The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	0	29827	2110729	tRNA	Streptococcus_phage(100.0%)	30	NA	NA
WP_011609851.1|916_1135_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_136121705.1|1201_1651_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_136121704.1|2031_3921_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_136121703.1|3920_4583_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_011609847.1|4695_5085_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_136121702.1|5103_5901_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_012340945.1|5999_6254_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_136121701.1|6318_6789_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_136121700.1|6802_7351_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_136121699.1|7363_8905_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_011609841.1|8928_9798_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_075294281.1|9811_11185_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_075321407.1|11227_11656_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_012340939.1|11844_12156_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_136121698.1|12483_13824_+	Na(+)-translocating NADH-quinone reductase subunit A	NA	NA	NA	NA	NA
WP_011609836.1|13826_15065_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit B	NA	NA	NA	NA	NA
WP_011609835.1|15057_15834_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_011609834.1|15833_16457_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit D	NA	NA	NA	NA	NA
WP_011609833.1|16460_17057_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
WP_136121697.1|17071_18295_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit F	NA	NA	NA	NA	NA
WP_136121696.1|18398_18911_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_136121695.1|18926_19976_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_136121694.1|19985_20240_+	(Na+)-NQR maturation NqrM	NA	NA	NA	NA	NA
WP_075294284.1|20279_20792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136121693.1|20826_21978_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_132995008.1|22061_22655_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_136121692.1|22651_25120_-	trimethylamine-N-oxide reductase TorA	NA	NA	NA	NA	NA
WP_136121691.1|25134_26304_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_075321405.1|26558_28040_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_136121690.1|28168_29827_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	33.0	1.1e-73
>prophage 2
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	41057	45352	2110729		Synechococcus_phage(50.0%)	4	NA	NA
WP_136121682.1|41057_42512_-	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	31.6	3.3e-34
WP_075294298.1|42631_43057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147604058.1|43112_43811_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_136121680.1|43861_45352_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.9	2.3e-83
>prophage 3
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	48865	52224	2110729		Streptococcus_phage(50.0%)	2	NA	NA
WP_011609790.1|48865_50968_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	1.2e-58
WP_011608348.1|51039_52224_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.1	6.4e-12
>prophage 4
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	60030	60411	2110729		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_011609781.1|60030_60411_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	33.6	4.7e-09
>prophage 5
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	74745	77815	2110729		Staphylococcus_phage(50.0%)	2	NA	NA
WP_075290452.1|74745_76362_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	7.1e-139
WP_075321223.1|76555_77815_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.0	6.0e-101
>prophage 6
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	80881	87697	2110729	protease	Prochlorococcus_phage(33.33%)	7	NA	NA
WP_075321226.1|80881_82483_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	1.1e-70
WP_075321227.1|82617_83127_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_011609769.1|83204_84359_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.0	9.0e-128
WP_011609768.1|84633_85212_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_136121915.1|85222_86017_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075294043.1|86026_86839_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_075294044.1|86845_87697_+	thymidylate synthase	NA	H9EB68	Vibrio_phage	76.7	4.9e-131
>prophage 7
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	103965	104895	2110729		Synechococcus_phage(100.0%)	1	NA	NA
WP_136121773.1|103965_104895_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.0	1.3e-31
>prophage 8
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	123362	129936	2110729		Bodo_saltans_virus(33.33%)	6	NA	NA
WP_011609739.1|123362_124730_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.3	8.2e-112
WP_075294259.1|124809_125247_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075294258.1|125414_126182_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_136121764.1|126267_127548_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_136121763.1|127547_128024_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.2	3.0e-21
WP_136121762.1|128097_129936_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	1.2e-30
>prophage 9
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	138550	143186	2110729		Staphylococcus_phage(50.0%)	3	NA	NA
WP_075294253.1|138550_140068_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	9.7e-13
WP_012341274.1|140105_141062_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_136121787.1|141248_143186_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.9	1.2e-20
>prophage 10
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	150232	151153	2110729		Dickeya_phage(50.0%)	2	NA	NA
WP_041604994.1|150232_150472_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	63.9	4.7e-07
WP_011609717.1|150544_151153_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	42.0	6.2e-19
>prophage 11
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	162322	174604	2110729		Chrysochromulina_ericina_virus(33.33%)	5	NA	NA
WP_075294085.1|162322_166351_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.2	3.0e-21
WP_136121840.1|166441_170704_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.7	2.4e-69
WP_075294086.1|171040_171892_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_136121841.1|172085_173021_+	D-allose transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_136121842.1|173068_174604_+	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.7	2.2e-12
>prophage 12
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	178127	193275	2110729	protease	uncultured_Caudovirales_phage(28.57%)	14	NA	NA
WP_136121844.1|178127_179459_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.4	7.1e-44
WP_011609687.1|179476_180004_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_136121845.1|180292_181357_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_132995297.1|181373_181964_+	DUF416 family protein	NA	NA	NA	NA	NA
WP_136121846.1|182122_182398_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	58.4	7.3e-20
WP_132995277.1|182554_183337_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_132995279.1|183362_185195_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HRE7	Paramecium_bursaria_Chlorella_virus	44.6	7.3e-132
WP_132995281.1|185266_186097_-	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_075294096.1|186132_186822_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011609679.1|186811_187849_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	37.7	9.8e-33
WP_012341404.1|188003_188558_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_136121847.1|188709_189825_-	restriction endonuclease subunit S	NA	A0A2H4J4K4	uncultured_Caudovirales_phage	38.8	1.0e-19
WP_136121848.1|189833_191876_-	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	35.7	3.6e-79
WP_075321369.1|192132_193275_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.9	5.5e-53
>prophage 13
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	204107	205418	2110729		Mycoplasma_phage(100.0%)	1	NA	NA
WP_136121549.1|204107_205418_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	32.2	2.8e-40
>prophage 14
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	208870	213857	2110729	tRNA	uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_132995346.1|208870_211771_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	38.4	3.5e-19
WP_132995344.1|211772_212438_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_075294427.1|212506_213271_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_075320162.1|213329_213857_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	66.3	9.6e-61
>prophage 15
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	217979	224039	2110729	tRNA	Enterobacteria_phage(33.33%)	5	NA	NA
WP_132995337.1|217979_218801_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	Q1MVG7	Enterobacteria_phage	44.1	7.3e-07
WP_136121542.1|219087_221670_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	8.3e-190
WP_132995333.1|221718_222222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132995331.1|222221_223262_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_136121541.1|223388_224039_+	cell division ATP-binding protein FtsE	NA	G3M9Y6	Bacillus_virus	31.1	1.7e-19
>prophage 16
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	228187	236414	2110729		uncultured_Caudovirales_phage(20.0%)	8	NA	NA
WP_081376604.1|228187_229189_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.0	2.3e-15
WP_075294438.1|229185_229953_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.2	1.5e-14
WP_136121539.1|230176_231214_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.6	6.7e-74
WP_136121538.1|231403_232078_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_136121548.1|232074_232617_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	6.5e-28
WP_136121536.1|234322_234619_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_136121535.1|234773_235463_+	pirin family protein	NA	NA	NA	NA	NA
WP_011609691.1|235571_236414_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.1	3.2e-42
>prophage 17
