.1|5139202_5140534_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010035415.1|5140888_5141206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035418.1|5141548_5146669_+	FG-GAP repeat protein	NA	F5B3Z3	Synechococcus_phage	40.4	1.4e-07
WP_010035390.1|5146702_5147527_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109570955.1|5147810_5148689_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.0	8.6e-22
5147469:5148317	attR	GGCTCGATGAGCCCCCACTGCTCGTCGGTCACGTCGCTCGGGTAGGATTGGGTTCGCATGGACCATTCTACCCACCCAACCGCCACATATGGGACAGTCACTAATTCCAAGTTCGGCAGGGCGTCACGAGGGCGCAACTCGTTTCGATCCTGCCACCGAAGGTCGTCTGTGTGTGACCAGTTTCAACCCAGAGGTGCAACGATGCGAATGCTCCACCTGTTCGTGCTCGCCATCAGCATGGTGGGCCTGGTGACGACTGCCGACGCTCGAGCGCGCGCAATGGACCCGCTGCCCGTGCCCGAACCGGTGGGATGCTGACGATTTGGCGGACAGTTCAGCTGCTTAGTTCTGGGCCATGGTGCGGGTTACGAATTGGTGGGGTGTAAGGTAGCCGATCGCCGAATGCTCCCGCTCGAGTCGGTAGTGCCTCACGTACTCCGCGACGACCGTCCGGGCCGCCACGACACTGTCATACTCGGCCACTTCGAGTTCGCGCTTGATCGAACTCCAACAACTTTCCATGAACGCGTTGTCGTAGCAGTTGTCCGCCCGACTCATGCTCTGCTTCATTGAGGCACGACGCAGCACAGCTCGATACTCGGTGCCGGCGTACTGCCCGCCGCGATCCGTGTGATGCACCAGACCGGCCCTCGGTTGGCGCTCGCGGATCGCACGGCGCAACACGTCCAGCACCAGCGGCTCCGTCATCGTCGCGTCAATTGACCACGCCACGATGTCACGCGAGTACCGGTCCAGCAACGCGGCCAGGTACCCGAACCCGCCGCCACGCAGCGGCAGGTACGTGATGTCGCCAACCCACAACTCATCGACCCGCGTCGGCTCATCCGC	NA	NA	NA	NA
WP_085948016.1|5149022_5149352_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_010035430.1|5149430_5149835_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010035434.1|5150220_5150493_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_010035436.1|5150572_5151229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035439.1|5151225_5151447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010035442.1|5151520_5155387_+	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	26.6	4.6e-11
WP_010035430.1|5155419_5155824_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109570953.1|5155902_5156511_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010043196.1|5156664_5157114_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010033494.1|5157553_5158711_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	5220496	5277944	8999201	tRNA,transposase	Synechococcus_phage(20.0%)	43	NA	NA
WP_010033997.1|5220496_5221492_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010051517.1|5221555_5221939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157507133.1|5223714_5224188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052548.1|5224871_5225249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570925.1|5226502_5226955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010047763.1|5228579_5229065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036145.1|5229183_5229588_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_010047764.1|5230210_5231482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010047766.1|5231553_5232561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010047767.1|5232708_5232969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010047768.1|5232976_5233882_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_010047769.1|5233916_5234249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157506985.1|5234914_5235946_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_010044655.1|5236155_5237646_+	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	M4QSA2	Synechococcus_phage	38.8	6.8e-19
WP_010044653.1|5237645_5238719_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_010044652.1|5238708_5240193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044651.1|5240283_5241231_+	lipopolysaccharide kinase RfaP	NA	NA	NA	NA	NA
WP_010044650.1|5241231_5242401_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010044649.1|5242445_5243942_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	29.3	8.9e-19
WP_157506867.1|5244157_5244334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157506864.1|5245909_5246020_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_010044642.1|5246152_5247556_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109570712.1|5247896_5249024_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010044639.1|5249158_5250742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010044637.1|5251077_5251887_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_010044635.1|5251883_5252213_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_010044632.1|5252331_5253636_-	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_109570921.1|5254301_5255543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087733.1|5255568_5255955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162542141.1|5256156_5257917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048679.1|5257961_5260727_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	52.5	1.9e-264
WP_010048682.1|5261685_5262927_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_010048684.1|5263096_5264071_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010048686.1|5264109_5265378_+	lactonase family protein	NA	NA	NA	NA	NA
WP_010033207.1|5265674_5266832_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033198625.1|5268396_5269218_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010042397.1|5269294_5269924_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010042399.1|5269942_5271256_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	44.1	1.3e-82
WP_010042408.1|5272845_5273118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168217239.1|5273356_5274124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042414.1|5274447_5274741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042417.1|5275193_5275601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162097345.1|5276510_5277944_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	5627740	5693630	8999201	tRNA,transposase	Pandoravirus(28.57%)	55	NA	NA
WP_157506574.1|5627740_5628958_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033199646.1|5628998_5631125_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_010048121.1|5631155_5631899_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010046530.1|5632019_5632835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010046528.1|5633049_5633895_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_010046524.1|5634669_5635272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010046520.1|5635353_5635665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010046517.1|5635679_5637254_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_010046515.1|5637285_5637648_+	flagellar hook capping protein	NA	NA	NA	NA	NA
