The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043001	Histophilus somni strain UOC-KLM-ATR-04 chromosome, complete genome	2183401	365171	419204	2183401	protease,terminase,transposase,capsid,integrase	Mannheimia_phage(34.38%)	59	369320:369336	399150:399166
WP_075293630.1|365171_366416_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	6.3e-127
WP_012341086.1|366431_367013_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	1.2e-59
WP_011609585.1|367098_368397_-	trigger factor	NA	NA	NA	NA	NA
WP_101812545.1|368779_370171_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
369320:369336	attL	TTGGATATAAGCGAAAC	NA	NA	NA	NA
WP_132994681.1|370204_371464_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_132994680.1|371533_372331_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_132994679.1|372476_373853_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_075293625.1|373895_375635_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.9	5.1e-34
WP_134244515.1|376091_377333_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.5	6.8e-89
WP_011609578.1|377294_377480_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.6	1.7e-09
WP_134244513.1|377492_377975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147797364.1|378319_379507_-	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7R2G4	Vibrio_phage	46.3	2.1e-95
WP_147797365.1|379535_380264_-	polymer-forming cytoskeletal protein	NA	A0A0M3LPL3	Mannheimia_phage	61.8	7.4e-19
WP_147797366.1|380269_381310_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	69.2	7.3e-12
WP_075293619.1|381359_382028_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	74.0	6.4e-94
WP_075293618.1|382020_382956_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	76.9	7.0e-131
WP_011609572.1|382967_383267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293616.1|383316_383601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147797367.1|383687_384353_-	Bro-N domain-containing protein	NA	Q7Y5X0	Haemophilus_phage	63.0	2.9e-38
WP_087437242.1|384736_385159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293616.1|385155_385440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437307.1|385526_386234_-	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	46.6	2.9e-20
WP_075293615.1|387355_387553_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	56.2	4.3e-14
WP_087437308.1|387555_387774_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_075293614.1|388653_388872_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	79.2	8.1e-22
WP_075293613.1|388895_389918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_132994672.1|390058_390547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293611.1|390675_391092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437243.1|391088_391268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075290735.1|391536_391725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609564.1|392070_392337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437244.1|392882_393722_-	DNA replication protein DnaD	NA	F5A3D6	Riemerella_phage	39.3	3.1e-45
WP_147797368.1|393778_394465_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.4	5.5e-40
WP_012341693.1|394567_394795_+	hypothetical protein	NA	A0A1I9KFF6	Aeromonas_phage	43.1	2.8e-09
WP_148418578.1|394950_395184_+	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	76.7	1.1e-24
WP_134244477.1|395180_396005_+	DNA replication protein	NA	A0A1X9SFR3	Acinetobacter_phage	41.7	2.8e-38
WP_075293605.1|396001_396694_+	replication protein P	NA	A0A077KCC8	Edwardsiella_phage	34.6	1.9e-24
WP_134244479.1|396703_397234_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	67.2	2.4e-67
WP_075293603.1|397270_397897_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	28.1	3.1e-18
WP_075293602.1|397909_398188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293601.1|398266_398854_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	55.1	1.7e-50
WP_134244481.1|398843_399248_+	hypothetical protein	NA	NA	NA	NA	NA
399150:399166	attR	TTGGATATAAGCGAAAC	NA	NA	NA	NA
WP_147797370.1|399398_400238_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.2	1.0e-72
WP_075319826.1|400506_400923_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	7.4e-48
WP_075319827.1|400969_402106_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	56.4	2.6e-119
WP_012341704.1|402392_402629_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	70.5	2.7e-23
WP_011609542.1|402621_403158_+	lysozyme	NA	Q19UR6	Mannheimia_phage	50.3	5.2e-46
WP_132994669.1|403130_403460_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_041604566.1|403488_403632_+	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	69.8	9.9e-13
WP_075294025.1|403656_404352_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_132994668.1|404351_405899_+	TerL	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	42.4	4.9e-97
WP_132994667.1|405900_408078_+	hypothetical protein	NA	S4S2T1	Puniceispirillum_phage	26.1	5.2e-44
WP_147604089.1|408142_409996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147797371.1|409979_411587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147797372.1|411974_416153_+	hypothetical protein	NA	A0A2I7RNS1	Vibrio_phage	22.8	2.2e-22