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	245553	311746	2110729	tail,tRNA,plate,transposase,head,terminase	Haemophilus_phage(39.53%)	75	NA	NA
WP_136121529.1|245553_249447_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	51.3	3.4e-110
WP_136121528.1|249628_250666_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_136121527.1|250706_251282_-	DedA family protein	NA	NA	NA	NA	NA
WP_136121526.1|251311_252052_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	49.0	2.2e-63
WP_136121525.1|252075_253083_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_136121524.1|253082_253571_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_132994829.1|253583_255389_-	potassium transporter	NA	NA	NA	NA	NA
WP_075294451.1|255394_256078_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011609646.1|256078_256360_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_011609645.1|256369_256846_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_136121523.1|257025_259329_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_136121522.1|259393_260710_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_136121521.1|260747_261329_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_011609641.1|261421_262120_-	competence protein	NA	NA	NA	NA	NA
WP_136121520.1|262266_263079_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012341347.1|263210_264251_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_012341348.1|264260_264893_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	33.9	9.9e-20
WP_041605003.1|264885_265875_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_041604352.1|265883_266666_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_011609635.1|266693_267221_+	DUF1523 family protein	NA	NA	NA	NA	NA
WP_136121519.1|267281_268571_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_011609633.1|268714_269137_-	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_136121518.1|269180_269786_-	porin family protein	NA	NA	NA	NA	NA
WP_011609631.1|270114_270684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041604350.1|271126_272326_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.7	1.4e-22
WP_147604036.1|272335_272566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136121547.1|272615_274127_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.5	3.8e-86
WP_136121517.1|274201_275300_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.1	2.2e-06
WP_132994804.1|275430_276123_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_132994803.1|276115_277837_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	1.2e-67
WP_132994802.1|278031_278721_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_148417889.1|278825_278981_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_147604032.1|279522_280014_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	55.2	2.2e-43
WP_147604030.1|280006_280633_-	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	58.7	4.3e-60
WP_012340329.1|280695_280947_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	50.6	1.2e-13
WP_012341722.1|280930_281278_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	50.9	1.3e-18
WP_148417890.1|281317_282460_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	49.2	2.5e-61
WP_075294226.1|282838_283402_-	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	41.9	4.8e-34
WP_075294225.1|283401_284463_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	72.4	1.1e-145
WP_075294224.1|284475_284826_-	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	78.4	9.9e-46
WP_075294223.1|284928_285588_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	69.4	1.3e-83
WP_075294228.1|285584_286691_-|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	72.3	1.1e-159
WP_075294222.1|286701_288057_-	hypothetical protein	NA	F6MIL2	Haemophilus_phage	61.9	1.4e-159
WP_075294221.1|288098_290231_-	hypothetical protein	NA	A0A0M3LPB6	Mannheimia_phage	37.0	9.8e-96
WP_087437316.1|290501_290789_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	52.8	3.5e-17
WP_075294219.1|290857_291232_-|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	85.5	3.3e-55
WP_075294218.1|291243_292665_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	74.8	1.5e-196
WP_075294217.1|292664_292838_-	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	72.7	3.7e-14
WP_075294216.1|292824_293091_-	hypothetical protein	NA	B7SDP6	Haemophilus_phage	67.1	6.0e-27
WP_075294215.1|293087_293726_-	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	70.8	5.0e-80
WP_075294214.1|293722_294145_-	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	64.5	6.5e-44
WP_075294213.1|294223_295204_-|head	head protein	head	B7SDP1	Haemophilus_phage	73.8	1.2e-133
WP_081376597.1|295203_295749_-	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	75.4	1.1e-62
WP_147604026.1|297261_298881_-	DUF935 family protein	NA	A0A0M3LRU4	Mannheimia_phage	83.9	2.9e-265
WP_135026522.1|298959_300573_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	85.1	2.5e-277
WP_075294210.1|300677_301187_-	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	72.2	8.7e-67
WP_147604024.1|301189_301444_-	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	45.0	5.9e-08
WP_147604022.1|301401_301695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075294207.1|301678_301888_-	lipoprotein	NA	F6MIK2	Haemophilus_phage	46.4	1.6e-06
WP_075294206.1|301811_302069_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_075294205.1|302065_302296_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	52.7	8.0e-12
WP_075294204.1|302302_302845_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	67.2	2.5e-72
WP_075294203.1|302934_303360_-	mor transcription activator family protein	NA	F6MIJ8	Haemophilus_phage	66.4	1.5e-48
WP_075294202.1|303484_303691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147604020.1|303701_304370_-	phage antirepressor Ant	NA	A0A0R6PJV6	Moraxella_phage	42.7	6.8e-19
WP_075294200.1|305098_305287_+	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	52.7	2.8e-07
WP_147604019.1|305380_305839_-	DUF1018 domain-containing protein	NA	A0A219VHC6	Ochrobactrum_phage	35.5	2.5e-12
WP_135026520.1|305976_306219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147604017.1|306203_306419_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_136121790.1|306572_307193_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	68.0	5.6e-76
WP_147604015.1|307213_307519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075294195.1|307515_307704_-	hypothetical protein	NA	F6MII8	Haemophilus_phage	80.0	1.3e-20
WP_075294194.1|307711_308593_-	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	85.0	3.7e-134
WP_075294193.1|310562_310826_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_075294192.1|310948_311746_+	transcriptional regulator	NA	A0A0M4UKA3	Ralstonia_phage	27.4	8.6e-13
>prophage 18
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	314924	319615	2110729		Vibrio_phage(66.67%)	3	NA	NA
WP_148417891.1|314924_316721_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.7	1.1e-10
WP_012341370.1|317005_319132_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.4	2.6e-258
WP_011609618.1|319147_319615_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	60.1	8.0e-51
>prophage 19
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	323819	327886	2110729		Indivirus(33.33%)	4	NA	NA
WP_136121513.1|323819_324620_+	LicD family protein	NA	A0A1V0SD50	Indivirus	31.6	7.6e-09
WP_012341379.1|324728_325355_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	32.1	1.2e-14
WP_011609609.1|325409_325682_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_136121512.1|325762_327886_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	38.9	3.3e-11
>prophage 20
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	346407	351021	2110729		Bacillus_phage(33.33%)	5	NA	NA
WP_136121622.1|346407_347640_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	32.7	1.6e-05
WP_041604337.1|347641_348499_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011609594.1|348553_349006_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_012341421.1|349189_350182_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	36.6	3.8e-50
WP_011609592.1|350298_351021_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	35.0	6.4e-15
>prophage 21
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	362292	363405	2110729		Pseudomonas_phage(100.0%)	1	NA	NA
WP_075294403.1|362292_363405_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.7	3.4e-47
>prophage 22
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	388356	397891	2110729		Bodo_saltans_virus(25.0%)	8	NA	NA
WP_136121638.1|388356_389331_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	28.5	1.3e-05
WP_136121639.1|389332_390073_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_011608525.1|390125_391076_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	47.5	8.0e-66
WP_075290504.1|391193_391967_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_136121640.1|392127_393135_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_011608528.1|393647_395318_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	5.6e-38
WP_136121641.1|395341_395884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136121642.1|396292_397891_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	4.1e-22
>prophage 23
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	405645	407649	2110729		Serratia_phage(100.0%)	1	NA	NA
WP_136121648.1|405645_407649_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	48.3	7.5e-138
>prophage 24
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	424418	431167	2110729		Streptococcus_phage(25.0%)	5	NA	NA
WP_136121618.1|424418_425999_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.4	3.1e-30
WP_136121617.1|426115_428551_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_075294334.1|428712_429345_+	repressor LexA	NA	A5LH73	Enterobacteria_phage	45.5	2.4e-13
WP_012341541.1|429431_429857_-	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	38.1	1.5e-11
WP_011608544.1|429868_431167_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.5	2.4e-28
>prophage 25
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	434506	437308	2110729		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_075321670.1|434506_436060_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.9	9.3e-11
WP_011608549.1|436654_437308_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4UU96	Bodo_saltans_virus	26.3	1.2e-07