WP_010046513.1|5637799_5639092_+	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_010046511.1|5638993_5639557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570720.1|5639700_5640144_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010035860.1|5640124_5640847_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010046509.1|5641361_5643173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010046506.1|5643524_5644802_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_029601164.1|5644955_5645642_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_010051660.1|5646164_5647586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010051663.1|5647736_5648609_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	37.2	5.5e-45
WP_010051666.1|5648727_5649489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029601278.1|5650029_5650785_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	9.7e-06
WP_010049698.1|5650795_5651674_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010049699.1|5651782_5654668_-	serine/threonine protein kinase	NA	A0A0B5J6A8	Pandoravirus	31.1	1.0e-18
WP_109570904.1|5654945_5657105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038879.1|5657187_5657799_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_010038878.1|5657837_5659013_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_010038877.1|5659413_5660145_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_162542137.1|5660187_5660691_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010038874.1|5660754_5660988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038871.1|5661000_5661264_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109571476.1|5661313_5661658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038865.1|5661750_5662113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038863.1|5662218_5662647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038860.1|5662758_5663115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038855.1|5663671_5664268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038854.1|5664399_5665035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038849.1|5665577_5666039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038846.1|5668056_5668506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038845.1|5668610_5669588_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010038837.1|5670016_5670295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038836.1|5670490_5671318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038832.1|5671340_5672165_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010038831.1|5672252_5672498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038828.1|5673082_5673283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038827.1|5673420_5673570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038826.1|5673595_5674129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029600843.1|5674600_5676877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038820.1|5676873_5678748_+	protein kinase	NA	A0A2P1EMR8	Moumouvirus	33.1	1.3e-22
WP_010038818.1|5678802_5680773_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	30.2	6.1e-68
WP_109570902.1|5681416_5683183_-	serine/threonine protein kinase	NA	S4VYW6	Pandoravirus	33.2	9.5e-20
WP_010038813.1|5683797_5685816_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010038811.1|5686031_5687867_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_010038808.1|5688468_5689050_+	response regulator	NA	W8CYM9	Bacillus_phage	34.5	1.3e-10
WP_010038805.1|5689159_5690836_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_010038797.1|5692380_5693079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071529272.1|5693009_5693630_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	5730126	5929264	8999201	integrase,transposase	Bacillus_phage(11.11%)	152	5817260:5817278	5840456:5840474
WP_010033207.1|5730126_5731284_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010039474.1|5731396_5732884_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	8.6e-14
WP_010039472.1|5733109_5734159_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109570897.1|5734212_5734656_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010033685.1|5734636_5735359_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010039467.1|5735532_5736168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081471615.1|5736678_5736933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010039459.1|5737185_5737650_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.4	1.8e-31
WP_071529277.1|5737724_5738777_-	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	30.5	1.9e-15
WP_010039455.1|5738862_5739696_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_029600866.1|5739699_5740584_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_010039449.1|5740641_5741709_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.3e-29
WP_010039447.1|5741885_5742023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570896.1|5741976_5743059_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_071529276.1|5743075_5744521_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010039442.1|5744534_5745731_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010039440.1|5745874_5746831_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_010039438.1|5746928_5748602_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010039435.1|5748691_5750773_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_010039432.1|5750881_5751784_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_148087852.1|5751866_5754326_-	GTPase domain-containing protein	NA	NA	NA	NA	NA
WP_010039423.1|5754408_5755059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010039420.1|5755078_5755591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010039418.1|5755587_5756118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010039416.1|5756271_5756658_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010039414.1|5756727_5758554_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_010039412.1|5758646_5760194_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_010039410.1|5760258_5762061_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	42.7	5.5e-23
WP_010039408.1|5762242_5762761_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_148087853.1|5762790_5763321_+	redoxin family protein	NA	NA	NA	NA	NA
WP_010041086.1|5763428_5763629_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_010041086.1|5763958_5764159_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_010041086.1|5764342_5764543_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_010041083.1|5764801_5766484_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_010041082.1|5766485_5766887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029600940.1|5766919_5767504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041079.1|5767565_5770409_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	26.8	7.6e-27
WP_010041078.1|5770564_5772130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041077.1|5772303_5774139_+	cytochrome c554	NA	NA	NA	NA	NA
