The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042984	Histophilus somni strain UOC-KLM-ATR-03 chromosome, complete genome	2183498	365173	419204	2183498	capsid,protease,terminase,transposase,integrase	Mannheimia_phage(34.48%)	54	369322:369338	399152:399168
WP_075293630.1|365173_366418_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	6.3e-127
WP_012341086.1|366433_367015_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	1.2e-59
WP_011609585.1|367100_368399_-	trigger factor	NA	NA	NA	NA	NA
WP_101812545.1|368781_370173_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
369322:369338	attL	TTGGATATAAGCGAAAC	NA	NA	NA	NA
WP_132994681.1|370206_371466_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_132994680.1|371535_372333_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_132994679.1|372478_373855_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_075293625.1|373897_375637_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.9	5.1e-34
WP_075293624.1|376093_377335_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.5	8.8e-89
WP_011609578.1|377296_377482_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.6	1.7e-09
WP_075293623.1|377494_378289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293622.1|378320_379508_-	DNA cytosine methyltransferase	NA	A0A2I7R2G4	Vibrio_phage	46.5	1.6e-95
WP_075293621.1|379536_380265_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	60.2	9.0e-17
WP_132994678.1|380270_381311_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-12
WP_075293619.1|381360_382029_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	74.0	6.4e-94
WP_011609572.1|382967_383267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293616.1|383316_383601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293616.1|385157_385442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148417573.1|385528_386236_-	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	46.6	2.9e-20
WP_075293615.1|387354_387552_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	56.2	4.3e-14
WP_087437308.1|387554_387773_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_075293614.1|388652_388871_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	79.2	8.1e-22
WP_075293613.1|388894_389917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132994672.1|390057_390546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293611.1|390674_391091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437243.1|391087_391267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075290735.1|391535_391724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609564.1|392069_392336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437244.1|392881_393721_-	DNA replication protein DnaD	NA	F5A3D6	Riemerella_phage	39.3	3.1e-45
WP_087437245.1|393777_394464_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.4	5.5e-40
WP_012341693.1|394566_394794_+	hypothetical protein	NA	A0A1I9KFF6	Aeromonas_phage	43.1	2.8e-09
WP_075290719.1|394949_395183_+	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	76.7	1.1e-24
WP_147590441.1|396000_396693_+	replication protein P	NA	A0A077KCC8	Edwardsiella_phage	36.5	3.8e-25
WP_147590442.1|396702_397269_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	64.0	3.7e-66
WP_075293603.1|397272_397899_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	28.1	3.1e-18
WP_075293602.1|397911_398190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147590282.1|398268_398856_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	54.6	4.7e-48
WP_132994671.1|398845_399250_+	hypothetical protein	NA	NA	NA	NA	NA
399152:399168	attR	TTGGATATAAGCGAAAC	NA	NA	NA	NA
WP_147590283.1|399400_400240_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.2	1.3e-72
WP_075319826.1|400508_400925_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	7.4e-48
WP_075319827.1|400971_402108_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	56.4	2.6e-119
WP_012341704.1|402394_402631_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	70.5	2.7e-23
WP_011609542.1|402623_403160_+	lysozyme	NA	Q19UR6	Mannheimia_phage	50.3	5.2e-46
WP_132994669.1|403132_403462_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_041604566.1|403490_403634_+	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	69.8	9.9e-13
WP_147590443.1|403681_404353_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_132994668.1|404352_405900_+	TerL	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	42.4	4.9e-97
WP_132994667.1|405901_408079_+	hypothetical protein	NA	S4S2T1	Puniceispirillum_phage	26.1	5.2e-44
WP_132994664.1|408143_408338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147590444.1|411458_416153_+	hypothetical protein	NA	A0A2I7RNS1	Vibrio_phage	22.8	2.4e-22
WP_011609534.1|416659_416962_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_011609533.1|417059_417242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609532.1|417319_418183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132994663.1|418208_419204_+|capsid	N4-gp56 family major capsid protein	capsid	NA	NA	NA	NA
>prophage 2
NZ_CP042984	Histophilus somni strain UOC-KLM-ATR-03 chromosome, complete genome	2183498	463821	520754	2183498	transposase,integrase,protease	Escherichia_phage(16.67%)	57	489229:489245	507785:507801
WP_075319814.1|463821_464238_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_075319813.1|464284_465421_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_147590450.1|465676_466621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609888.1|466626_467073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609887.1|467290_467623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609885.1|467993_468641_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_132994536.1|468840_469146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147590451.1|469294_469624_-	heme utilization protein	NA	NA	NA	NA	NA
WP_147590452.1|469720_469945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133098725.1|470065_470533_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_011609880.1|471292_473323_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.2	1.2e-47
WP_041604434.1|473324_473612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609878.1|473706_474429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609877.1|474714_474966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609876.1|474962_475481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609875.1|475960_476440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147590453.1|477328_478498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081376607.1|478613_479048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293458.1|479895_480735_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_075293414.1|480718_481723_+	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	27.6	1.2e-19