>prophage 26
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	443356	445213	2110729		Hokovirus(100.0%)	1	NA	NA
WP_136121613.1|443356_445213_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.3	4.2e-42
>prophage 27
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	450939	454715	2110729	tRNA	Streptococcus_phage(33.33%)	4	NA	NA
WP_136121608.1|450939_452196_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.3	7.8e-93
WP_136121607.1|452205_452877_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_011608566.1|453037_453625_-	thymidine kinase	NA	A0A2H4YFP5	Citrobacter_phage	53.2	3.3e-54
WP_136121606.1|453686_454715_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	3.7e-109
>prophage 28
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	465224	466688	2110729		Klosneuvirus(100.0%)	1	NA	NA
WP_136121601.1|465224_466688_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.1	1.0e-96
>prophage 29
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	471209	475525	2110729		Clostridium_phage(40.0%)	6	NA	NA
WP_008752997.1|471209_471425_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	46.4	4.0e-13
WP_075294316.1|471417_472458_+	DNA cytosine methyltransferase	NA	Q6DMX0	Streptococcus_phage	49.5	5.5e-76
WP_075294315.1|472463_473549_+	HpaII family restriction endonuclease	NA	NA	NA	NA	NA
WP_075294314.1|473548_473992_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	38.9	1.8e-23
WP_075294313.1|474041_474950_+	DUF4868 domain-containing protein	NA	Q24LC1	Clostridium_phage	40.1	2.1e-55
WP_081376599.1|474964_475525_+	hypothetical protein	NA	A0A090DC14	Clostridium_phage	37.7	3.8e-23
>prophage 30
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	481896	482160	2110729		Streptococcus_phage(100.0%)	1	NA	NA
WP_136121588.1|481896_482160_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	58.1	8.8e-23
>prophage 31
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	488157	491676	2110729	transposase	uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_136121583.1|488157_490038_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.1	6.4e-115
WP_075319829.1|490214_490493_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.2	5.5e-23
WP_136121582.1|490539_491676_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	56.7	2.3e-120
>prophage 32
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	500702	501999	2110729		uncultured_virus(50.0%)	2	NA	NA
WP_011608620.1|500702_501242_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.7	6.5e-12
WP_132994691.1|501369_501999_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	54.9	1.2e-57
>prophage 33
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	506241	508206	2110729		uncultured_virus(50.0%)	2	NA	NA
WP_011608624.1|506241_506532_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	38.9	5.9e-12
WP_011608625.1|506562_508206_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	66.9	1.1e-182
>prophage 34
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	511229	511712	2110729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011608630.1|511229_511712_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.2	2.0e-25
>prophage 35
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	522468	529739	2110729	transposase	Tupanvirus(16.67%)	6	NA	NA
WP_011609430.1|522468_523440_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	19.7	2.1e-05
WP_075319814.1|523554_523971_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_147604001.1|524017_525154_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.8	1.7e-110
WP_011609429.1|525309_526896_-	FAD-binding protein	NA	M1I0Y3	Acanthocystis_turfacea_Chlorella_virus	23.7	9.8e-08
WP_041604300.1|526976_527783_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	6.3e-19
WP_075320114.1|527786_529739_-	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	6.2e-12
>prophage 36
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	541590	545217	2110729	tRNA	Enterococcus_phage(50.0%)	2	NA	NA
WP_075294165.1|541590_542331_+	site-specific DNA-methyltransferase	NA	A0A249XUJ2	Enterococcus_phage	34.3	4.5e-32
WP_147603997.1|542352_545217_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.1	7.9e-149
>prophage 37
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	548873	549641	2110729	tRNA	Pandoravirus(100.0%)	1	NA	NA
WP_132995077.1|548873_549641_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.2	1.3e-18
>prophage 38
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	557395	558904	2110729		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_075294172.1|557395_558904_-	sugar ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.1	2.8e-12
>prophage 39
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	567350	568358	2110729		Klosneuvirus(100.0%)	1	NA	NA
WP_136121658.1|567350_568358_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	43.9	3.2e-73
>prophage 40
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	575451	584984	2110729		Tupanvirus(20.0%)	8	NA	NA
WP_011609396.1|575451_577248_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	43.2	3.8e-24
WP_136121655.1|577258_578290_+	signal peptidase I	NA	NA	NA	NA	NA
WP_012341647.1|578495_579167_+	ribonuclease III	NA	A0A1C9C5A7	Heterosigma_akashiwo_virus	38.3	5.6e-21
WP_075294004.1|579219_580122_+	GTPase Era	NA	NA	NA	NA	NA
WP_075294005.1|580146_580734_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.2	7.0e-12
WP_005717672.1|580918_581134_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_012341651.1|581294_583052_+	DNA primase	NA	A0A1S5RH90	Helicobacter_phage	32.3	3.6e-43
WP_136121654.1|583118_584984_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.0	3.4e-36
>prophage 41
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	610502	620190	2110729	tRNA	Enterobacteria_phage(14.29%)	10	NA	NA
WP_136121965.1|610502_610979_+	flavin reductase	NA	Q9KX93	Enterobacteria_phage	47.3	1.4e-15
WP_136121966.1|611054_611999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136121967.1|612272_614039_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.7	3.6e-11
WP_041605047.1|614199_614925_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	S5VMD2	Pseudomonas_phage	31.4	6.4e-23
WP_136121968.1|614964_615813_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.3	1.4e-29
WP_148417902.1|616404_616617_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	49.2	8.4e-08
WP_012341730.1|616896_617274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135026570.1|617371_617629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136121510.1|617698_618637_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	39.4	4.8e-55
WP_136121509.1|618759_620190_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.8	1.3e-35
>prophage 42
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	627803	629318	2110729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_136121502.1|627803_629318_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.2e-18
>prophage 43
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	635403	636697	2110729		Bradyrhizobium_phage(50.0%)	2	NA	NA
WP_075293501.1|635403_636162_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.3	7.6e-35
WP_136121501.1|636232_636697_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.2	4.5e-46
>prophage 44
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	641907	650105	2110729		Streptococcus_phage(33.33%)	5	NA	NA
WP_041604107.1|641907_642987_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.5	1.3e-88
WP_011608769.1|643045_644155_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.1	1.7e-19
WP_132995461.1|644217_645516_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_136121498.1|645752_646967_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_136121497.1|646988_650105_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.6	8.5e-56
>prophage 45
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	656904	662917	2110729		Synechococcus_phage(40.0%)	6	NA	NA
WP_148417903.1|656904_657972_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	24.0	3.3e-07
WP_075290652.1|657968_658994_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.2	4.7e-11
WP_087437281.1|659070_659844_-	glycosyltransferase family 25 protein	NA	A0A1D8KNF8	Synechococcus_phage	28.3	1.3e-08
WP_136121490.1|659905_660703_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_148417904.1|660824_661730_+	glycosyltransferase family 25 protein	NA	A0A1D8KNF8	Synechococcus_phage	31.2	2.4e-11
WP_136121488.1|661867_662917_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.4e-34
>prophage 46
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	667365	671824	2110729		Catovirus(33.33%)	5	NA	NA
WP_011608800.1|667365_668007_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.2	2.1e-33
WP_136121484.1|668016_668601_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.7	1.9e-25
WP_136121483.1|668615_669809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011608803.1|670088_671090_+	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_011608804.1|671179_671824_+	adenylate kinase	NA	A0A2K9L833	Tupanvirus	36.2	7.0e-13
>prophage 47
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	675501	679237	2110729		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_136121479.1|675501_676812_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	38.8	1.6e-35
WP_012341791.1|677139_677490_-	RidA family protein	NA	NA	NA	NA	NA
WP_012341792.1|677600_678323_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_012341793.1|678337_679237_+	RimK family alpha-L-glutamate ligase	NA	A0A1D7SYT2	Cyanophage	30.1	9.4e-32
>prophage 48
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	683729	685709	2110729		Lactococcus_phage(100.0%)	1	NA	NA
WP_132994965.1|683729_685709_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	26.0	3.5e-31
>prophage 49
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	693632	697621	2110729		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
WP_132994969.1|693632_694187_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	8.3e-31
WP_132994971.1|694256_695309_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_011609253.1|695531_695789_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_132994973.1|695893_697621_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.1	7.4e-17
>prophage 50
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	703166	704591	2110729		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_133098709.1|703166_704591_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.8e-43