WP_010041076.1|5774640_5778171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010041075.1|5778182_5778713_-	HAD hydrolase family protein	NA	A0A222YVZ6	Synechococcus_phage	32.5	1.5e-05
WP_010041072.1|5778717_5779752_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.6	2.0e-30
WP_168217264.1|5780349_5781288_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570720.1|5781320_5781764_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010033685.1|5781744_5782467_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570894.1|5784503_5785421_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010041065.1|5786084_5787449_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_010041062.1|5787650_5788148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041060.1|5788530_5789022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162542134.1|5789089_5792014_-	protein kinase	NA	A0A160EPW9	Powai_lake_megavirus	26.7	2.8e-16
WP_010052708.1|5792168_5793191_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_029600993.1|5793494_5794403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010042209.1|5794572_5796465_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010042205.1|5796692_5799284_-	response regulator	NA	NA	NA	NA	NA
WP_010042202.1|5800132_5801524_+	serine/threonine protein kinase	NA	M1HXV5	Paramecium_bursaria_Chlorella_virus	23.3	9.5e-07
WP_010042200.1|5801628_5802918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010042198.1|5803068_5804154_+	peptidase	NA	NA	NA	NA	NA
WP_010042196.1|5804180_5805578_-	Na+ dependent nucleoside transporter domain protein	NA	NA	NA	NA	NA
WP_010042194.1|5805762_5808837_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010042192.1|5809086_5810778_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRP3	Ostreococcus_lucimarinus_virus	25.9	1.7e-29
WP_010042189.1|5810811_5811567_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010042188.1|5811731_5812784_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010042187.1|5812994_5813333_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010042186.1|5813446_5813965_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_081471709.1|5814021_5814426_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_010042184.1|5814502_5816299_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_050790239.1|5816651_5817521_+	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
5817260:5817278	attL	CGCACGGGCCGACGAACTG	NA	NA	NA	NA
WP_109571475.1|5818912_5820514_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_010037351.1|5820586_5821165_+	MoeA domain protein, domain I and II	NA	NA	NA	NA	NA
WP_010037350.1|5821179_5822253_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_148087854.1|5822468_5824433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010037344.1|5824903_5825884_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010037342.1|5827393_5831107_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_010037339.1|5831184_5831421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010037336.1|5831847_5833152_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_010037332.1|5833465_5835478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010037329.1|5835575_5835953_+	DUF1580 domain-containing protein	NA	NA	NA	NA	NA
WP_010037327.1|5836040_5838941_+	DUF3854 domain-containing protein	NA	NA	NA	NA	NA
WP_010037325.1|5838937_5839366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010037323.1|5839824_5840391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010037320.1|5840383_5840683_-	hypothetical protein	NA	NA	NA	NA	NA
5840456:5840474	attR	CAGTTCGTCGGCCCGTGCG	NA	NA	NA	NA
WP_010037318.1|5840980_5841910_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SLZ7	Klosneuvirus	31.3	2.1e-10
WP_010037314.1|5841995_5843093_+	hypothetical protein	NA	A0A1V0SAS8	Catovirus	29.1	7.2e-10
WP_109570892.1|5843369_5844224_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	44.5	5.1e-19
WP_010037308.1|5844270_5844894_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010037307.1|5844906_5845569_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010037304.1|5846965_5854762_-	cadherin-like domain-containing protein	NA	A0A0N7C8U6	Skermania_phage	40.7	9.1e-06
WP_010037300.1|5854933_5857597_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_010037297.1|5858437_5858872_-	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	44.5	1.8e-25
WP_010037295.1|5858879_5859224_-	excisionase family DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	53.9	1.6e-24
WP_010037292.1|5859225_5859417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010037290.1|5860137_5860659_+	DUF3050 domain-containing protein	NA	A0A1L7N1A4	Ralstonia_phage	39.1	2.3e-22
WP_010033577.1|5868412_5868712_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_010033576.1|5868721_5870383_-	type I-MYXAN CRISPR-associated endonuclease Cas4/Cas1	NA	NA	NA	NA	NA
WP_071529222.1|5870398_5871160_-	type I-MYXAN CRISPR-associated protein Cas5/Cmx5/DevS	NA	NA	NA	NA	NA
WP_010033572.1|5871159_5872074_-	fruiting body developmental protein	NA	NA	NA	NA	NA
WP_081471411.1|5872095_5873808_-	type I-MYXAN CRISPR-associated protein Cmx8	NA	NA	NA	NA	NA
WP_162097333.1|5873820_5876130_-	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
WP_162542133.1|5876126_5876711_-	type I-MYXAN CRISPR-associated protein Cas6/Cmx6	NA	NA	NA	NA	NA
WP_010033555.1|5881242_5881434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033553.1|5881430_5881802_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010033550.1|5882125_5883919_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010033548.1|5885093_5885789_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010033545.1|5885758_5886229_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071529220.1|5886397_5887003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168217240.1|5886968_5887763_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010033539.1|5887865_5888966_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010033537.1|5889192_5889612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033536.1|5889648_5891778_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_010033532.1|5891781_5892480_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010033531.1|5892559_5893021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033524.1|5893084_5893888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033522.1|5893913_5894552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033520.1|5894568_5895513_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_010033518.1|5895514_5896870_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_010033516.1|5896866_5897592_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_109570712.1|5897652_5898780_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010033504.1|5898835_5899315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571472.1|5899366_5899975_-	hypothetical protein	NA	A0A2P1A2Z7	Mycobacterium_phage	25.9	2.2e-08