WP_011609534.1|416659_416962_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_134244483.1|417059_417242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609532.1|417319_418183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132994663.1|418208_419204_+|capsid	N4-gp56 family major capsid protein	capsid	NA	NA	NA	NA
>prophage 2
NZ_CP043001	Histophilus somni strain UOC-KLM-ATR-04 chromosome, complete genome	2183401	463828	520756	2183401	integrase,transposase,protease	Escherichia_phage(16.67%)	56	489230:489246	507786:507802
WP_075319814.1|463828_464245_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_075319813.1|464291_465428_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_147797376.1|465683_466628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609888.1|466633_467080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609887.1|467297_467630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609885.1|468000_468648_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_132994536.1|468847_469153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147611119.1|469228_469630_-	heme utilization protein	NA	NA	NA	NA	NA
WP_147797377.1|469726_469948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049752248.1|470068_470536_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_011609880.1|471295_473326_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.2	1.2e-47
WP_041604434.1|473327_473615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609878.1|473709_474432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609877.1|474717_474969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041604432.1|474965_475340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609875.1|475963_476443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148418580.1|477329_478544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081376607.1|478614_479049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293458.1|479896_480736_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_075293414.1|480719_481724_+	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	27.6	1.2e-19
WP_075293415.1|482345_482768_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_075293416.1|482820_483321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293417.1|483323_483521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293459.1|483694_484156_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075293418.1|484518_484929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147797379.1|484930_486958_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_075293460.1|486960_488283_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
489230:489246	attL	TAATGTTTTATGATTTT	NA	NA	NA	NA
WP_011609871.1|490367_490562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609870.1|490565_490775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609869.1|490778_491576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609868.1|491723_492236_-	DUF3158 family protein	NA	NA	NA	NA	NA
WP_147797380.1|492276_492549_-	DUF1845 family protein	NA	NA	NA	NA	NA
WP_081376609.1|492745_493933_+|integrase	site-specific integrase	integrase	A0A1B5FPC6	Escherichia_phage	32.1	6.8e-46
WP_081376610.1|493904_494744_+	ATP-binding protein	NA	H7BWC4	unidentified_phage	38.5	1.6e-38
WP_041604971.1|495269_495473_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_135026463.1|495588_495870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293423.1|495838_496060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293424.1|496363_496546_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	67.8	2.2e-12
WP_012341117.1|496842_497061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341122.1|498015_498315_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_075293425.1|498525_499044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147604096.1|499226_499841_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011609866.1|499950_501180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609865.1|501342_501894_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_011609864.1|501904_503611_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_147604097.1|503600_504953_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	45.2	2.1e-83
WP_132994788.1|506100_507210_+	methionine biosynthesis PLP-dependent protein	NA	A0A1V0SL56	Klosneuvirus	25.0	1.2e-17
WP_011609498.1|507374_507698_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	4.3e-19
WP_012341146.1|507815_508511_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
507786:507802	attR	AAAATCATAAAACATTA	NA	NA	NA	NA
WP_012341148.1|508597_509839_-	uracil permease	NA	NA	NA	NA	NA
WP_011609495.1|509940_510567_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_147590457.1|513481_513889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132994786.1|514698_516489_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	44.2	2.1e-136
WP_012341153.1|516510_517539_-	sugar kinase	NA	NA	NA	NA	NA
