The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043226	Enterobacter hormaechei strain PG20180049 chromosome, complete genome	4635256	562266	575945	4635256	integrase	Enterobacteria_phage(77.78%)	14	552290:552303	569716:569729
552290:552303	attL	CGGCCAGCGGCAAC	NA	NA	NA	NA
WP_047718329.1|562266_563526_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.1e-73
WP_047718330.1|563598_564327_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_017692853.1|565016_565580_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	6.0e-61
WP_047718331.1|565608_565827_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	66.7	2.5e-15
WP_047718333.1|565829_566573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125183029.1|566557_566791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026094409.1|567124_567391_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	62.5	4.4e-22
WP_045339587.1|567387_567942_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.0	3.9e-36
WP_017694617.1|567934_568234_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	71.1	1.1e-32
WP_017694616.1|568226_568676_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.8	9.7e-46
WP_032620946.1|568780_569008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620858.1|569004_569325_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_148754431.1|569339_571673_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.6	0.0e+00
569716:569729	attR	CGGCCAGCGGCAAC	NA	NA	NA	NA
WP_139152738.1|572435_575945_+	type I restriction-modification system endonuclease	NA	S0A182	Cellulophaga_phage	34.8	1.1e-06
>prophage 2
NZ_CP043226	Enterobacter hormaechei strain PG20180049 chromosome, complete genome	4635256	1114299	1183021	4635256	transposase,terminase,protease,head,portal,capsid,integrase,plate,tRNA,tail	Enterobacteria_phage(48.78%)	77	1130741:1130769	1186552:1186580
WP_080346137.1|1114299_1115454_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_047718970.1|1115461_1115665_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_017383213.1|1115677_1116205_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_015571246.1|1116255_1116633_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_000127359.1|1116784_1117336_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	1.6e-29
WP_017383214.1|1117424_1119353_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	42.9	7.9e-44
WP_003858972.1|1119406_1119739_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_006809843.1|1119738_1120344_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_032670453.1|1120454_1122329_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.3	7.8e-113
WP_006809841.1|1122547_1123192_+	adenylate kinase	NA	NA	NA	NA	NA
WP_047718967.1|1123316_1124279_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017383217.1|1124341_1125646_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_017383218.1|1125739_1127416_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_015571242.1|1127648_1128869_-	MFS transporter	NA	NA	NA	NA	NA
WP_017383219.1|1129033_1130686_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
1130741:1130769	attL	AGGCCCGGTAAGCGCAGCGCCACCGGGCA	NA	NA	NA	NA
WP_010428207.1|1130775_1131255_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_023303208.1|1131453_1132248_-	GumN family protein	NA	NA	NA	NA	NA
WP_023303209.1|1132298_1134797_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.3	4.5e-108
WP_088545029.1|1135026_1135218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074172047.1|1135451_1135700_-	hypothetical protein	NA	Q858U4	Yersinia_virus	50.0	4.0e-09
WP_063147925.1|1135739_1136876_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	79.0	5.1e-160
WP_063153996.1|1137029_1138211_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	75.9	2.5e-173
WP_014072462.1|1138211_1138724_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	65.9	2.1e-60
WP_063153994.1|1138776_1139094_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	55.1	7.6e-21
WP_032424037.1|1139099_1139255_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
WP_148754450.1|1139241_1142208_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	52.9	1.9e-259
WP_014072465.1|1142222_1142711_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	74.1	2.4e-66
WP_063147927.1|1142864_1143269_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	49.3	5.3e-27
WP_148754452.1|1143281_1145468_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.0	5.7e-91
WP_063147929.1|1145479_1146007_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	73.9	6.4e-73
WP_063147930.1|1145999_1146896_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	66.8	2.0e-103
WP_063153988.1|1146882_1147251_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	64.3	1.3e-35
WP_148754454.1|1147247_1147829_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.4	5.4e-73
WP_063153985.1|1147825_1148464_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	53.6	2.7e-57
WP_063153984.1|1148456_1148927_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	66.9	1.5e-60
WP_148754457.1|1149028_1149241_-	peptidase	NA	NA	NA	NA	NA
WP_148754459.1|1149137_1149575_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	35.3	2.3e-07
WP_148754461.1|1149571_1150117_-	glycoside hydrolase family protein	NA	Q1I0Z1	Pasteurella_virus	41.1	1.7e-28
WP_148754463.1|1150100_1150403_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_148754465.1|1150393_1150594_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	77.3	1.1e-22
WP_063153976.1|1150593_1151118_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	51.7	7.6e-42
WP_063153974.1|1151216_1152074_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	57.6	2.0e-68
WP_063153972.1|1152119_1153169_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	51.9	2.8e-104
WP_063153970.1|1153192_1154029_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.3	1.0e-101
WP_063958605.1|1154188_1155919_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	77.0	2.1e-269
WP_063153966.1|1155918_1156977_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.8	1.5e-142
WP_148754468.1|1157444_1157687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063153962.1|1157679_1158375_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	83.0	1.3e-105