WP_075293415.1|482344_482767_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_075293416.1|482819_483320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293417.1|483322_483520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293459.1|483693_484155_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075293418.1|484517_484928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293419.1|484929_486957_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_075293460.1|486959_488282_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
489229:489245	attL	TAATGTTTTATGATTTT	NA	NA	NA	NA
WP_011609871.1|490366_490561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609870.1|490564_490774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609869.1|490777_491575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609868.1|491722_492235_-	DUF3158 family protein	NA	NA	NA	NA	NA
WP_147590454.1|492275_492491_-	DUF1845 family protein	NA	NA	NA	NA	NA
WP_081376609.1|492744_493932_+|integrase	site-specific integrase	integrase	A0A1B5FPC6	Escherichia_phage	32.1	6.8e-46
WP_081376610.1|493903_494743_+	ATP-binding protein	NA	H7BWC4	unidentified_phage	38.5	1.6e-38
WP_041604971.1|495268_495472_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_135026463.1|495587_495869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293423.1|495837_496059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293424.1|496362_496545_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	67.8	2.2e-12
WP_012341117.1|496841_497060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341122.1|498014_498314_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_075293425.1|498524_499043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147590455.1|499225_499840_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011609866.1|499949_501179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609865.1|501341_501893_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_011609864.1|501903_503610_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_147590456.1|503599_504952_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	45.1	1.2e-83
WP_132994788.1|506099_507209_+	methionine biosynthesis PLP-dependent protein	NA	A0A1V0SL56	Klosneuvirus	25.0	1.2e-17
WP_011609498.1|507373_507697_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	4.3e-19
WP_012341146.1|507814_508510_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
507785:507801	attR	AAAATCATAAAACATTA	NA	NA	NA	NA
WP_012341148.1|508596_509838_-	uracil permease	NA	NA	NA	NA	NA
WP_011609495.1|509939_510566_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_075321856.1|511725_513075_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_147590457.1|513479_513887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132994786.1|514696_516487_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	44.2	2.1e-136
WP_012341153.1|516508_517537_-	sugar kinase	NA	NA	NA	NA	NA
WP_132994785.1|518037_519336_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.9	4.5e-67
WP_132994784.1|519401_520754_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP042984	Histophilus somni strain UOC-KLM-ATR-03 chromosome, complete genome	2183498	741844	770784	2183498	transposase,integrase,terminase	Burkholderia_phage(18.18%)	31	760556:760585	771263:771292
WP_014325826.1|741844_742609_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
WP_087437258.1|743672_745166_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|745277_745583_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014325824.1|745610_746825_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001447541.1|747101_747986_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_075268008.1|748306_748531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325823.1|748613_749906_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025288851.1|750068_750914_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|751082_751886_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|751885_752722_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|753057_753873_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021112546.1|754789_755800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340803.1|757148_758048_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
WP_012340802.1|758197_758635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340801.1|759366_759945_-	hypothetical protein	NA	NA	NA	NA	NA
760556:760585	attL	ATTTTAGTAGTATAAATGGTAGTATAAAAT	NA	NA	NA	NA
WP_147590471.1|760695_761943_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	31.5	2.1e-53
WP_075294469.1|762235_762493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294470.1|762502_763012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340798.1|763179_763401_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_075294471.1|763410_763656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147590472.1|763656_763896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147590473.1|763840_764437_+	ash family protein	NA	NA	NA	NA	NA
WP_075294473.1|764588_765071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294474.1|765063_765282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041604074.1|765268_765637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294476.1|766162_768073_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	31.1	3.1e-48
WP_041604501.1|768616_768883_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	43.5	2.7e-11
WP_011608692.1|768918_769314_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.5	5.6e-05
WP_147590474.1|769452_769755_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	33.8	4.1e-08
WP_075294478.1|769757_770345_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.7	5.0e-10
WP_075294479.1|770337_770784_+|terminase	terminase	terminase	NA	NA	NA	NA
771263:771292	attR	ATTTTAGTAGTATAAATGGTAGTATAAAAT	NA	NA	NA	NA
>prophage 4
NZ_CP042984	Histophilus somni strain UOC-KLM-ATR-03 chromosome, complete genome	2183498	1652938	1660210	2183498	transposase	Planktothrix_phage(16.67%)	6	NA	NA
WP_075320114.1|1652938_1654891_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	6.2e-12
WP_041604300.1|1654894_1655701_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	6.3e-19
WP_132995053.1|1655781_1657368_+	FAD-binding protein	NA	M1I0Y3	Acanthocystis_turfacea_Chlorella_virus	23.9	7.5e-08
