The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042993	Histophilus somni strain UOC-KLM-ATR-014 chromosome, complete genome	2183545	365179	419212	2183545	transposase,terminase,protease,integrase,capsid	Mannheimia_phage(34.48%)	54	369328:369344	399162:399178
WP_075293630.1|365179_366424_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	6.3e-127
WP_012341086.1|366439_367021_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	1.2e-59
WP_011609585.1|367106_368405_-	trigger factor	NA	NA	NA	NA	NA
WP_101812545.1|368787_370179_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
369328:369344	attL	TTGGATATAAGCGAAAC	NA	NA	NA	NA
WP_132994681.1|370212_371472_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_132994680.1|371541_372339_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_132994679.1|372484_373861_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_075293625.1|373903_375643_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.9	5.1e-34
WP_075293624.1|376099_377341_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.5	8.8e-89
WP_011609578.1|377302_377488_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.6	1.7e-09
WP_075293623.1|377500_378295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293622.1|378326_379514_-	DNA cytosine methyltransferase	NA	A0A2I7R2G4	Vibrio_phage	46.5	1.6e-95
WP_075293621.1|379542_380271_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	60.2	9.0e-17
WP_147590280.1|380276_381317_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-12
WP_075293619.1|381366_382035_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	74.0	6.4e-94
WP_075293618.1|382027_382963_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	76.9	7.0e-131
WP_011609572.1|382974_383274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293616.1|383323_383608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437241.1|383694_384360_-	Bro-N domain-containing protein	NA	Q7Y5X0	Haemophilus_phage	64.4	2.0e-39
WP_075293616.1|385163_385448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147590424.1|385534_386242_-	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	46.1	1.9e-19
WP_075293615.1|387368_387566_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	56.2	4.3e-14
WP_087437308.1|387568_387787_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_075293614.1|388666_388885_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	79.2	8.1e-22
WP_075293613.1|388908_389931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132994672.1|390071_390560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293611.1|390688_391105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437243.1|391101_391281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075290735.1|391548_391737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609564.1|392082_392349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437244.1|392893_393733_-	DNA replication protein DnaD	NA	F5A3D6	Riemerella_phage	39.3	3.1e-45
WP_087437245.1|393789_394476_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.4	5.5e-40
WP_012341693.1|394578_394806_+	hypothetical protein	NA	A0A1I9KFF6	Aeromonas_phage	43.1	2.8e-09
WP_075290719.1|394961_395195_+	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	76.7	1.1e-24
WP_147590281.1|396012_396705_+	replication protein P	NA	A0A077KCC8	Edwardsiella_phage	36.5	3.8e-25
WP_075293603.1|397282_397909_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	28.1	3.1e-18
WP_075293602.1|397921_398200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147590282.1|398278_398866_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	54.6	4.7e-48
WP_132994671.1|398855_399260_+	hypothetical protein	NA	NA	NA	NA	NA
399162:399178	attR	TTGGATATAAGCGAAAC	NA	NA	NA	NA
WP_147590283.1|399410_400250_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.2	1.3e-72
WP_075319826.1|400518_400935_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	7.4e-48
WP_075319827.1|400981_402118_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	56.4	2.6e-119
WP_012341704.1|402403_402640_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	70.5	2.7e-23
WP_011609542.1|402632_403169_+	lysozyme	NA	Q19UR6	Mannheimia_phage	50.3	5.2e-46
WP_132994669.1|403141_403471_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_041604566.1|403499_403643_+	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	69.8	9.9e-13
WP_075294025.1|403667_404363_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_132994668.1|404362_405910_+	TerL	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	42.4	4.9e-97
WP_132994667.1|405911_408089_+	hypothetical protein	NA	S4S2T1	Puniceispirillum_phage	26.1	5.2e-44
WP_147590284.1|408153_411426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609534.1|416667_416970_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_011609533.1|417067_417250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609532.1|417327_418191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132994663.1|418216_419212_+|capsid	N4-gp56 family major capsid protein	capsid	NA	NA	NA	NA
>prophage 2
NZ_CP042993	Histophilus somni strain UOC-KLM-ATR-014 chromosome, complete genome	2183545	463845	520775	2183545	transposase,integrase,protease	Escherichia_phage(16.67%)	57	489252:489268	507806:507822
WP_075319814.1|463845_464262_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_075319813.1|464308_465445_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_147590288.1|465700_466645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609888.1|466650_467097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609887.1|467314_467647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609885.1|468017_468665_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_132994536.1|468864_469170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147590289.1|469331_469649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147590290.1|469661_469967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049752248.1|470087_470555_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_011609880.1|471314_473345_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.2	1.2e-47