WP_010033500.1|5900183_5900402_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_109570712.1|5900871_5902000_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010033494.1|5902593_5903751_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010033491.1|5904000_5904432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087856.1|5904836_5905145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033485.1|5905141_5905435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087857.1|5905431_5905794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033481.1|5905813_5906209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087858.1|5906275_5906806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087859.1|5906802_5907024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033477.1|5907089_5908151_+	RNA ligase (ATP)	NA	A0A0F6WCT9	Sinorhizobium_phage	39.1	2.5e-55
WP_010033476.1|5908158_5908440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033474.1|5908896_5911806_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0S925	Catovirus	34.6	5.6e-09
WP_010033472.1|5911844_5912261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071529218.1|5912250_5914983_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_033197688.1|5915013_5916477_+|transposase	IS66-like element ISGob3 family transposase	transposase	NA	NA	NA	NA
WP_071529217.1|5916489_5916729_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_010033465.1|5917082_5917754_-	Homing nuclease of HNH family with NUMOD4 and IENR domains	NA	V5UQG0	Enterococcus_phage	38.5	4.3e-13
WP_010033463.1|5918012_5919164_+	hypothetical protein	NA	K4K6I9	Caulobacter_phage	31.5	3.5e-15
WP_010033462.1|5919160_5919337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033461.1|5919647_5919857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033457.1|5919900_5921931_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010033454.1|5922031_5922358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033451.1|5922495_5924001_+	DNA methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	29.9	5.0e-38
WP_148087861.1|5924020_5924491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033448.1|5924493_5924970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033446.1|5924962_5925220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033444.1|5925279_5925486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010033442.1|5925482_5925881_-	phage protein	NA	NA	NA	NA	NA
WP_109570887.1|5925877_5926096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087862.1|5926537_5927299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010033437.1|5927408_5927963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570712.1|5928135_5929264_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
>prophage 17
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	6328451	6380452	8999201	tRNA,transposase	Brazilian_cedratvirus(33.33%)	36	NA	NA
WP_029600855.1|6328451_6329399_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_010039057.1|6329488_6333397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571463.1|6333673_6333841_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_010051562.1|6333837_6334590_+	cobalt ECF transporter T component CbiQ	NA	NA	NA	NA	NA
WP_010051560.1|6334589_6335387_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.6	3.6e-11
WP_010051558.1|6335476_6336310_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_081471447.1|6337279_6337483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071529236.1|6338251_6338728_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_148087880.1|6339009_6339474_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_109570861.1|6340153_6341452_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_010034914.1|6342765_6343137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570712.1|6343238_6344366_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_157506541.1|6344515_6346396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034904.1|6347537_6348872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033197819.1|6349496_6350501_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_148087881.1|6350576_6351212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034902.1|6351244_6353356_-	serine/threonine protein kinase	NA	B5LWE2	Feldmannia_species_virus	25.4	3.4e-16
WP_010034901.1|6353370_6354033_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010034899.1|6354301_6356890_+	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_010034896.1|6356916_6358794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034892.1|6360775_6361138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034888.1|6361151_6363296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034883.1|6363346_6364546_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_010034879.1|6364600_6364888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034877.1|6364914_6365379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034876.1|6365426_6366008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010034870.1|6367181_6367790_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010034864.1|6369157_6369655_-	DUF2924 domain-containing protein	NA	NA	NA	NA	NA
WP_010034863.1|6370255_6371479_+	putative DNA modification/repair radical SAM protein	NA	NA	NA	NA	NA
WP_109570859.1|6371475_6372816_+	DUF4130 domain-containing protein	NA	NA	NA	NA	NA
WP_010034856.1|6374406_6375414_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_157506538.1|6375770_6376343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010034845.1|6376243_6377959_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_081471440.1|6377985_6378756_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010033957.1|6378890_6380036_+|transposase	ISAs1-like element ISGob5 family transposase	transposase	NA	NA	NA	NA
WP_010034836.1|6380176_6380452_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	6884553	6934382	8999201	transposase	uncultured_Caudovirales_phage(16.67%)	34	NA	NA
WP_010033997.1|6884553_6885549_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_029600978.1|6885746_6886106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010041939.1|6886170_6888183_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.4	3.9e-09
WP_010041934.1|6890054_6890588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010041933.1|6890947_6891139_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_010041931.1|6891248_6891950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570804.1|6892008_6892263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087905.1|6892259_6892616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010049964.1|6892854_6894525_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.1	7.8e-32