WP_075319813.1|1657524_1658661_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_075319814.1|1658707_1659124_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_011609430.1|1659238_1660210_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	19.7	2.1e-05
>prophage 5
NZ_CP042984	Histophilus somni strain UOC-KLM-ATR-03 chromosome, complete genome	2183498	1869915	1932611	2183498	tail,head,terminase,plate,tRNA,transposase	Haemophilus_phage(38.46%)	70	NA	NA
WP_081376598.1|1869915_1870089_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075294192.1|1870775_1871573_-	transcriptional regulator	NA	A0A0M4UKA3	Ralstonia_phage	27.4	8.6e-13
WP_075294193.1|1871695_1871959_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_075294194.1|1873929_1874811_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	85.0	3.7e-134
WP_075294195.1|1874818_1875007_+	hypothetical protein	NA	F6MII8	Haemophilus_phage	80.0	1.3e-20
WP_075294196.1|1875003_1875309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147590523.1|1876105_1876321_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_135026520.1|1876305_1876548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294199.1|1876685_1877144_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_075294200.1|1877237_1877426_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	52.7	2.8e-07
WP_075294201.1|1878154_1878823_+	hypothetical protein	NA	A0A0R6PJV6	Moraxella_phage	45.3	2.7e-20
WP_075294202.1|1878833_1879040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294203.1|1879164_1879590_+	mor transcription activator family protein	NA	F6MIJ8	Haemophilus_phage	66.4	1.5e-48
WP_075294204.1|1879679_1880222_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	67.2	2.5e-72
WP_147590524.1|1880228_1880459_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	52.7	1.4e-11
WP_075294206.1|1880455_1880713_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_075294208.1|1880829_1881084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294209.1|1881080_1881335_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	45.0	1.6e-08
WP_075294210.1|1881337_1881847_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	72.2	8.7e-67
WP_135026522.1|1881951_1883565_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	85.1	2.5e-277
WP_075294211.1|1883643_1885263_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	84.1	4.4e-266
WP_075294212.1|1885249_1886521_+|head	phage head morphogenesis protein	head	A0A0M3LSH7	Mannheimia_phage	70.9	2.3e-169
WP_081376597.1|1886762_1887308_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	75.4	1.1e-62
WP_075294213.1|1887307_1888288_+|head	head protein	head	B7SDP1	Haemophilus_phage	73.8	1.2e-133
WP_075294214.1|1888366_1888789_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	64.5	6.5e-44
WP_075294215.1|1888785_1889424_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	70.8	5.0e-80
WP_075294216.1|1889420_1889687_+	hypothetical protein	NA	B7SDP6	Haemophilus_phage	67.1	6.0e-27
WP_075294217.1|1889673_1889847_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	72.7	3.7e-14
WP_075294218.1|1889846_1891268_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	74.8	1.5e-196
WP_075294219.1|1891279_1891654_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	85.5	3.3e-55
WP_087437316.1|1891722_1892010_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	52.8	3.5e-17
WP_075294221.1|1892280_1894413_+	hypothetical protein	NA	A0A0M3LPB6	Mannheimia_phage	37.0	9.8e-96
WP_087437296.1|1894454_1895810_+	hypothetical protein	NA	F6MIL2	Haemophilus_phage	61.9	1.4e-159
WP_147590525.1|1895820_1896927_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	71.8	2.7e-158
WP_075294223.1|1896923_1897583_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	69.4	1.3e-83
WP_075294224.1|1897685_1898036_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	78.4	9.9e-46
WP_075294225.1|1898048_1899110_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	72.4	1.1e-145
WP_075294226.1|1899109_1899673_+	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	41.9	4.8e-34
WP_147590526.1|1899675_1901238_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	51.1	2.0e-66
WP_012341722.1|1901234_1901582_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	50.9	1.3e-18
WP_012340329.1|1901565_1901817_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	50.6	1.2e-13
WP_147590527.1|1901907_1902504_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	60.9	1.1e-57
WP_147590528.1|1903553_1903709_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_132994802.1|1903815_1904505_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_132994803.1|1904699_1906421_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	1.2e-67
WP_147590529.1|1906413_1907106_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_132994805.1|1907242_1908340_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.1	1.7e-06
WP_132994847.1|1908415_1909927_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.2	2.2e-86
WP_132994817.1|1910217_1911420_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.7	1.1e-22
WP_132994819.1|1911859_1912429_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_133098770.1|1912757_1913363_+	porin family protein	NA	NA	NA	NA	NA
WP_075294460.1|1913384_1913828_+	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_148417628.1|1913950_1914925_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	2.0e-51
WP_011609634.1|1916113_1917403_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012341351.1|1917463_1917991_-	DUF1523 family protein	NA	NA	NA	NA	NA
WP_132994821.1|1918018_1918801_-	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_041604354.1|1918809_1919799_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_132994823.1|1919791_1920424_-	dTMP kinase	NA	W8D0J5	Erwinia_phage	34.4	1.3e-19
WP_132994825.1|1920433_1921474_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011609640.1|1921605_1922418_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011609641.1|1922564_1923263_+	competence protein	NA	NA	NA	NA	NA
WP_011609642.1|1923355_1923937_+	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_075294453.1|1923974_1925291_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_132994827.1|1925357_1927661_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_011609645.1|1927840_1928317_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011609646.1|1928326_1928608_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_075294451.1|1928608_1929292_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_132994829.1|1929297_1931103_+	potassium transporter	NA	NA	NA	NA	NA
WP_012341339.1|1931115_1931604_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_012341338.1|1931603_1932611_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