WP_063153960.1|1158574_1160965_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	84.9	0.0e+00
WP_063147949.1|1161174_1161381_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	77.8	3.4e-22
WP_080460818.1|1161380_1162238_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	55.3	5.7e-79
WP_063147950.1|1162246_1162795_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	30.3	7.8e-13
WP_063147951.1|1162791_1163016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063147952.1|1163083_1163356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063147953.1|1163376_1163604_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	69.3	5.6e-26
WP_074136366.1|1163779_1164040_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	49.2	2.5e-09
WP_058651712.1|1164052_1164391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063147954.1|1164639_1164939_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	56.6	7.4e-26
WP_148754470.1|1165008_1166031_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	49.8	1.4e-92
WP_017383222.1|1166117_1166528_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_015571238.1|1166524_1166977_-	NfeD family protein	NA	NA	NA	NA	NA
WP_003858941.1|1166973_1167888_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_015571236.1|1168042_1168897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015571235.1|1169039_1169711_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.3	2.7e-23
WP_047051105.1|1169703_1170486_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_045327640.1|1170537_1171392_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_006809829.1|1171450_1172260_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003858933.1|1172240_1172873_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_023315548.1|1172843_1173530_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.1e-32
WP_017383227.1|1173526_1175941_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017383228.1|1176123_1177269_+	porin	NA	NA	NA	NA	NA
WP_015571228.1|1177391_1178462_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_003858922.1|1178546_1179614_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_006809824.1|1179610_1180120_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_047718964.1|1180239_1180962_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256009.1|1180965_1181460_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_017383232.1|1181635_1183021_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	1.5e-44
1186552:1186580	attR	AGGCCCGGTAAGCGCAGCGCCACCGGGCA	NA	NA	NA	NA
>prophage 3
NZ_CP043226	Enterobacter hormaechei strain PG20180049 chromosome, complete genome	4635256	2120218	2127759	4635256		Escherichia_phage(83.33%)	9	NA	NA
WP_047719425.1|2120218_2120896_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.6	1.2e-76
WP_045339618.1|2120934_2121249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384548.1|2121363_2121675_-	YebG family protein	NA	NA	NA	NA	NA
WP_148754489.1|2121784_2122399_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	33.7	3.4e-25
WP_047719426.1|2122443_2123298_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	34.6	5.8e-23
WP_048249541.1|2123299_2123917_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	5.2e-74
WP_148754492.1|2123927_2126366_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.5	1.7e-216
WP_003857424.1|2126496_2126802_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003857421.1|2126904_2127759_-	benzoate transporter	NA	M1I711	Paramecium_bursaria_Chlorella_virus	33.2	8.1e-25
>prophage 4
NZ_CP043226	Enterobacter hormaechei strain PG20180049 chromosome, complete genome	4635256	2677415	2742089	4635256	terminase,protease,holin,head,portal,tRNA,tail	Escherichia_phage(15.38%)	75	NA	NA
WP_015570297.1|2677415_2678297_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_015570296.1|2678490_2680539_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
WP_003859895.1|2680558_2681245_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_006811006.1|2681341_2681839_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_020480541.1|2681971_2683255_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_017693254.1|2683223_2685857_+	PqiB family protein	NA	NA	NA	NA	NA
WP_017693253.1|2685913_2687377_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_003859885.1|2687483_2687723_+	YebV family protein	NA	NA	NA	NA	NA
WP_015570293.1|2687757_2688402_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.9e-55
WP_047719460.1|2688569_2689550_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_017693250.1|2689595_2689793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003859787.1|2689918_2690257_-	YebY family protein	NA	NA	NA	NA	NA
WP_047719459.1|2690273_2691143_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_023296802.1|2691144_2691516_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003859784.1|2691653_2691884_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
WP_003859783.1|2691995_2692646_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_047733794.1|2692670_2693333_+	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_017693247.1|2693314_2695390_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_047719457.1|2695465_2696116_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_047719456.1|2696287_2697466_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003859774.1|2697540_2698182_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_047719454.1|2698221_2700033_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003859771.1|2700266_2701742_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
WP_003859769.1|2702098_2702968_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003859767.1|2703082_2704525_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_015570283.1|2704568_2705540_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_045348798.1|2705657_2706977_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_032103662.1|2706992_2707937_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_023296807.1|2708014_2708770_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	8.8e-15
WP_015570280.1|2708766_2709552_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003859753.1|2709604_2710615_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.4e-07