WP_010049962.1|6894628_6896539_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.7	9.2e-45
WP_010049960.1|6897574_6898975_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_010050013.1|6899155_6900010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010050011.1|6900125_6901283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010050009.1|6901430_6904934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570803.1|6905451_6906537_-	S49 family peptidase	NA	NA	NA	NA	NA
WP_109570802.1|6906877_6914659_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	24.7	6.5e-20
WP_010045541.1|6914996_6918383_+	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_010045537.1|6918382_6918655_+	putative acyl carrier protein	NA	NA	NA	NA	NA
WP_010045535.1|6919443_6920280_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033199147.1|6920429_6921062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010045531.1|6921104_6922274_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010045529.1|6922266_6922989_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	1.3e-31
WP_010045527.1|6923068_6923830_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_063744622.1|6924218_6924716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010045517.1|6924727_6925675_+	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_010045515.1|6925671_6926355_+	ATPase	NA	NA	NA	NA	NA
WP_010037269.1|6926496_6927567_-|transposase	ISKra4-like element ISGob7 family transposase	transposase	NA	NA	NA	NA
WP_081471554.1|6927563_6927932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010045512.1|6928018_6929653_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.0	1.5e-144
WP_010045510.1|6929787_6930906_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_010045508.1|6930838_6931165_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109570801.1|6931161_6932220_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010046813.1|6932296_6932626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010046807.1|6932978_6934382_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	7873501	7914132	8999201	transposase,protease	Bacillus_thuringiensis_phage(25.0%)	31	NA	NA
WP_010036248.1|7873501_7874497_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157506791.1|7875501_7876383_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010042506.1|7876358_7876838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042502.1|7877479_7878418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010042500.1|7878419_7879487_-	chemotaxis-specific protein-glutamate methyltransferase CheB	NA	NA	NA	NA	NA
WP_109570723.1|7879494_7882572_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	40.0	5.2e-13
WP_010047920.1|7882591_7883416_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_010047918.1|7883437_7885744_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.5	2.1e-11
WP_010047916.1|7885832_7887617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010047914.1|7887686_7888052_-	response regulator	NA	W8CYM9	Bacillus_phage	36.5	2.3e-13
WP_157506991.1|7888121_7889390_-	response regulator	NA	NA	NA	NA	NA
WP_071529344.1|7890120_7890438_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_109570720.1|7891335_7891779_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010035860.1|7891759_7892482_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570719.1|7892757_7893285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010048653.1|7893350_7894871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010048651.1|7895482_7897084_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_168217268.1|7897303_7897915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162542108.1|7898579_7901816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109570716.1|7901991_7903281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087962.1|7903309_7903738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087963.1|7903834_7904659_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_010051292.1|7904784_7905096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010048731.1|7905612_7906503_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010048729.1|7906618_7907383_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_010048726.1|7907423_7908110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048724.1|7908492_7909629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048723.1|7909983_7910415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010048722.1|7910634_7911936_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.2	2.3e-119
WP_050790363.1|7912117_7912972_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_010033207.1|7912974_7914132_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	8023213	8048442	8999201	transposase	Bacillus_virus(33.33%)	24	NA	NA
WP_010038619.1|8023213_8023519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010033957.1|8023669_8024815_+|transposase	ISAs1-like element ISGob5 family transposase	transposase	NA	NA	NA	NA
WP_029600833.1|8024791_8025280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600832.1|8025228_8025744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071529269.1|8025849_8026188_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081471584.1|8026141_8026603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033197911.1|8026702_8028166_+|transposase	IS66-like element ISGob3 family transposase	transposase	NA	NA	NA	NA
WP_010038605.1|8028184_8028688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010038603.1|8029131_8029707_-	elongation factor P	NA	NA	NA	NA	NA
WP_010038601.1|8029911_8031951_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_010038597.1|8032075_8033899_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_010049381.1|8034125_8034449_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_010049380.1|8034560_8036477_-	HTTM domain-containing protein	NA	NA	NA	NA	NA
WP_010049379.1|8036590_8037904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010049378.1|8038216_8038723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010049375.1|8038848_8039394_+	DUF2617 family protein	NA	NA	NA	NA	NA
WP_010049371.1|8039390_8040329_-	hypothetical protein	NA	G3M9V9	Bacillus_virus	31.5	2.7e-21
WP_010049370.1|8040408_8041251_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.4	1.6e-20
WP_010052621.1|8041381_8043130_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_010052619.1|8043276_8043780_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010036084.1|8043987_8046150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036083.1|8046208_8046931_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_168217242.1|8047294_8048107_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.7	2.9e-40