WP_132994785.1|518039_519338_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.9	4.5e-67
WP_132994784.1|519403_520756_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP043001	Histophilus somni strain UOC-KLM-ATR-04 chromosome, complete genome	2183401	741839	770772	2183401	integrase,transposase,terminase	Burkholderia_phage(18.18%)	31	760392:760451	771323:771430
WP_014325826.1|741839_742604_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
WP_087437258.1|743667_745161_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|745272_745578_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014325824.1|745605_746820_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001447541.1|747096_747981_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_075268008.1|748301_748526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325823.1|748608_749901_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025288851.1|750063_750909_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|751077_751881_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|751880_752717_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|753052_753868_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021112546.1|754784_755795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340803.1|757143_758043_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
WP_012340802.1|758192_758630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340801.1|759361_759940_-	hypothetical protein	NA	NA	NA	NA	NA
760392:760451	attL	GTGTCGGTTCGAGTCCGACCACTGGCACCAAATCCGATTTTCCATTCTTTCCCACTCTTT	NA	NA	NA	NA
WP_147797394.1|760690_761938_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	32.1	7.8e-53
WP_075294469.1|762219_762477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294470.1|762486_762996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011608679.1|763163_763385_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_075294471.1|763394_763640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294472.1|763640_763880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081376605.1|763893_764421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147797395.1|764572_765058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134244549.1|765050_765269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041604074.1|765255_765624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147797396.1|766149_768060_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	30.8	6.4e-46
WP_041604501.1|768603_768870_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	43.5	2.7e-11
WP_011608692.1|768905_769301_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.5	5.6e-05
WP_011608693.1|769439_769733_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	33.8	4.0e-08
WP_075294478.1|769745_770333_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.7	5.0e-10
WP_075294479.1|770325_770772_+|terminase	terminase	terminase	NA	NA	NA	NA
771323:771430	attR	GTGTCGGTTCGAGTCCGACCACTGGCACCAAATCCGATTTTCCATTCTTTCCCACTCTTTCAAATTCATTAAATAAACCTTTGTAAATAATAACGTTAAGTTGCTTTT	NA	NA	NA	NA
>prophage 4
NZ_CP043001	Histophilus somni strain UOC-KLM-ATR-04 chromosome, complete genome	2183401	1652870	1660142	2183401	transposase	Planktothrix_phage(16.67%)	6	NA	NA
WP_075320114.1|1652870_1654823_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	6.2e-12
WP_041604300.1|1654826_1655633_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	6.3e-19
WP_132995053.1|1655713_1657300_+	FAD-binding protein	NA	M1I0Y3	Acanthocystis_turfacea_Chlorella_virus	23.9	7.5e-08
WP_075319813.1|1657456_1658593_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_075319814.1|1658639_1659056_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_011609430.1|1659170_1660142_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	19.7	2.1e-05
>prophage 5
NZ_CP043001	Histophilus somni strain UOC-KLM-ATR-04 chromosome, complete genome	2183401	1869838	1932544	2183401	tail,terminase,tRNA,transposase,plate,head	Haemophilus_phage(37.5%)	69	NA	NA
WP_081376598.1|1869838_1870012_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075294192.1|1870700_1871498_-	transcriptional regulator	NA	A0A0M4UKA3	Ralstonia_phage	27.4	8.6e-13
WP_075294193.1|1871620_1871884_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_075294194.1|1873854_1874736_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	85.0	3.7e-134
WP_075294195.1|1874743_1874932_+	hypothetical protein	NA	F6MII8	Haemophilus_phage	80.0	1.3e-20
WP_147797456.1|1874928_1875234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134244429.1|1876030_1876246_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_147604190.1|1876245_1876473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148418643.1|1876690_1877068_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_075294200.1|1877161_1877350_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	52.7	2.8e-07
WP_075294201.1|1878078_1878747_+	hypothetical protein	NA	A0A0R6PJV6	Moraxella_phage	45.3	2.7e-20
WP_075294202.1|1878757_1878964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294203.1|1879088_1879514_+	mor transcription activator family protein	NA	F6MIJ8	Haemophilus_phage	66.4	1.5e-48
