The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043225	Enterobacter hormaechei strain PG20180056 chromosome, complete genome	4635242	562256	575935	4635242	integrase	Enterobacteria_phage(77.78%)	14	552280:552293	569706:569719
552280:552293	attL	CGGCCAGCGGCAAC	NA	NA	NA	NA
WP_047718329.1|562256_563516_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.1e-73
WP_047718330.1|563588_564317_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_017692853.1|565006_565570_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	6.0e-61
WP_047718331.1|565598_565817_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	66.7	2.5e-15
WP_047718333.1|565819_566563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125183029.1|566547_566781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026094409.1|567114_567381_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	62.5	4.4e-22
WP_045339587.1|567377_567932_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.0	3.9e-36
WP_017694617.1|567924_568224_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	71.1	1.1e-32
WP_017694616.1|568216_568666_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.8	9.7e-46
WP_032620946.1|568770_568998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620858.1|568994_569315_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_148754431.1|569329_571663_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.6	0.0e+00
569706:569719	attR	CGGCCAGCGGCAAC	NA	NA	NA	NA
WP_139152738.1|572425_575935_+	type I restriction-modification system endonuclease	NA	S0A182	Cellulophaga_phage	34.8	1.1e-06
>prophage 2
NZ_CP043225	Enterobacter hormaechei strain PG20180056 chromosome, complete genome	4635242	1114289	1183011	4635242	transposase,head,capsid,terminase,plate,tRNA,protease,integrase,tail,portal	Enterobacteria_phage(48.78%)	77	1130731:1130759	1186542:1186570
WP_080346137.1|1114289_1115444_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_047718970.1|1115451_1115655_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_017383213.1|1115667_1116195_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_015571246.1|1116245_1116623_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_000127359.1|1116774_1117326_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	1.6e-29
WP_017383214.1|1117414_1119343_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	42.9	7.9e-44
WP_003858972.1|1119396_1119729_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_006809843.1|1119728_1120334_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_032670453.1|1120444_1122319_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.3	7.8e-113
WP_006809841.1|1122537_1123182_+	adenylate kinase	NA	NA	NA	NA	NA
WP_047718967.1|1123306_1124269_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017383217.1|1124331_1125636_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_017383218.1|1125729_1127406_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_015571242.1|1127638_1128859_-	MFS transporter	NA	NA	NA	NA	NA
WP_017383219.1|1129023_1130676_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
1130731:1130759	attL	AGGCCCGGTAAGCGCAGCGCCACCGGGCA	NA	NA	NA	NA
WP_010428207.1|1130765_1131245_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_023303208.1|1131443_1132238_-	GumN family protein	NA	NA	NA	NA	NA
WP_023303209.1|1132288_1134787_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.3	4.5e-108
WP_088545029.1|1135016_1135208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074172047.1|1135441_1135690_-	hypothetical protein	NA	Q858U4	Yersinia_virus	50.0	4.0e-09
WP_063147925.1|1135729_1136866_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	79.0	5.1e-160
WP_063153996.1|1137019_1138201_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	75.9	2.5e-173
WP_014072462.1|1138201_1138714_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	65.9	2.1e-60
WP_063153994.1|1138766_1139084_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	55.1	7.6e-21
WP_032424037.1|1139089_1139245_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
WP_148754450.1|1139231_1142198_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	52.9	1.9e-259
WP_014072465.1|1142212_1142701_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	74.1	2.4e-66
WP_063147927.1|1142854_1143259_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	49.3	5.3e-27
WP_148772187.1|1143271_1145458_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.0	5.7e-91
WP_063147929.1|1145469_1145997_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	73.9	6.4e-73
WP_063147930.1|1145989_1146886_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	66.8	2.0e-103
WP_063153988.1|1146872_1147241_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	64.3	1.3e-35
WP_148754454.1|1147237_1147819_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.4	5.4e-73
WP_063153985.1|1147815_1148454_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	53.6	2.7e-57
WP_063153984.1|1148446_1148917_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	66.9	1.5e-60
WP_148754457.1|1149018_1149231_-	peptidase	NA	NA	NA	NA	NA
WP_148754459.1|1149127_1149565_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	35.3	2.3e-07
WP_148754461.1|1149561_1150107_-	glycoside hydrolase family protein	NA	Q1I0Z1	Pasteurella_virus	41.1	1.7e-28