WP_010036081.1|8048148_8048442_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	8093333	8159207	8999201	tRNA,transposase	Staphylococcus_phage(12.5%)	56	NA	NA
WP_109570720.1|8093333_8093777_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010033685.1|8093757_8094480_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010036043.1|8095588_8096986_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_109571426.1|8097054_8097858_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_010046474.1|8097989_8099036_-	methyltransferase	NA	NA	NA	NA	NA
WP_010046471.1|8099212_8100187_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010046468.1|8100183_8101173_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_010046466.1|8101169_8102105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010046464.1|8102117_8103308_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010046462.1|8103298_8104045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010046460.1|8104054_8105302_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	3.7e-10
WP_010046458.1|8105309_8106212_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010046456.1|8106247_8107561_-	VanZ family protein	NA	NA	NA	NA	NA
WP_157506925.1|8107557_8108595_-	exosortase	NA	NA	NA	NA	NA
WP_010046445.1|8108841_8110158_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_010046443.1|8110411_8110843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010046439.1|8111006_8112050_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010044622.1|8112458_8112911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044620.1|8112991_8114515_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_010044614.1|8114627_8115365_+	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_085948077.1|8115791_8116160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044612.1|8116163_8117129_+	site-specific tyrosine recombinase XerD	NA	A0A1I9SC88	Mycobacterium_phage	31.7	6.3e-18
WP_010044611.1|8117187_8118162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010044608.1|8118320_8121539_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_010044605.1|8121834_8122227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087969.1|8122229_8123228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087970.1|8123240_8123615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071529318.1|8123666_8125154_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010044592.1|8125346_8126819_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	3.5e-36
WP_010044589.1|8127118_8127811_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010044587.1|8127826_8128309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044584.1|8128359_8128953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010044582.1|8129228_8129435_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_010044580.1|8129491_8129863_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_081471979.1|8130135_8131593_+	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_010049878.1|8131799_8133542_+	Hsp70 family protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	39.3	1.1e-79
WP_010049876.1|8133538_8134852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010049873.1|8134861_8136238_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_109571425.1|8136430_8138434_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	29.4	3.6e-15
WP_010050974.1|8138740_8140180_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_010049000.1|8140771_8143798_-	tetratricopeptide repeat protein	NA	S4VR00	Pandoravirus	30.0	6.4e-16
WP_010048999.1|8144064_8144928_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_010048997.1|8144972_8145263_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010048996.1|8145511_8146900_-	patatin family protein	NA	NA	NA	NA	NA
WP_010048995.1|8146992_8147541_-	orotate phosphoribosyltransferase	NA	E3SNS3	Prochlorococcus_phage	35.3	5.9e-21
WP_010048993.1|8147558_8147903_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_109571424.1|8147987_8149187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010052456.1|8149394_8150570_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010052458.1|8150726_8151677_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_063744651.1|8151696_8152086_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_109571423.1|8152194_8153613_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010042317.1|8153793_8154150_+	SET domain-containing protein	NA	A0A1V0CNS8	Kaumoebavirus	32.5	1.6e-06
WP_029600997.1|8154180_8156388_-	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_148087973.1|8156550_8156745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571600.1|8157115_8157298_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157506780.1|8158538_8159207_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	8222264	8286799	8999201	tRNA,transposase,protease	Bacillus_phage(33.33%)	53	NA	NA
WP_162097345.1|8222264_8223698_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010036643.1|8223757_8224126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036639.1|8224165_8226181_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_033197976.1|8226871_8228074_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010036635.1|8228827_8229262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036633.1|8229298_8229985_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_010036631.1|8230108_8230747_+	reverse transcriptase-like protein	NA	A0A2L0V0T1	Agrobacterium_phage	31.0	1.4e-05
WP_010036629.1|8230748_8233214_+	pyruvate phosphate dikinase PEP/pyruvate-binding domain protein	NA	NA	NA	NA	NA
WP_010036626.1|8233265_8233823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087978.1|8234517_8236083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036620.1|8236110_8237622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036616.1|8237633_8238854_-	response regulator	NA	W8CYM9	Bacillus_phage	37.7	1.3e-15
WP_010036612.1|8239045_8239600_+	NADH-quinone oxidoreductase subunit I	NA	NA	NA	NA	NA
WP_033197972.1|8239677_8240202_+	NAD(P)H-quinone oxidoreductase subunit 3	NA	NA	NA	NA	NA
WP_162542196.1|8240198_8242871_+	protein kinase	NA	K7YID8	Megavirus	25.0	1.4e-11
WP_010052562.1|8242874_8243486_+	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_010052565.1|8243536_8243731_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010047101.1|8244742_8245156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081471898.1|8245168_8245351_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010047100.1|8245457_8248097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010047098.1|8248270_8250157_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_010047095.1|8250579_8251521_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010047093.1|8251621_8252101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010047091.1|8252462_8252759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010047090.1|8252826_8253780_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_010047088.1|8253946_8254471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010047085.1|8254540_8254936_-	response regulator	NA	NA	NA	NA	NA