WP_148418645.1|1879603_1880146_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	68.4	5.1e-73
WP_075294205.1|1880152_1880383_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	52.7	8.0e-12
WP_148418647.1|1880379_1880637_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_075294208.1|1880754_1881009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294209.1|1881005_1881260_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	45.0	1.6e-08
WP_075294210.1|1881262_1881772_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	72.2	8.7e-67
WP_135026522.1|1881876_1883490_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	85.1	2.5e-277
WP_147797460.1|1883568_1885188_+	DUF935 family protein	NA	A0A0M3LRU4	Mannheimia_phage	83.9	2.2e-265
WP_075294212.1|1885174_1886446_+|head	phage head morphogenesis protein	head	A0A0M3LSH7	Mannheimia_phage	70.9	2.3e-169
WP_081376597.1|1886687_1887233_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	75.4	1.1e-62
WP_147797461.1|1887232_1888213_+|head	head protein	head	B7SDP1	Haemophilus_phage	73.5	4.6e-133
WP_075294214.1|1888291_1888714_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	64.5	6.5e-44
WP_075294215.1|1888710_1889349_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	70.8	5.0e-80
WP_075294216.1|1889345_1889612_+	hypothetical protein	NA	B7SDP6	Haemophilus_phage	67.1	6.0e-27
WP_075294217.1|1889598_1889772_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	72.7	3.7e-14
WP_075294218.1|1889771_1891193_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	74.8	1.5e-196
WP_075294219.1|1891204_1891579_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	85.5	3.3e-55
WP_087437316.1|1891647_1891935_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	52.8	3.5e-17
WP_147797462.1|1892205_1894338_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	36.9	1.4e-94
WP_147797463.1|1894379_1895735_+	hypothetical protein	NA	F6MIL2	Haemophilus_phage	61.5	4.0e-159
WP_075294228.1|1895745_1896852_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	72.3	1.1e-159
WP_075294223.1|1896848_1897508_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	69.4	1.3e-83
WP_075294224.1|1897610_1897961_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	78.4	9.9e-46
WP_075294225.1|1897973_1899035_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	72.4	1.1e-145
WP_075294226.1|1899034_1899598_+	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	41.9	4.8e-34
WP_147797464.1|1899976_1901158_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	50.4	7.9e-63
WP_012341722.1|1901164_1901512_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	50.9	1.3e-18
WP_012340329.1|1901495_1901747_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	50.6	1.2e-13
WP_147797465.1|1901809_1902436_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	59.2	1.8e-61
WP_132994802.1|1903748_1904438_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_132994803.1|1904632_1906354_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	1.2e-67
WP_147590529.1|1906346_1907039_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_132994805.1|1907175_1908273_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.1	1.7e-06
WP_132994847.1|1908348_1909860_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.2	2.2e-86
WP_132994817.1|1910150_1911353_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.7	1.1e-22
WP_132994819.1|1911792_1912362_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_075294460.1|1913318_1913762_+	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_075266381.1|1913885_1914860_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	8.8e-52
WP_147797480.1|1914957_1915968_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.7	7.0e-52
WP_011609634.1|1916046_1917336_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012341351.1|1917396_1917924_-	DUF1523 family protein	NA	NA	NA	NA	NA
WP_132994821.1|1917951_1918734_-	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_041604354.1|1918742_1919732_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_132994823.1|1919724_1920357_-	dTMP kinase	NA	W8D0J5	Erwinia_phage	34.4	1.3e-19
WP_132994825.1|1920366_1921407_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011609640.1|1921538_1922351_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011609641.1|1922497_1923196_+	competence protein	NA	NA	NA	NA	NA
WP_011609642.1|1923288_1923870_+	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_075294453.1|1923907_1925224_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_134244467.1|1925290_1927594_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_011609645.1|1927773_1928250_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011609646.1|1928259_1928541_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_075294451.1|1928541_1929225_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_132994829.1|1929230_1931036_+	potassium transporter	NA	NA	NA	NA	NA
WP_012341339.1|1931048_1931537_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_012341338.1|1931536_1932544_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