WP_148754463.1|1150090_1150393_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_148754465.1|1150383_1150584_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	77.3	1.1e-22
WP_063153976.1|1150583_1151108_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	51.7	7.6e-42
WP_063153974.1|1151206_1152064_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	57.6	2.0e-68
WP_063153972.1|1152109_1153159_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	51.9	2.8e-104
WP_063153970.1|1153182_1154019_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.3	1.0e-101
WP_063958605.1|1154178_1155909_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	77.0	2.1e-269
WP_063153966.1|1155908_1156967_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.8	1.5e-142
WP_148754468.1|1157434_1157677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063153962.1|1157669_1158365_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	83.0	1.3e-105
WP_063153960.1|1158564_1160955_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	84.9	0.0e+00
WP_063147949.1|1161164_1161371_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	77.8	3.4e-22
WP_080460818.1|1161370_1162228_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	55.3	5.7e-79
WP_063147950.1|1162236_1162785_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	30.3	7.8e-13
WP_063147951.1|1162781_1163006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063147952.1|1163073_1163346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063147953.1|1163366_1163594_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	69.3	5.6e-26
WP_074136366.1|1163769_1164030_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	49.2	2.5e-09
WP_058651712.1|1164042_1164381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063147954.1|1164629_1164929_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	56.6	7.4e-26
WP_148754470.1|1164998_1166021_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	49.8	1.4e-92
WP_017383222.1|1166107_1166518_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_015571238.1|1166514_1166967_-	NfeD family protein	NA	NA	NA	NA	NA
WP_003858941.1|1166963_1167878_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_015571236.1|1168032_1168887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015571235.1|1169029_1169701_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.3	2.7e-23
WP_047051105.1|1169693_1170476_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_045327640.1|1170527_1171382_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_006809829.1|1171440_1172250_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003858933.1|1172230_1172863_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_023315548.1|1172833_1173520_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.1e-32
WP_017383227.1|1173516_1175931_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017383228.1|1176113_1177259_+	porin	NA	NA	NA	NA	NA
WP_015571228.1|1177381_1178452_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_003858922.1|1178536_1179604_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_006809824.1|1179600_1180110_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_047718964.1|1180229_1180952_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256009.1|1180955_1181450_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_017383232.1|1181625_1183011_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	1.5e-44
1186542:1186570	attR	AGGCCCGGTAAGCGCAGCGCCACCGGGCA	NA	NA	NA	NA
>prophage 3
NZ_CP043225	Enterobacter hormaechei strain PG20180056 chromosome, complete genome	4635242	2677402	2742076	4635242	holin,head,terminase,tRNA,protease,tail,portal	Escherichia_phage(15.38%)	75	NA	NA
WP_015570297.1|2677402_2678284_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_015570296.1|2678477_2680526_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
WP_003859895.1|2680545_2681232_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_006811006.1|2681328_2681826_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_020480541.1|2681958_2683242_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_017693254.1|2683210_2685844_+	PqiB family protein	NA	NA	NA	NA	NA
WP_017693253.1|2685900_2687364_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_003859885.1|2687470_2687710_+	YebV family protein	NA	NA	NA	NA	NA
WP_015570293.1|2687744_2688389_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.9e-55
WP_047719460.1|2688556_2689537_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_017693250.1|2689582_2689780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003859787.1|2689905_2690244_-	YebY family protein	NA	NA	NA	NA	NA
WP_047719459.1|2690260_2691130_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_023296802.1|2691131_2691503_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003859784.1|2691640_2691871_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
WP_003859783.1|2691982_2692633_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_047733794.1|2692657_2693320_+	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_017693247.1|2693301_2695377_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_047719457.1|2695452_2696103_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_047719456.1|2696274_2697453_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003859774.1|2697527_2698169_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_047719454.1|2698208_2700020_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003859771.1|2700253_2701729_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