>prophage 51
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	727146	737424	2110729		Organic_Lake_phycodnavirus(40.0%)	9	NA	NA
WP_136121411.1|727146_728877_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y1V5	Organic_Lake_phycodnavirus	29.9	1.6e-19
WP_075321337.1|728876_730640_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y1V6	Organic_Lake_phycodnavirus	27.8	2.0e-14
WP_136121410.1|730705_731659_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.9	5.1e-60
WP_136121409.1|731787_732528_-	pyruvate formate lyase 1-activating protein	NA	M4MAG2	Vibrio_phage	47.9	3.3e-06
WP_075321340.1|732592_733297_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_075293709.1|733281_734202_-	DUF692 family protein	NA	NA	NA	NA	NA
WP_148417909.1|734247_734484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293711.1|734506_734965_-	DoxX family protein	NA	NA	NA	NA	NA
WP_011609291.1|735099_737424_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	6.4e-157
>prophage 52
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	742106	745581	2110729		EBPR_podovirus(50.0%)	2	NA	NA
WP_011609284.1|742106_742571_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	53.2	2.0e-38
WP_136121406.1|742749_745581_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	1.8e-310
>prophage 53
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	756302	762566	2110729	tRNA	Vibrio_phage(40.0%)	5	NA	NA
WP_136121400.1|756302_758927_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	1.4e-80
WP_012340249.1|759113_759296_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	62.7	6.3e-12
WP_012340250.1|759329_760694_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.4	3.3e-28
WP_012340251.1|760767_761655_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-60
WP_132994600.1|761702_762566_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	1.7e-62
>prophage 54
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	781122	781770	2110729		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_012340270.1|781122_781770_-	hexitol phosphatase HxpB	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	29.1	2.3e-11
>prophage 55
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	816582	820664	2110729		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
WP_132994626.1|816582_818388_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.4	1.3e-51
WP_005627617.1|818449_818668_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_136121388.1|818878_819550_+	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_136121387.1|819656_820664_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.7	3.3e-86
>prophage 56
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	833030	838106	2110729		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_136121384.1|833030_835886_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	29.1	3.9e-63
WP_132994635.1|836093_838106_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.7	4.0e-115
>prophage 57
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	844506	858637	2110729	tRNA,protease,holin	Ostreococcus_tauri_virus(20.0%)	10	NA	NA
WP_132994648.1|844506_846336_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	41.8	4.0e-114
WP_075293774.1|846668_847466_+|holin	lipopolysaccharide cholinephosphotransferase	holin	A0A1V0SD50	Indivirus	46.6	3.8e-08
WP_133098735.1|847813_850003_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_132994638.1|850260_851088_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	26.1	3.3e-15
WP_011608883.1|851178_852513_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_136121383.1|852526_852994_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_132994641.1|852998_853958_+	AEC family transporter	NA	NA	NA	NA	NA
WP_136121382.1|854085_856008_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.5	2.0e-95
WP_011608887.1|856012_856729_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011608888.1|856954_858637_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	1.0e-31
>prophage 58
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	863449	864295	2110729		Streptococcus_phage(100.0%)	1	NA	NA
WP_136121378.1|863449_864295_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	41.9	3.9e-48
>prophage 59
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	876268	878200	2110729	tRNA,protease	Pseudomonas_phage(50.0%)	2	NA	NA
WP_132995197.1|876268_876724_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.9	1.7e-26
WP_012340395.1|876796_878200_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.4	2.6e-81
>prophage 60
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	884708	886226	2110729		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_011608916.1|884708_886226_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	2.8e-12
>prophage 61
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	890634	892125	2110729		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_136121368.1|890634_892125_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	1.6e-12
>prophage 62
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	902558	903608	2110729		Bacillus_virus(100.0%)	1	NA	NA
WP_011608934.1|902558_903608_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	7.9e-30
>prophage 63
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	912836	913853	2110729		Tupanvirus(100.0%)	1	NA	NA
WP_136121360.1|912836_913853_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	50.2	9.1e-92
>prophage 64
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	936563	940854	2110729		Tupanvirus(50.0%)	3	NA	NA
WP_148417916.1|936563_938507_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.6	1.2e-52
WP_148417917.1|938598_939768_-	hemagglutinin	NA	NA	NA	NA	NA
WP_011608747.1|940059_940854_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.6e-11
>prophage 65
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	948151	955608	2110729		Bacillus_virus(50.0%)	5	NA	NA
WP_136121233.1|948151_948415_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	68.8	1.6e-24
WP_136121234.1|948534_950781_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	38.2	6.3e-85
WP_136121235.1|950878_952774_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	1.8e-93
WP_012341756.1|952826_954113_-	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_041604104.1|954294_955608_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	78.3	1.3e-175
>prophage 66
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	966183	968652	2110729		Escherichia_phage(100.0%)	1	NA	NA
WP_136121241.1|966183_968652_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.4	6.3e-78
>prophage 67
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	974559	979383	2110729		Orpheovirus(33.33%)	5	NA	NA
WP_011608965.1|974559_975168_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.8	3.7e-24
WP_136121245.1|975220_976561_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.1	1.4e-79
WP_011608967.1|976626_977241_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_132994519.1|977452_977866_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_132994518.1|977994_979383_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.8	2.1e-22
>prophage 68
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	983200	985696	2110729		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_136121246.1|983200_985696_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.4	1.3e-27
>prophage 69
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	992492	992834	2110729		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_011608980.1|992492_992834_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	48.6	2.5e-25
>prophage 70
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	996491	996965	2110729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011608983.1|996491_996965_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	3.0e-29
>prophage 71
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1007483	1010573	2110729		Acinetobacter_phage(100.0%)	3	NA	NA
WP_132994505.1|1007483_1008902_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	3.4e-36
WP_132994504.1|1008914_1009919_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	33.0	2.2e-45
WP_132994503.1|1009967_1010573_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	38.5	9.7e-33
>prophage 72
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1015713	1035156	2110729	tRNA,protease	Tupanvirus(12.5%)	19	NA	NA
WP_132994498.1|1015713_1017642_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	3.3e-127
WP_136121255.1|1017697_1018546_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_136121256.1|1018882_1020193_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.9	1.1e-70
WP_136121257.1|1020274_1020811_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_136121258.1|1020811_1021741_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.2	2.0e-24
WP_136121259.1|1021740_1022505_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_148417918.1|1022614_1023997_-	DUF3412 domain-containing protein	NA	NA	NA	NA	NA
WP_011609004.1|1024009_1024849_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	36.7	2.9e-35
WP_136121262.1|1025736_1026051_+	YqcC family protein	NA	NA	NA	NA	NA
WP_136121263.1|1026035_1026758_+|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_136121264.1|1026784_1026952_+	YoaH family protein	NA	NA	NA	NA	NA
WP_011609009.1|1027101_1027311_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	46.3	2.3e-10
WP_011609010.1|1027382_1027829_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_012340489.1|1027980_1029792_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_136121265.1|1029886_1030876_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.4	3.8e-34
WP_136121266.1|1030890_1031370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136121267.1|1031384_1033772_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011609015.1|1033774_1034068_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	41.1	1.0e-11
WP_075321107.1|1034211_1035156_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	82.3	4.2e-123
>prophage 73
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1043879	1046774	2110729		Staphylococcus_phage(50.0%)	2	NA	NA
WP_147603952.1|1043879_1045430_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.6	3.0e-102