WP_010047082.1|8255223_8256213_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_109571598.1|8256540_8256723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052806.1|8256734_8257421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052802.1|8257978_8259775_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_148087979.1|8260452_8261544_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_081472047.1|8262387_8262678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010053284.1|8263147_8263600_-	universal stress protein	NA	NA	NA	NA	NA
WP_109571416.1|8263784_8264831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052054.1|8264827_8265115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087980.1|8265647_8265839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010052052.1|8265921_8266797_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_010052051.1|8266944_8267649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010052785.1|8268134_8270066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029600920.1|8270587_8270806_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_029600919.1|8270910_8271270_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_010040629.1|8272260_8272728_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_010040625.1|8272796_8273327_-	NADAR family protein	NA	A0A125SA38	Pseudomonas_phage	45.5	2.2e-33
WP_010040623.1|8273714_8275931_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_033198392.1|8276621_8277116_+	DinB family protein	NA	NA	NA	NA	NA
WP_010040619.1|8277183_8278479_+|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	35.6	1.3e-61
WP_109571415.1|8279211_8279622_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010040614.1|8279727_8280603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109570712.1|8280601_8281729_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.6e-23
WP_010040612.1|8282136_8283027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040610.1|8284905_8285181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162097345.1|8285365_8286799_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	8348642	8377485	8999201	tRNA,transposase	Shigella_phage(50.0%)	22	NA	NA
WP_010041008.1|8348642_8349161_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_010041007.1|8349363_8351796_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	44.6	1.2e-78
WP_010041006.1|8351991_8352459_+	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	38.9	5.8e-25
WP_010041005.1|8352503_8352971_-	VanZ family protein	NA	NA	NA	NA	NA
WP_010041003.1|8352967_8354035_-	protein arginine kinase	NA	NA	NA	NA	NA
WP_010041001.1|8354131_8354605_-	McsA	NA	NA	NA	NA	NA
WP_010040999.1|8354672_8355146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010040997.1|8355584_8356817_-	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_109571411.1|8356917_8360301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010036735.1|8360494_8361217_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010036730.1|8362149_8363397_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010036729.1|8363515_8364412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010036726.1|8364533_8364968_-	TIGR03067 domain-containing protein	NA	NA	NA	NA	NA
WP_010036724.1|8365247_8367368_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_010036721.1|8367637_8369080_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010036719.1|8369274_8373021_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010036718.1|8373495_8373966_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_081471511.1|8374426_8374963_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033197982.1|8375050_8375251_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010033207.1|8375300_8376458_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010036712.1|8376508_8377141_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.3	4.1e-26
WP_010036709.1|8377188_8377485_-|transposase	transposase	transposase	Q716C1	Shigella_phage	31.9	1.3e-06
>prophage 24
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	8474156	8581688	8999201	transposase,terminase,integrase	Bacillus_phage(25.0%)	90	8467287:8467303	8489590:8489606
8467287:8467303	attL	GTTGCTCGGGATCGTCC	NA	NA	NA	NA
WP_010038307.1|8474156_8474786_-|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_010038306.1|8474790_8475531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010038304.1|8475556_8475769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571591.1|8476059_8478729_-	peptidase	NA	A0A1B1P7L5	Bacillus_phage	29.4	1.3e-33
WP_010043572.1|8478849_8479620_-	site-specific DNA-methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	50.0	8.2e-61
WP_010043570.1|8479757_8480480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010043568.1|8480491_8481070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010043566.1|8481066_8481477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109571403.1|8481473_8481806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010043562.1|8481802_8482159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010043559.1|8482155_8482311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010043558.1|8482310_8482781_-	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_010043556.1|8482777_8483002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010043554.1|8483043_8483244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010043552.1|8483389_8483716_-	DUF1580 domain-containing protein	NA	NA	NA	NA	NA
WP_010043550.1|8484127_8484430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043548.1|8485103_8486306_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010043547.1|8486501_8487698_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_148087988.1|8488019_8488271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043546.1|8488691_8488991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109571402.1|8489176_8489797_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
8489590:8489606	attR	GTTGCTCGGGATCGTCC	NA	NA	NA	NA
WP_010043542.1|8489840_8490281_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010043539.1|8490574_8491480_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_010043537.1|8491762_8492266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087989.1|8492268_8492544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010043534.1|8492693_8493581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043533.1|8493761_8496095_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_109571398.1|8496290_8497022_-	permease	NA	NA	NA	NA	NA