WP_003859769.1|2702085_2702955_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003859767.1|2703069_2704512_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_015570283.1|2704555_2705527_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_045348798.1|2705644_2706964_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_032103662.1|2706979_2707924_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_023296807.1|2708001_2708757_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	8.8e-15
WP_015570280.1|2708753_2709539_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003859753.1|2709591_2710602_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.4e-07
WP_003859751.1|2710610_2711225_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003859749.1|2711305_2711827_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003859747.1|2711861_2712602_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003859745.1|2712629_2713073_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_017384352.1|2713074_2714847_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015570278.1|2715109_2715676_+	hydrolase	NA	NA	NA	NA	NA
WP_063255217.1|2716040_2716304_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	90.8	2.4e-36
WP_148754506.1|2716345_2716900_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	78.3	3.8e-76
WP_148754508.1|2717030_2717771_+|tail	phage tail protein	tail	G8C7K5	Escherichia_phage	68.0	3.6e-90
WP_032673522.1|2719342_2720020_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	96.4	1.3e-121
WP_058656707.1|2720037_2721312_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	98.8	6.2e-247
WP_058656708.1|2721311_2722826_-|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	99.6	6.8e-293
WP_148754510.1|2722832_2723318_-|terminase	terminase	terminase	Q77WA1	Escherichia_phage	98.1	2.2e-80
WP_059468687.1|2723469_2723706_-	hypothetical protein	NA	K7PHC8	Enterobacterial_phage	96.2	7.4e-37
WP_048209453.1|2723705_2724047_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	99.1	1.6e-64
WP_148754512.1|2724043_2724634_-	hypothetical protein	NA	F1C588	Cronobacter_phage	95.9	3.0e-111
WP_148754514.1|2724615_2726073_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	74.4	6.9e-218
WP_127345315.1|2726084_2726738_-	DUF1983 domain-containing protein	NA	K7PH02	Enterobacteria_phage	85.4	1.2e-36
WP_050597004.1|2726863_2727055_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	88.0	3.9e-20
WP_032659111.1|2727005_2727284_-	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	92.0	6.1e-06
WP_032659116.1|2727280_2727823_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.9	7.0e-75
WP_001514184.1|2727825_2728101_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|2728097_2728499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006811071.1|2729043_2729826_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.4	1.5e-110
WP_032621744.1|2729829_2731701_-	AAA family ATPase	NA	Q5G8S8	Enterobacteria_phage	59.6	1.1e-223
WP_006811073.1|2731808_2732741_-	hypothetical protein	NA	C5IHL2	Burkholderia_virus	37.0	2.2e-36
WP_126519123.1|2732737_2732935_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_048859479.1|2732936_2733152_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	50.0	2.4e-10
WP_032621740.1|2733305_2733998_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	65.4	4.3e-85
WP_032621737.1|2734169_2734463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126519119.1|2734536_2734923_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	60.0	6.4e-38
WP_148754516.1|2735029_2735254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126519117.1|2735246_2735654_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	82.8	1.2e-47
WP_072159686.1|2735625_2735847_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.1e-18
WP_063850003.1|2735843_2736251_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	51.5	6.6e-25
WP_126519113.1|2736250_2736445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045345438.1|2736441_2737269_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.4	2.5e-111
WP_032635099.1|2737314_2738058_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	94.7	4.6e-133
WP_045347095.1|2738060_2738486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045347096.1|2738478_2738724_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	85.5	4.2e-35
WP_148754518.1|2738779_2740093_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	85.8	7.1e-222
WP_048984553.1|2740071_2740845_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.3e-58
WP_003859737.1|2740896_2741292_+	membrane protein	NA	NA	NA	NA	NA
WP_003859735.1|2741332_2742076_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
>prophage 4
NZ_CP043225	Enterobacter hormaechei strain PG20180056 chromosome, complete genome	4635242	2902745	2911992	4635242		Escherichia_phage(25.0%)	9	NA	NA
WP_032103476.1|2902745_2903357_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
WP_047718266.1|2903396_2904377_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_047718268.1|2904569_2905574_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.3	6.6e-34