WP_075293867.1|1045691_1046774_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	27.0	3.6e-22
>prophage 74
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1053795	1054215	2110729		Sphingomonas_phage(100.0%)	1	NA	NA
WP_094946299.1|1053795_1054215_+	hypothetical protein	NA	H9NBX2	Sphingomonas_phage	54.2	2.3e-33
>prophage 75
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1057231	1057774	2110729		Agrobacterium_phage(100.0%)	1	NA	NA
WP_075293873.1|1057231_1057774_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	2.4e-14
>prophage 76
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1064287	1069465	2110729		Acinetobacter_phage(50.0%)	2	NA	NA
WP_136121275.1|1064287_1066897_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.5	7.4e-21
WP_136121276.1|1067005_1069465_-	glycogen/starch/alpha-glucan phosphorylase	NA	A0A140XAG6	Dickeya_phage	51.9	1.6e-17
>prophage 77
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1079673	1090937	2110729	tRNA	Escherichia_phage(50.0%)	5	NA	NA
WP_136121281.1|1079673_1082457_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	24.9	3.2e-06
WP_148417919.1|1082456_1084850_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_136121283.1|1085044_1086712_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	75.2	5.1e-249
WP_136121284.1|1086907_1087861_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	26.9	6.2e-26
WP_136121285.1|1087847_1090937_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	24.2	7.2e-07
>prophage 78
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1101911	1118167	2110729		Acidithiobacillus_phage(12.5%)	15	NA	NA
WP_136121291.1|1101911_1103777_-	signal peptide peptidase SppA	NA	K4HZZ6	Acidithiobacillus_phage	27.5	7.7e-12
WP_132994462.1|1103904_1104459_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_011609063.1|1104524_1105181_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	50.0	6.0e-52
WP_136121292.1|1105327_1106542_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011609065.1|1106549_1107278_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_075293898.1|1107350_1107983_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.6	4.6e-25
WP_136121293.1|1108181_1110788_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	34.9	1.2e-92
WP_041604193.1|1111068_1111656_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_011609069.1|1111645_1113160_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.2	4.8e-89
WP_132994456.1|1113172_1113673_-	colicin V synthesis protein	NA	NA	NA	NA	NA
WP_136121294.1|1114367_1115303_+	KpsF/GutQ family sugar isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	7.0e-38
WP_136121295.1|1115307_1115859_+	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	39.3	6.0e-21
WP_011609074.1|1116191_1116677_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_012340546.1|1116693_1117191_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_132994454.1|1117411_1118167_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.6	1.1e-30
>prophage 79
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1122480	1124505	2110729		Brevibacillus_phage(100.0%)	1	NA	NA
WP_136121300.1|1122480_1124505_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	25.1	3.9e-09
>prophage 80
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1136661	1152256	2110729	tRNA	Escherichia_phage(14.29%)	16	NA	NA
WP_075293911.1|1136661_1138080_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	66.3	5.2e-162
WP_011609095.1|1138232_1139312_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	44.8	1.6e-78
WP_012340563.1|1139418_1140669_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_132994442.1|1140665_1141349_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.5	1.8e-38
WP_136121304.1|1141369_1142560_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_132994440.1|1142729_1143671_-	2-hydroxyacid dehydrogenase	NA	M1GWB3	Acanthocystis_turfacea_Chlorella_virus	30.3	5.8e-24
WP_012340566.1|1143782_1144637_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.1	2.3e-48
WP_136121305.1|1144650_1145445_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_136121306.1|1145428_1146334_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_136121307.1|1146348_1146840_-	RDD family protein	NA	NA	NA	NA	NA
WP_012340570.1|1146891_1147974_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	50.0	3.7e-06
WP_136121356.1|1148011_1148845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609106.1|1149037_1149499_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_075293917.1|1149522_1149846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609108.1|1149851_1150439_-	VOC family protein	NA	NA	NA	NA	NA
WP_136121308.1|1150522_1152256_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.8	1.8e-84
>prophage 81
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1160298	1167455	2110729	lysis	Pseudomonas_phage(40.0%)	8	NA	NA
WP_011609115.1|1160298_1161429_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.1	2.3e-168
WP_136121357.1|1161494_1161752_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	58.7	4.3e-14
WP_011609117.1|1161805_1162993_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	46.4	2.1e-79
WP_136121311.1|1163179_1164532_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_075293923.1|1164534_1165224_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_075293924.1|1165220_1165637_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_041604213.1|1165762_1166266_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	42.8	8.1e-25
WP_136121312.1|1166255_1167455_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	31.2	3.6e-55
>prophage 82
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1173422	1173707	2110729		Bacillus_phage(100.0%)	1	NA	NA
WP_011609129.1|1173422_1173707_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	43.3	1.2e-12
>prophage 83
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1182666	1183392	2110729		Flavobacterium_phage(100.0%)	1	NA	NA
WP_011609137.1|1182666_1183392_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	46.7	1.4e-25
>prophage 84
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1190776	1194691	2110729		Indivirus(100.0%)	1	NA	NA
WP_136121358.1|1190776_1194691_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	29.7	7.9e-51
>prophage 85
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1198724	1199672	2110729		Tupanvirus(100.0%)	1	NA	NA
WP_011609150.1|1198724_1199672_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.1	2.8e-42
>prophage 86
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1204242	1205691	2110729		Erwinia_phage(100.0%)	1	NA	NA
WP_136121329.1|1204242_1205691_+	membrane-bound lytic murein transglycosylase MltF	NA	G0YQ82	Erwinia_phage	35.8	2.2e-06
>prophage 87
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1214037	1214682	2110729		Planktothrix_phage(100.0%)	1	NA	NA
WP_011609165.1|1214037_1214682_-	thiamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	4.5e-28
>prophage 88
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1240679	1242428	2110729		Bacillus_phage(100.0%)	1	NA	NA
WP_041605303.1|1240679_1242428_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.9	6.9e-55
>prophage 89
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1245808	1247790	2110729		unidentified_phage(50.0%)	2	NA	NA
WP_136121342.1|1245808_1247317_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	32.8	2.2e-25
WP_012340643.1|1247313_1247790_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	35.1	3.9e-13
>prophage 90
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1252580	1258623	2110729		Enterobacteria_phage(33.33%)	6	NA	NA
WP_136121344.1|1252580_1253582_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.5	6.8e-31
WP_136121345.1|1253632_1254604_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_011609189.1|1254665_1254992_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_136121346.1|1255093_1256122_-	porin OmpA	NA	NA	NA	NA	NA
WP_136121347.1|1256264_1257641_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	53.3	1.4e-18
WP_075294352.1|1257828_1258623_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.6	8.3e-16
>prophage 91
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1262885	1263536	2110729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_136121348.1|1262885_1263536_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.2	5.3e-45
>prophage 92
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1270099	1272296	2110729		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_136121350.1|1270099_1271146_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	32.9	1.5e-17
WP_132994853.1|1271165_1272296_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	8.1e-49
>prophage 93
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1299033	1305292	2110729	tRNA	Moraxella_phage(33.33%)	5	NA	NA
WP_136121880.1|1299033_1301061_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.3	5.0e-81
WP_136121881.1|1301125_1302553_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_011609228.1|1302629_1303193_+	YcbK family protein	NA	NA	NA	NA	NA
WP_136121882.1|1303268_1303901_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	1.6e-25
WP_136121883.1|1304002_1305292_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.6	1.4e-97
>prophage 94
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1311360	1314426	2110729		Bacillus_phage(50.0%)	2	NA	NA
WP_075294063.1|1311360_1312563_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N6W8I1	Bacillus_phage	45.0	9.4e-11
WP_136121886.1|1312578_1314426_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.2	1.7e-67
>prophage 95
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1330975	1332938	2110729		Bacillus_virus(50.0%)	2	NA	NA
WP_011609312.1|1330975_1332094_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	37.1	1.2e-31
WP_011609313.1|1332077_1332938_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	27.6	1.2e-15
>prophage 96
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1339302	1341948	2110729		Bacillus_virus(100.0%)	1	NA	NA
WP_136121782.1|1339302_1341948_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.5	2.4e-104
>prophage 97
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1347883	1354226	2110729	tRNA	Bacillus_virus(25.0%)	7	NA	NA
WP_011609328.1|1347883_1348678_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.2	7.8e-22