WP_010049248.1|8497091_8497880_-	DUF1571 domain-containing protein	NA	NA	NA	NA	NA
WP_010035860.1|8498062_8498785_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570720.1|8498765_8499209_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_010037269.1|8499254_8500325_-|transposase	ISKra4-like element ISGob7 family transposase	transposase	NA	NA	NA	NA
WP_081471959.1|8500321_8500714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010049246.1|8501004_8502774_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_109571397.1|8502903_8504115_+	pilus assembly protein PilC	NA	NA	NA	NA	NA
WP_010043155.1|8504749_8505295_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_010043153.1|8505291_8505753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148087990.1|8505749_8507234_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_010043151.1|8507230_8508877_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_010043148.1|8508987_8510571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043146.1|8510669_8512391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043142.1|8512891_8513701_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_010043139.1|8513697_8514549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087991.1|8514788_8515730_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010043136.1|8516089_8520904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010043133.1|8521045_8522902_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010043129.1|8523107_8523449_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010043127.1|8523496_8523739_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148087992.1|8523810_8524068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010043121.1|8524608_8525271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948103.1|8525347_8525752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010049183.1|8526384_8527308_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010049185.1|8527691_8528609_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_010049187.1|8528625_8529039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050790373.1|8529226_8531788_+	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_109571395.1|8531867_8533232_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010050662.1|8533364_8534048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010050660.1|8534593_8538181_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_109571394.1|8538311_8539049_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_081472041.1|8539675_8539975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044707.1|8540252_8541716_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010044704.1|8541736_8542156_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_010044700.1|8542152_8542431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010044698.1|8542467_8545017_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_010044696.1|8545208_8549546_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010044694.1|8549775_8550942_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_010044691.1|8551280_8551490_-	carbon storage regulator	NA	H2BD56	Pseudomonas_phage	51.1	1.7e-05
WP_063744618.1|8553392_8554196_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_010044682.1|8554200_8554530_-	phosphatase	NA	NA	NA	NA	NA
WP_010044679.1|8554618_8555194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010044678.1|8555284_8556358_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010044677.1|8557053_8557530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010044676.1|8557665_8558166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010052675.1|8558335_8560363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010050401.1|8562432_8563698_-	acetylxylan esterase	NA	NA	NA	NA	NA
WP_010050398.1|8563787_8565722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010041575.1|8566002_8567379_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_010041573.1|8567505_8569146_-	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_109571590.1|8569305_8569425_-	YHS domain-containing protein	NA	NA	NA	NA	NA
WP_010041561.1|8570233_8570608_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_010041559.1|8571101_8571950_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_010041557.1|8572369_8573008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010041556.1|8573165_8573417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041555.1|8573421_8575518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010041553.1|8575543_8575771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148087993.1|8575814_8576813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033198504.1|8576854_8578564_-	DEAD/DEAH box helicase family protein	NA	B2CRJ8	Acidianus_filamentous_virus	22.8	7.8e-11
WP_010041547.1|8578730_8580101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010035860.1|8580541_8581264_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_109570720.1|8581244_8581688_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP042911	Gemmata obscuriglobus strain DSM 5831 chromosome, complete genome	8999201	8802953	8821522	8999201	transposase	Streptococcus_phage(50.0%)	19	NA	NA
WP_157507071.1|8802953_8803616_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_162683627.1|8803741_8804068_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010050319.1|8804370_8804601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010050317.1|8804604_8805642_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_109571381.1|8805820_8806540_-	sugar transferase	NA	NA	NA	NA	NA
WP_010050314.1|8806593_8807241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010050623.1|8807410_8809660_-	Etk-like tyrosine kinase involved in Eps biosynthesis	NA	A0A1X9I5D6	Streptococcus_phage	28.7	1.0e-10
WP_157507077.1|8809792_8810563_-	exosortase	NA	NA	NA	NA	NA
WP_071529367.1|8810478_8811663_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010033207.1|8811803_8812961_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010041170.1|8813076_8814315_-	peptidase T	NA	NA	NA	NA	NA
WP_010041168.1|8814362_8815115_-	endonuclease III	NA	NA	NA	NA	NA
WP_010041167.1|8815116_8815950_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010041166.1|8816117_8816849_-	sigma-70 family RNA polymerase sigma factor	NA	S5VTF2	Leptospira_phage	31.2	3.8e-07
WP_010041164.1|8817096_8817363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010041162.1|8817377_8817782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010041159.1|8817778_8820166_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_109571379.1|8820503_8821250_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_010041153.1|8821351_8821522_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