WP_041604434.1|473346_473634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609878.1|473728_474451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609877.1|474736_474988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609876.1|474984_475503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609875.1|475982_476462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293412.1|477351_478566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081376607.1|478636_479071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293458.1|479918_480758_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_075293414.1|480741_481746_+	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	27.6	1.2e-19
WP_075293415.1|482367_482790_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_075293416.1|482842_483343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293417.1|483345_483543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293459.1|483716_484178_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075293418.1|484540_484951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293419.1|484952_486980_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_075293460.1|486982_488305_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
489252:489268	attL	TAATGTTTTATGATTTT	NA	NA	NA	NA
WP_011609871.1|490388_490583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609870.1|490586_490796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609869.1|490799_491597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609868.1|491744_492257_-	DUF3158 family protein	NA	NA	NA	NA	NA
WP_147590291.1|492297_492558_-	DUF1845 family protein	NA	NA	NA	NA	NA
WP_081376609.1|492764_493952_+|integrase	site-specific integrase	integrase	A0A1B5FPC6	Escherichia_phage	32.1	6.8e-46
WP_081376610.1|493923_494763_+	ATP-binding protein	NA	H7BWC4	unidentified_phage	38.5	1.6e-38
WP_041604971.1|495288_495492_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_135026463.1|495607_495889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293423.1|495857_496079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293424.1|496382_496565_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	67.8	2.2e-12
WP_012341117.1|496861_497080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341122.1|498034_498334_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_075293425.1|498544_499063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147590292.1|499258_499861_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011609866.1|499970_501200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609865.1|501362_501914_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_011609864.1|501924_503631_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_147590293.1|503620_504973_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	45.2	2.1e-83
WP_132994788.1|506120_507230_+	methionine biosynthesis PLP-dependent protein	NA	A0A1V0SL56	Klosneuvirus	25.0	1.2e-17
WP_011609498.1|507394_507718_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	4.3e-19
WP_012341146.1|507835_508531_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
507806:507822	attR	AAAATCATAAAACATTA	NA	NA	NA	NA
WP_012341148.1|508617_509859_-	uracil permease	NA	NA	NA	NA	NA
WP_011609495.1|509960_510587_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_075321856.1|511746_513096_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_147590296.1|513500_513908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132994786.1|514717_516508_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	44.2	2.1e-136
WP_012341153.1|516529_517558_-	sugar kinase	NA	NA	NA	NA	NA
WP_132994785.1|518058_519357_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.9	4.5e-67
WP_132994784.1|519422_520775_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP042993	Histophilus somni strain UOC-KLM-ATR-014 chromosome, complete genome	2183545	741841	770782	2183545	transposase,integrase,terminase	Burkholderia_phage(18.18%)	31	760394:760453	771333:771442
WP_014325826.1|741841_742606_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
WP_087437258.1|743669_745163_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|745274_745580_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014325824.1|745607_746822_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001447541.1|747098_747983_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_075268008.1|748303_748528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325823.1|748610_749903_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025288851.1|750065_750911_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|751079_751883_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|751882_752719_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|753054_753870_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021112546.1|754786_755797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340803.1|757145_758045_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
WP_012340802.1|758194_758632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340801.1|759363_759942_-	hypothetical protein	NA	NA	NA	NA	NA
760394:760453	attL	GTGTCGGTTCGAGTCCGACCACTGGCACCAAATCCGATTTTCCATTCTTTCCCACTCTTT	NA	NA	NA	NA
WP_075294468.1|760692_761940_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	31.5	6.0e-53
WP_075294469.1|762232_762490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294470.1|762499_763009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340798.1|763176_763398_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_075294471.1|763407_763653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294472.1|763653_763893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081376605.1|763906_764434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294473.1|764585_765068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294474.1|765060_765279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041604074.1|765265_765634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294476.1|766159_768070_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	31.1	3.1e-48