WP_012340726.1|1348898_1349474_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011609330.1|1349454_1349973_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_012340728.1|1349987_1350713_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.3e-23
WP_136121780.1|1350715_1351276_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_011609333.1|1351278_1352139_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	26.4	1.4e-05
WP_132995151.1|1352174_1354226_-|tRNA	methionine--tRNA ligase	tRNA	H2EDI7	Moumouvirus	30.2	4.6e-50
>prophage 98
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1368462	1369764	2110729		Streptococcus_phage(100.0%)	1	NA	NA
WP_011608718.1|1368462_1369764_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	59.5	5.2e-132
>prophage 99
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1373847	1384193	2110729	integrase	Staphylococcus_phage(50.0%)	8	1374904:1374928	1380330:1380354
WP_147590482.1|1373847_1374762_+	abortive phage resistance protein	NA	A0A059NT88	Lactococcus_phage	27.1	1.5e-16
1374904:1374928	attL	ACGCTTGGGAACAGAGGAAGTTGGG	NA	NA	NA	NA
WP_148417965.1|1375333_1375564_+	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	47.3	5.5e-05
WP_148417934.1|1375479_1376085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136121989.1|1376097_1376658_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_136121990.1|1376711_1378325_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.1	4.8e-127
WP_148417935.1|1378426_1378909_+	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	30.5	5.1e-08
WP_012340749.1|1378921_1379848_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	48.7	6.2e-79
WP_136121992.1|1382564_1384193_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	4.3e-152
1380330:1380354	attR	CCCAACTTCCTCTGTTCCCAAGCGT	NA	NA	NA	NA
>prophage 100
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1391201	1400275	2110729		Ostreococcus_lucimarinus_virus(33.33%)	5	NA	NA
WP_136121913.1|1391201_1392836_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	A0A0P0CRP3	Ostreococcus_lucimarinus_virus	29.2	1.4e-38
WP_075321290.1|1392835_1393471_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_012340784.1|1393479_1394265_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_011608698.1|1394447_1395158_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	57.1	2.0e-61
WP_136121911.1|1396069_1400275_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	37.4	4.0e-48
>prophage 101
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1415920	1420120	2110729		Marinitoga_camini_virus(25.0%)	5	NA	NA
WP_011608694.1|1415920_1416508_-	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.7	5.0e-10
WP_147603912.1|1416510_1416813_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	33.8	9.2e-08
WP_011608692.1|1416953_1417349_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.5	5.6e-05
WP_148417938.1|1417396_1417669_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_136121836.1|1418209_1420120_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	31.1	3.1e-48
>prophage 102
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1424333	1430907	2110729	integrase	Escherichia_phage(66.67%)	5	1418862:1418876	1426736:1426750
1418862:1418876	attL	CCGGAAATTGCTTTT	NA	NA	NA	NA
WP_136121833.1|1424333_1425581_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	32.1	2.1e-53
WP_132995244.1|1426083_1427154_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
1426736:1426750	attR	CCGGAAATTGCTTTT	NA	NA	NA	NA
WP_132995246.1|1427166_1428270_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_136121832.1|1428388_1429876_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.3	1.6e-52
WP_136121831.1|1430148_1430907_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	3.3e-22
>prophage 103
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1438264	1438834	2110729		Bacillus_virus(100.0%)	1	NA	NA
WP_136121829.1|1438264_1438834_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	28.4	2.4e-09
>prophage 104
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1443822	1444479	2110729		Acaryochloris_phage(100.0%)	1	NA	NA
WP_136121823.1|1443822_1444479_+	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	24.2	1.1e-05
>prophage 105
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1447553	1449734	2110729		Bacillus_phage(100.0%)	1	NA	NA
WP_136121820.1|1447553_1449734_-	DNA helicase II	NA	A7KV33	Bacillus_phage	36.3	9.7e-115
>prophage 106
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1457204	1459616	2110729		Moraxella_phage(100.0%)	1	NA	NA
WP_011608646.1|1457204_1459616_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.3	1.8e-223
>prophage 107
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1465682	1469316	2110729	transposase	Elephant_endotheliotropic_herpesvirus(33.33%)	6	NA	NA
WP_011608638.1|1465682_1466354_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	52.6	5.2e-51
WP_075319838.1|1466650_1467787_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	56.4	2.3e-120
WP_075293968.1|1468023_1468257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293967.1|1468262_1468592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148417940.1|1468696_1468831_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011608637.1|1468932_1469316_+	autonomous glycyl radical cofactor GrcA	NA	A0A2K9VG12	Escherichia_phage	68.0	4.9e-30
>prophage 108
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1481439	1484148	2110729		Mycobacterium_phage(100.0%)	1	NA	NA
WP_136121802.1|1481439_1484148_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	46.8	3.8e-84
>prophage 109
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1488005	1506770	2110729	tRNA,transposase	Ostreococcus_lucimarinus_virus(12.5%)	16	NA	NA
WP_011609346.1|1488005_1489268_+	inorganic phosphate transporter	NA	A0A0P0CDM4	Ostreococcus_lucimarinus_virus	34.3	5.7e-59
WP_012341227.1|1489372_1489984_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_136121804.1|1489988_1491242_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.5	3.9e-76
WP_011609349.1|1491420_1493328_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.7	1.3e-147
WP_136121805.1|1493425_1494547_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	57.1	6.2e-17
WP_075294140.1|1495046_1495262_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075294154.1|1495370_1495628_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012341222.1|1496118_1498389_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	66.8	1.1e-299
WP_075321386.1|1498471_1499011_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_132995224.1|1499041_1500160_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_132995220.1|1500412_1502416_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.9	6.1e-47
WP_012341218.1|1502446_1502986_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.0	6.0e-26
WP_132995218.1|1503056_1504010_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_011609358.1|1504033_1504807_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_132995217.1|1504815_1505655_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_136121807.1|1505687_1506770_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	44.6	2.6e-84
>prophage 110
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1520347	1521682	2110729		Indivirus(100.0%)	1	NA	NA
WP_136121814.1|1520347_1521682_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.8	6.2e-40
>prophage 111
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1546730	1550604	2110729		Brevibacillus_phage(50.0%)	4	NA	NA
WP_011609437.1|1546730_1547624_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.8	4.6e-31
WP_136121550.1|1547620_1548820_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_132994756.1|1548820_1549636_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_136121551.1|1549698_1550604_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	45.7	7.2e-64
>prophage 112
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1558065	1567378	2110729	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_148417948.1|1558065_1559388_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	30.3	3.4e-46
WP_011609450.1|1559481_1560192_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_041604983.1|1560208_1560787_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_012341182.1|1560885_1561254_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_075293447.1|1561302_1562190_-	tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	28.3	2.1e-15
WP_136121557.1|1562486_1563371_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_136121558.1|1563397_1564030_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_136121559.1|1564267_1566187_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.5	3.7e-70
WP_132994771.1|1566310_1567378_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.8	2.9e-112
>prophage 113
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1574532	1581920	2110729	tRNA	uncultured_Mediterranean_phage(75.0%)	6	NA	NA
WP_136121561.1|1574532_1576431_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.3	8.0e-41
WP_011609465.1|1576568_1576913_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_012341171.1|1577486_1578455_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.0	1.2e-45
WP_136121562.1|1578467_1580318_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_136121563.1|1580349_1580634_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	41.0	5.1e-08
WP_132994792.1|1580789_1581920_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.0	9.8e-87
>prophage 114
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1587660	1589988	2110729	tRNA	Phage_TP(50.0%)	2	NA	NA
WP_132994780.1|1587660_1589037_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	77.4	2.9e-165
WP_136121565.1|1589178_1589988_-	DNA ligase	NA	A0A1X9VNU1	Mimivirus	34.1	2.4e-34
>prophage 115
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1593918	1598557	2110729		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_136121567.1|1593918_1595217_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	34.5	4.5e-67
WP_012341153.1|1595716_1596745_+	sugar kinase	NA	NA	NA	NA	NA
WP_136121568.1|1596766_1598557_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	44.0	1.6e-136
>prophage 116
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1605559	1609658	2110729		Streptomyces_phage(33.33%)	4	NA	NA
WP_011609498.1|1605559_1605883_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	4.3e-19