WP_023294998.1|2905621_2906788_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.6e-111
WP_023294999.1|2907041_2908448_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_148754521.1|2908583_2909132_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	2.4e-54
WP_032682169.1|2909142_2910033_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.3	2.8e-28
WP_023295002.1|2910045_2910912_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	8.3e-110
WP_032103484.1|2910927_2911992_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
>prophage 5
NZ_CP043225	Enterobacter hormaechei strain PG20180056 chromosome, complete genome	4635242	3401043	3501386	4635242	holin,capsid,head,terminase,lysis,plate,tRNA,integrase,tail,portal	Escherichia_phage(27.78%)	110	3476654:3476670	3497962:3497978
WP_032649123.1|3401043_3401781_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_017383554.1|3401913_3403242_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860727.1|3403293_3403677_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_045347547.1|3403992_3404682_+	uracil-DNA glycosylase	NA	A0A0S0DP74	Lymphocryptovirus	50.2	2.1e-55
WP_017383555.1|3404721_3405807_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_032649129.1|3406011_3406431_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_047718866.1|3406501_3407200_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_017692865.1|3407235_3409899_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_026094276.1|3410008_3411364_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003860739.1|3411409_3411733_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_047718868.1|3411729_3413076_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	3.6e-43
WP_039270055.1|3413188_3413641_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	1.7e-34
WP_017692862.1|3419164_3421738_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	6.9e-128
WP_047718511.1|3421867_3422599_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_017383977.1|3422595_3423576_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863164.1|3423707_3424445_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863162.1|3424712_3425054_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100229775.1|3425158_3425206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015571567.1|3425313_3426474_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_017383978.1|3426470_3427343_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_006811631.1|3427403_3428525_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_006811632.1|3428535_3429606_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_032619209.1|3429817_3430192_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_032619208.1|3430345_3430882_+	YfiR family protein	NA	NA	NA	NA	NA
WP_017692859.1|3430874_3432095_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_017382956.1|3432107_3432593_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017382957.1|3432595_3433966_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_047718512.1|3434004_3434409_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_045359356.1|3434653_3435685_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	79.8	1.4e-164
WP_045359358.1|3435687_3436548_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	43.8	2.0e-68
WP_045359360.1|3436667_3436898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045359362.1|3436929_3437439_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	85.8	1.9e-77
WP_072050071.1|3437446_3437647_+	DUF2724 domain-containing protein	NA	A0A218M4I1	Erwinia_phage	75.8	5.7e-22
WP_045359364.1|3437610_3437949_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	75.9	2.4e-41
WP_045359367.1|3438014_3438242_+	DUF2732 family protein	NA	A0A218M4I9	Erwinia_phage	61.3	2.6e-15
WP_045359370.1|3438242_3438524_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	69.9	1.5e-28
WP_048249330.1|3438501_3440895_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	85.8	0.0e+00
WP_049108644.1|3440913_3441141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045359375.1|3441356_3441539_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	70.7	6.5e-17
WP_048249328.1|3441542_3441776_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	1.8e-35
WP_049108645.1|3442475_3443498_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.6	6.0e-168
WP_048249324.1|3443499_3445269_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.9	6.5e-303
WP_059453244.1|3445434_3446289_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	70.1	3.4e-108
WP_039671454.1|3446349_3447423_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	79.3	1.6e-158
WP_059453245.1|3447426_3448188_+|terminase	terminase endonuclease subunit	terminase	A0A218M4L0	Erwinia_phage	66.8	7.3e-78
WP_049108649.1|3448287_3448788_+|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	67.4	1.8e-56
WP_059453246.1|3448787_3448991_+|tail	phage tail protein	tail	Q858W3	Yersinia_virus	82.1	1.6e-24
WP_049108653.1|3448995_3449292_+|holin	holin	holin	O80308	Escherichia_phage	88.8	2.3e-40
WP_049108654.1|3449278_3449776_+	glycoside hydrolase family 104 protein	NA	O80309	Escherichia_phage	91.4	2.4e-85
WP_058658663.1|3449772_3450186_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	68.6	7.1e-43