WP_041604501.1|768613_768880_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	43.5	2.7e-11
WP_011608692.1|768915_769311_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.5	5.6e-05
WP_075294477.1|769449_769743_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	33.8	6.8e-08
WP_075294478.1|769755_770343_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.7	5.0e-10
WP_075294479.1|770335_770782_+|terminase	terminase	terminase	NA	NA	NA	NA
771333:771442	attR	GTGTCGGTTCGAGTCCGACCACTGGCACCAAATCCGATTTTCCATTCTTTCCCACTCTTTCAAATTCATTAAATAAACCTTTGTAAATAATAACGTTAAGTTGCTTTTTC	NA	NA	NA	NA
>prophage 4
NZ_CP042993	Histophilus somni strain UOC-KLM-ATR-014 chromosome, complete genome	2183545	1652985	1660257	2183545	transposase	Planktothrix_phage(16.67%)	6	NA	NA
WP_075320114.1|1652985_1654938_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	6.2e-12
WP_041604300.1|1654941_1655748_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	6.3e-19
WP_132995053.1|1655828_1657415_+	FAD-binding protein	NA	M1I0Y3	Acanthocystis_turfacea_Chlorella_virus	23.9	7.5e-08
WP_075319813.1|1657571_1658708_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_075319814.1|1658754_1659171_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_011609430.1|1659285_1660257_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	19.7	2.1e-05
>prophage 5
NZ_CP042993	Histophilus somni strain UOC-KLM-ATR-014 chromosome, complete genome	2183545	1869985	1906503	2183545	transposase,head,tail,plate	Haemophilus_phage(42.42%)	43	NA	NA
WP_081376598.1|1869985_1870159_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_147590406.1|1870847_1871645_-	transcriptional regulator	NA	A0A0M4UKA3	Ralstonia_phage	27.4	6.6e-13
WP_075294193.1|1871767_1872031_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_075294194.1|1874001_1874883_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	85.0	3.7e-134
WP_075294195.1|1874890_1875079_+	hypothetical protein	NA	F6MII8	Haemophilus_phage	80.0	1.3e-20
WP_075294196.1|1875075_1875381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294197.1|1876177_1876393_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_135026520.1|1876377_1876620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294199.1|1876757_1877216_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_075294200.1|1877309_1877498_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	52.7	2.8e-07
WP_075294201.1|1878226_1878895_+	hypothetical protein	NA	A0A0R6PJV6	Moraxella_phage	45.3	2.7e-20
WP_075294202.1|1878905_1879112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294203.1|1879236_1879662_+	mor transcription activator family protein	NA	F6MIJ8	Haemophilus_phage	66.4	1.5e-48
WP_075294204.1|1879751_1880294_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	67.2	2.5e-72
WP_075294205.1|1880300_1880531_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	52.7	8.0e-12
WP_075294206.1|1880527_1880785_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_075294208.1|1880901_1881156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294209.1|1881152_1881407_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	45.0	1.6e-08
WP_075294210.1|1881409_1881919_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	72.2	8.7e-67
WP_075294211.1|1883714_1885334_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	84.1	4.4e-266
WP_075294212.1|1885320_1886592_+|head	phage head morphogenesis protein	head	A0A0M3LSH7	Mannheimia_phage	70.9	2.3e-169
WP_081376597.1|1886833_1887379_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	75.4	1.1e-62
WP_075294213.1|1887378_1888359_+|head	head protein	head	B7SDP1	Haemophilus_phage	73.8	1.2e-133
WP_147590407.1|1888437_1888860_+	DUF1320 family protein	NA	A0A0M3LP98	Mannheimia_phage	59.6	2.8e-39
WP_075294215.1|1888856_1889495_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	70.8	5.0e-80
WP_147590408.1|1889491_1889758_+	hypothetical protein	NA	B7SDP6	Haemophilus_phage	65.9	1.7e-26
WP_075294217.1|1889744_1889918_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	72.7	3.7e-14
WP_075294218.1|1889917_1891339_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	74.8	1.5e-196
WP_075294219.1|1891350_1891725_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	85.5	3.3e-55
WP_087437316.1|1891793_1892081_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	52.8	3.5e-17
WP_075294221.1|1892351_1894484_+	hypothetical protein	NA	A0A0M3LPB6	Mannheimia_phage	37.0	9.8e-96
WP_087437296.1|1894525_1895881_+	hypothetical protein	NA	F6MIL2	Haemophilus_phage	61.9	1.4e-159
WP_075294228.1|1895891_1896998_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	72.3	1.1e-159
WP_075294223.1|1896994_1897654_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	69.4	1.3e-83
WP_075294224.1|1897756_1898107_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	78.4	9.9e-46
WP_075294225.1|1898119_1899181_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	72.4	1.1e-145
WP_075294226.1|1899180_1899744_+	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	41.9	4.8e-34
WP_148401612.1|1900122_1901298_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	51.0	1.9e-64
WP_012341722.1|1901311_1901659_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	50.9	1.3e-18
WP_012340329.1|1901642_1901894_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	50.6	1.2e-13
WP_147590410.1|1901997_1902585_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	60.9	1.1e-57
WP_132994802.1|1903897_1904587_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_132994803.1|1904781_1906503_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	1.2e-67