WP_075321854.1|1606047_1607157_-	methionine biosynthesis PLP-dependent protein	NA	A0A1V0SL56	Klosneuvirus	25.0	2.1e-17
WP_148417950.1|1607878_1608400_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_135026467.1|1608353_1609658_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	44.8	3.1e-84
>prophage 117
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1616709	1620510	2110729	integrase	Mannheimia_phage(33.33%)	6	1614024:1614040	1620552:1620568
1614024:1614040	attL	TTTTAGGGATCATTTGG	NA	NA	NA	NA
WP_075293424.1|1616709_1616892_+	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	67.8	2.2e-12
WP_075293423.1|1617195_1617417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135026463.1|1617385_1617667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041604971.1|1617782_1617986_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081376610.1|1618511_1619351_-	ATP-binding protein	NA	H7BWC4	unidentified_phage	38.5	1.6e-38
WP_081376609.1|1619322_1620510_-|integrase	site-specific integrase	integrase	A0A1B5FPC6	Escherichia_phage	32.1	6.8e-46
1620552:1620568	attR	CCAAATGATCCCTAAAA	NA	NA	NA	NA
>prophage 118
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1631526	1632531	2110729		Wolbachia_phage(100.0%)	1	NA	NA
WP_075293414.1|1631526_1632531_-	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	27.6	1.2e-19
>prophage 119
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1639938	1641969	2110729		Streptococcus_phage(100.0%)	1	NA	NA
WP_075293408.1|1639938_1641969_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.2	1.2e-47
>prophage 120
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1647862	1648999	2110729	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_075319813.1|1647862_1648999_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
>prophage 121
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1659736	1666495	2110729		Moraxella_phage(100.0%)	1	NA	NA
WP_147604060.1|1659736_1666495_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.3	4.1e-39
>prophage 122
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1675831	1676467	2110729		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_132994656.1|1675831_1676467_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	38.5	1.6e-22
>prophage 123
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1680055	1683239	2110729		Dickeya_phage(50.0%)	3	NA	NA
WP_011609516.1|1680055_1681390_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	80.2	3.1e-55
WP_011609517.1|1681481_1682312_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_075321841.1|1682378_1683239_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.0	3.9e-51
>prophage 124
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1687423	1688315	2110729		Mannheimia_phage(50.0%)	2	NA	NA
WP_147603855.1|1687423_1687708_-	DNA helicase UvrD	NA	A0A0M3LNN9	Mannheimia_phage	65.9	2.7e-25
WP_147603854.1|1687700_1688315_-	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	67.2	5.6e-44
>prophage 125
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1694082	1747783	2110729	capsid,protease,integrase,transposase,terminase	Mannheimia_phage(42.86%)	54	1714113:1714130	1743618:1743635
WP_136121729.1|1694082_1695078_-|capsid	N4-gp56 family major capsid protein	capsid	NA	NA	NA	NA
WP_011609533.1|1696043_1696226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609534.1|1696323_1696626_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_148417953.1|1697132_1700510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148417954.1|1700539_1705141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075321483.1|1705206_1707384_-	hypothetical protein	NA	S4S2T1	Puniceispirillum_phage	26.3	4.0e-44
WP_011609539.1|1707385_1708933_-	hypothetical protein	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	42.0	6.4e-97
WP_136121726.1|1708932_1709628_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_041604566.1|1709651_1709795_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	69.8	9.9e-13
WP_075321496.1|1709823_1710150_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_011609542.1|1710122_1710659_-	lysozyme	NA	Q19UR6	Mannheimia_phage	50.3	5.2e-46
WP_012341704.1|1710651_1710888_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	70.5	2.7e-23
WP_075319827.1|1711173_1712310_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	56.4	2.6e-119
WP_075319826.1|1712356_1712773_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	7.4e-48
WP_147603848.1|1713041_1713881_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.6	7.8e-73
WP_075293600.1|1714031_1714436_-	hypothetical protein	NA	NA	NA	NA	NA
1714113:1714130	attL	TGTTTCGCTTATATCCAA	NA	NA	NA	NA
WP_147603846.1|1714425_1715013_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	56.2	4.5e-51
WP_075293602.1|1715091_1715370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293603.1|1715382_1716009_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	28.1	3.1e-18
WP_147603844.1|1716043_1716574_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	65.0	4.5e-66
WP_147603843.1|1716583_1717276_-	replication protein P	NA	A0A077KCC8	Edwardsiella_phage	35.4	5.5e-24
WP_087449175.1|1718060_1718309_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	72.2	3.5e-21
WP_011609558.1|1718351_1718804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609559.1|1718848_1719055_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	50.0	4.9e-13
WP_011609560.1|1719193_1719829_+	LexA family transcriptional repressor	NA	G9L676	Escherichia_phage	45.6	7.8e-41
WP_075293607.1|1720137_1721082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293608.1|1721093_1721651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293609.1|1722058_1722250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293610.1|1722481_1722661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293611.1|1722657_1723074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148417955.1|1723203_1723692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293614.1|1724878_1725097_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	79.2	8.1e-22
WP_148417956.1|1725747_1726407_+	hypothetical protein	NA	B6SCX2	Bacteriophage	53.2	1.0e-27
WP_148417957.1|1726493_1726778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148417958.1|1726774_1727197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148417966.1|1728176_1728953_+	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	46.6	3.2e-20
WP_075293616.1|1728971_1729256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132994676.1|1729252_1729690_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	45.6	3.6e-05
WP_011609572.1|1729686_1729986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136121719.1|1729997_1730933_+	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	75.6	7.3e-128
WP_136121718.1|1730925_1731594_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	74.9	7.6e-95
WP_147603839.1|1731643_1732684_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	69.8	2.5e-12
WP_147603837.1|1732689_1733418_+	polymer-forming cytoskeletal protein	NA	A0A0M3LPL3	Mannheimia_phage	62.2	5.1e-20
WP_136121713.1|1734667_1735462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609578.1|1735474_1735660_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.6	1.7e-09
WP_136121712.1|1735621_1736902_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.2	4.5e-88
WP_075293625.1|1737319_1739059_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.9	5.1e-34
WP_132994679.1|1739101_1740478_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_136121711.1|1740623_1741421_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_012341088.1|1741490_1742750_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_136121732.1|1742783_1744175_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
1743618:1743635	attR	TGTTTCGCTTATATCCAA	NA	NA	NA	NA
WP_136121710.1|1744557_1745856_+	trigger factor	NA	NA	NA	NA	NA
WP_075293629.1|1745941_1746523_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	9.0e-60
WP_136121709.1|1746538_1747783_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	1.8e-126
>prophage 126
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1757362	1759051	2110729		Aeromonas_phage(100.0%)	1	NA	NA
WP_136121852.1|1757362_1759051_+	solute:sodium symporter family transporter	NA	A0A219Y9P9	Aeromonas_phage	29.3	1.3e-37
>prophage 127
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1763064	1769899	2110729		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_136121855.1|1763064_1764426_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	34.7	4.7e-35
WP_132995315.1|1764427_1765042_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_136121856.1|1765143_1766673_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_075320943.1|1767074_1767737_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.6	1.2e-28
WP_011608483.1|1767814_1768144_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	52.8	5.3e-25
WP_012341045.1|1768249_1769131_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_136121857.1|1769140_1769899_+	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	26.3	6.7e-15
>prophage 128
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1775864	1777701	2110729		Synechococcus_phage(50.0%)	2	NA	NA
WP_136121861.1|1775864_1776425_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	57.1	8.2e-18
WP_136121862.1|1776519_1777701_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.8	5.8e-90
>prophage 129
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1807294	1811876	2110729		Chrysochromulina_ericina_virus(25.0%)	5	NA	NA
WP_136121743.1|1807294_1809145_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.2	1.0e-104
WP_011608438.1|1809186_1809705_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_012340699.1|1809713_1810037_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.3	9.5e-27
WP_011608436.1|1810202_1810586_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	82.3	5.7e-55
WP_012340679.1|1810661_1811876_-	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.2	1.4e-35
>prophage 130
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1817460	1818243	2110729		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_012340619.1|1817460_1818243_-	glycosyl transferase	NA	Q58M87	Prochlorococcus_phage	38.8	2.4e-31
>prophage 131