WP_115877087.1|3450067_3450331_+|holin	holin	holin	S4TNY4	Salmonella_phage	69.8	4.1e-28
WP_039671463.1|3450293_3450761_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	85.8	2.2e-72
WP_039671464.1|3450753_3451203_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	1.8e-47
WP_148754528.1|3451271_3452378_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	79.9	2.4e-90
WP_039671470.1|3452370_3452901_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	85.8	2.6e-90
WP_148754530.1|3452912_3455099_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.0	1.4e-89
WP_039671472.1|3455110_3455515_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	51.1	2.6e-29
WP_063409934.1|3455639_3456830_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	90.2	3.4e-207
WP_063409933.1|3456843_3457362_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	91.3	1.5e-87
WP_058658647.1|3457423_3457699_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	83.5	1.6e-35
WP_039671477.1|3457731_3457851_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	6.7e-15
WP_063409932.1|3457843_3460387_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	70.5	6.2e-222
WP_048249321.1|3460402_3460882_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	84.3	2.6e-73
WP_048249319.1|3460881_3462027_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	78.6	3.8e-155
WP_072050070.1|3462104_3462323_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	80.6	2.1e-30
WP_002914145.1|3462482_3462830_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003863138.1|3462873_3463641_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015571575.1|3463672_3464212_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3464227_3464476_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|3464592_3465954_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014832951.1|3466120_3466912_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026094274.1|3466931_3468218_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003863126.1|3468269_3468863_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_017383004.1|3468985_3469864_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_015571579.1|3469949_3471611_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071524123.1|3471585_3471768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003863121.1|3471749_3472088_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_003863119.1|3472149_3472437_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|3472426_3472903_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|3473020_3473503_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_048249317.1|3474120_3475350_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	85.6	1.1e-205
WP_047718515.1|3475632_3477189_+	recombinase family protein	NA	Q9XJF6	Enterococcus_phage	26.9	8.4e-12
3476654:3476670	attL	TCATTGATGAAGATGAT	NA	NA	NA	NA
WP_047718519.1|3477178_3478075_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_047718520.1|3478071_3478968_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000248204.1|3479095_3479308_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	77.3	2.5e-20
WP_047718521.1|3479464_3481072_-	sporadically distributed, TIGR04141 family protein	NA	NA	NA	NA	NA
WP_001624497.1|3481090_3481726_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_148754532.1|3481722_3482835_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_047718527.1|3482827_3484216_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.5	1.4e-47
WP_047718528.1|3484215_3484488_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_003845893.1|3485541_3486102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549549.1|3486510_3486948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047718530.1|3486916_3488080_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_007666384.1|3488304_3488577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001078959.1|3488618_3489005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708681.1|3489024_3489339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000360018.1|3489389_3489815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062150.1|3489911_3490298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718533.1|3490312_3492187_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_047718536.1|3492183_3493488_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_008322898.1|3493480_3494683_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001019190.1|3494978_3495278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000795663.1|3495298_3495505_-	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
WP_001067212.1|3495784_3496630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023295270.1|3497194_3497434_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	92.4	2.2e-33
WP_023295271.1|3497497_3497860_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	70.0	3.4e-41
WP_023295272.1|3497856_3498771_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.4	1.6e-159
3497962:3497978	attR	ATCATCTTCATCAATGA	NA	NA	NA	NA
WP_047718538.1|3498771_3500244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080346129.1|3500319_3500592_-	hypothetical protein	NA	A0A0F7LDZ0	Escherichia_phage	66.1	3.4e-17
WP_015571649.1|3500780_3501386_-	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	25.7	5.4e-07