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1823707	1824715	2110729		Bacillus_phage(100.0%)	1	NA	NA
WP_011608424.1|1823707_1824715_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.2	4.0e-07
>prophage 132
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1842333	1843071	2110729		Planktothrix_phage(100.0%)	1	NA	NA
WP_012340409.1|1842333_1843071_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.1	9.7e-27
>prophage 133
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1847682	1850949	2110729	tRNA	Indivirus(50.0%)	3	NA	NA
WP_136121892.1|1847682_1848654_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	1.6e-08
WP_012340343.1|1848774_1849518_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_136121893.1|1849569_1850949_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	34.0	4.2e-47
>prophage 134
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1860909	1862427	2110729		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_136121899.1|1860909_1862427_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.0	8.2e-12
>prophage 135
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1871785	1878740	2110729		Vibrio_phage(33.33%)	7	NA	NA
WP_012341763.1|1871785_1872799_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	45.4	4.2e-73
WP_041603981.1|1872866_1873280_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_012341745.1|1873308_1874319_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_132995469.1|1874339_1875293_-	ribokinase	NA	NA	NA	NA	NA
WP_132995471.1|1875376_1876255_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	26.0	3.9e-06
WP_012341719.1|1876283_1877243_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_136121909.1|1877252_1878740_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	2.2e-17
>prophage 136
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1885700	1886450	2110729		Planktothrix_phage(100.0%)	1	NA	NA
WP_136121908.1|1885700_1886450_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	1.1e-33
>prophage 137
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1899363	1899624	2110729		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_011608361.1|1899363_1899624_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.2	2.6e-19
>prophage 138
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1904812	1905766	2110729		Cyanophage(100.0%)	1	NA	NA
WP_075294018.1|1904812_1905766_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	6.3e-10
>prophage 139
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1910054	1929422	2110729	tRNA	Enterobacteria_phage(11.11%)	14	NA	NA
WP_136121868.1|1910054_1912625_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	33.6	2.1e-124
WP_136121864.1|1912789_1916266_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.6	1.8e-195
WP_075294022.1|1916446_1917655_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_081376595.1|1917708_1918662_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	35.0	4.2e-30
WP_011608348.1|1919366_1920551_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.1	6.4e-12
WP_011608347.1|1920726_1921134_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_012341435.1|1921135_1921690_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.3e-09
WP_011608345.1|1921850_1922963_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.9	3.3e-63
WP_136121963.1|1923120_1923909_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_012341410.1|1923911_1924376_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_011608342.1|1924428_1924914_+	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	43.2	1.4e-34
WP_136121962.1|1924999_1925944_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	29.0	4.9e-07
WP_132995567.1|1926041_1926590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136121961.1|1926608_1929422_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	27.0	7.9e-85
>prophage 140
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1942665	1943925	2110729		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_136121465.1|1942665_1943925_-	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.1	1.7e-39
>prophage 141
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1948086	1948317	2110729		Ralstonia_phage(100.0%)	1	NA	NA
WP_011608321.1|1948086_1948317_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	50.0	4.0e-11
>prophage 142
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1961076	1974720	2110729		Lactococcus_phage(16.67%)	16	NA	NA
WP_136121458.1|1961076_1963491_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	5.4e-66
WP_011608302.1|1963494_1963998_-	chorismate lyase	NA	NA	NA	NA	NA
WP_012340638.1|1964114_1964777_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011608300.1|1964842_1965061_-	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_136121457.1|1965064_1966741_-	acetolactate synthase 2 catalytic subunit	NA	G8DDL3	Micromonas_pusilla_virus	29.6	7.8e-64
WP_011608298.1|1966832_1967645_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	30.2	1.4e-21
WP_005542835.1|1967749_1967920_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011608297.1|1967931_1968168_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_011608296.1|1968388_1969057_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_075319926.1|1969229_1970456_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.1	5.0e-36
WP_011608294.1|1970452_1970908_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	59.9	4.4e-46
WP_011608293.1|1970907_1971567_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_012341336.1|1971601_1971826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011608291.1|1971838_1972483_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011608290.1|1972539_1973616_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_132994584.1|1973619_1974720_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	28.9	2.1e-41
>prophage 143
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	1980332	1988318	2110729		Clostridium_phage(20.0%)	10	NA	NA
WP_011608283.1|1980332_1980812_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	31.9	7.7e-17
WP_075293539.1|1980964_1981534_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	40.0	2.7e-32
WP_136121454.1|1981590_1982598_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.4	1.3e-08
WP_136121453.1|1982746_1983328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011608279.1|1983388_1983778_+	RidA family protein	NA	NA	NA	NA	NA
WP_011608278.1|1984005_1984341_+	competence protein ComE	NA	NA	NA	NA	NA
WP_011608277.1|1984530_1985127_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A2P1DNP2	Cassava_brown_streak_virus	31.4	5.5e-12
WP_136121452.1|1985126_1986305_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011608275.1|1986400_1987060_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_136121451.1|1987085_1988318_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.1	8.7e-105
>prophage 144
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	2007857	2012664	2110729		Streptococcus_phage(33.33%)	5	NA	NA
WP_136121437.1|2007857_2009177_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	28.1	6.6e-34
WP_080502951.1|2009197_2009908_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_012341040.1|2010081_2010726_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.1	1.0e-40
WP_075290602.1|2011073_2011313_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_012341038.1|2011386_2012664_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	47.5	1.1e-91
>prophage 145
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	2035266	2036775	2110729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_136121434.1|2035266_2036775_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	22.6	3.1e-11
>prophage 146
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	2048920	2050461	2110729	tRNA	Synechococcus_phage(100.0%)	2	NA	NA
WP_012341013.1|2048920_2049433_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.2	1.5e-18
WP_136121430.1|2049507_2050461_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	26.5	6.9e-09
>prophage 147
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	2053913	2055674	2110729		Lactobacillus_phage(50.0%)	2	NA	NA
WP_011608195.1|2053913_2054828_-	DNA-binding transcriptional regulator OxyR	NA	A0A2P0ZL89	Lactobacillus_phage	22.1	1.6e-07
WP_012341008.1|2054951_2055674_+	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	57.2	4.5e-45
>prophage 148
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	2059296	2060787	2110729		Bacillus_virus(100.0%)	1	NA	NA
WP_136121426.1|2059296_2060787_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	4.7e-12
>prophage 149
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	2073000	2074044	2110729		Indivirus(100.0%)	1	NA	NA
WP_136121421.1|2073000_2074044_-	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	31.2	1.2e-09
>prophage 150
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	2077993	2091124	2110729	tRNA	Escherichia_phage(57.14%)	13	NA	NA
WP_012340988.1|2077993_2078626_-	aldolase	NA	A0A077SK32	Escherichia_phage	59.7	3.8e-64
WP_132994545.1|2078622_2079864_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	53.0	1.5e-112
WP_012340986.1|2079865_2080774_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	70.8	3.3e-109
WP_011608169.1|2080944_2081703_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	48.4	2.1e-56
WP_011608168.1|2081703_2082129_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_012340984.1|2082128_2082692_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_012340982.1|2082825_2083374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136121418.1|2083370_2083922_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	A0A291ATS8	Pandoravirus	23.9	1.5e-08
WP_136121417.1|2083925_2084732_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_136121416.1|2084881_2087452_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.0	9.2e-32
WP_011608162.1|2087599_2089060_-	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_011608161.1|2089184_2089649_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_136121415.1|2089726_2091124_-	nicotinate phosphoribosyltransferase	NA	A0A1B0V392	Roseobacter_phage	51.0	2.3e-130
>prophage 151
NZ_CP042987	Histophilus somni strain UOC-KLM-ATR-08 chromosome, complete genome	2110729	2106729	2108604	2110729		Catovirus(100.0%)	1	NA	NA
WP_132995042.1|2106729_2108604_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.2	6.2e-86