WP_003859751.1|2710623_2711238_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003859749.1|2711318_2711840_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003859747.1|2711874_2712615_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003859745.1|2712642_2713086_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_017384352.1|2713087_2714860_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015570278.1|2715122_2715689_+	hydrolase	NA	NA	NA	NA	NA
WP_063255217.1|2716053_2716317_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	90.8	2.4e-36
WP_148754506.1|2716358_2716913_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	78.3	3.8e-76
WP_148754508.1|2717043_2717784_+|tail	phage tail protein	tail	G8C7K5	Escherichia_phage	68.0	3.6e-90
WP_032673522.1|2719355_2720033_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	96.4	1.3e-121
WP_058656707.1|2720050_2721325_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	98.8	6.2e-247
WP_058656708.1|2721324_2722839_-|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	99.6	6.8e-293
WP_148754510.1|2722845_2723331_-|terminase	terminase	terminase	Q77WA1	Escherichia_phage	98.1	2.2e-80
WP_059468687.1|2723482_2723719_-	hypothetical protein	NA	K7PHC8	Enterobacterial_phage	96.2	7.4e-37
WP_048209453.1|2723718_2724060_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	99.1	1.6e-64
WP_148754512.1|2724056_2724647_-	hypothetical protein	NA	F1C588	Cronobacter_phage	95.9	3.0e-111
WP_148754514.1|2724628_2726086_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	74.4	6.9e-218
WP_127345315.1|2726097_2726751_-	DUF1983 domain-containing protein	NA	K7PH02	Enterobacteria_phage	85.4	1.2e-36
WP_050597004.1|2726876_2727068_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	88.0	3.9e-20
WP_032659111.1|2727018_2727297_-	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	92.0	6.1e-06
WP_032659116.1|2727293_2727836_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.9	7.0e-75
WP_001514184.1|2727838_2728114_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|2728110_2728512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006811071.1|2729056_2729839_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.4	1.5e-110
WP_032621744.1|2729842_2731714_-	AAA family ATPase	NA	Q5G8S8	Enterobacteria_phage	59.6	1.1e-223
WP_006811073.1|2731821_2732754_-	hypothetical protein	NA	C5IHL2	Burkholderia_virus	37.0	2.2e-36
WP_126519123.1|2732750_2732948_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_048859479.1|2732949_2733165_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	50.0	2.4e-10
WP_032621740.1|2733318_2734011_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	65.4	4.3e-85
WP_032621737.1|2734182_2734476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126519119.1|2734549_2734936_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	60.0	6.4e-38
WP_148754516.1|2735042_2735267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126519117.1|2735259_2735667_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	82.8	1.2e-47
WP_072159686.1|2735638_2735860_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.1e-18
WP_063850003.1|2735856_2736264_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	51.5	6.6e-25
WP_126519113.1|2736263_2736458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045345438.1|2736454_2737282_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.4	2.5e-111
WP_032635099.1|2737327_2738071_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	94.7	4.6e-133
WP_045347095.1|2738073_2738499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045347096.1|2738491_2738737_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	85.5	4.2e-35
WP_148754518.1|2738792_2740106_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	85.8	7.1e-222
WP_048984553.1|2740084_2740858_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.3e-58
WP_003859737.1|2740909_2741305_+	membrane protein	NA	NA	NA	NA	NA
WP_003859735.1|2741345_2742089_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
>prophage 5
NZ_CP043226	Enterobacter hormaechei strain PG20180049 chromosome, complete genome	4635256	2902758	2912005	4635256		Escherichia_phage(25.0%)	9	NA	NA
WP_032103476.1|2902758_2903370_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
WP_047718266.1|2903409_2904390_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_047718268.1|2904582_2905587_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.3	6.6e-34
WP_023294998.1|2905634_2906801_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.6e-111
WP_023294999.1|2907054_2908461_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_148754521.1|2908596_2909145_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	2.4e-54
WP_032682169.1|2909155_2910046_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.3	2.8e-28
WP_023295002.1|2910058_2910925_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	8.3e-110
WP_032103484.1|2910940_2912005_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
>prophage 6
NZ_CP043226	Enterobacter hormaechei strain PG20180049 chromosome, complete genome	4635256	3401058	3501401	4635256	lysis,tRNA,terminase,holin,head,integrase,capsid,plate,portal,tail	Escherichia_phage(27.78%)	110	3476669:3476685	3497977:3497993
WP_032649123.1|3401058_3401796_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_017383554.1|3401928_3403257_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860727.1|3403308_3403692_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_045347547.1|3404007_3404697_+	uracil-DNA glycosylase	NA	A0A0S0DP74	Lymphocryptovirus	50.2	2.1e-55
WP_017383555.1|3404736_3405822_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_032649129.1|3406026_3406446_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_047718866.1|3406516_3407215_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_017692865.1|3407250_3409914_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_026094276.1|3410023_3411379_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003860739.1|3411424_3411748_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_047718868.1|3411744_3413091_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	3.6e-43
WP_039270055.1|3413203_3413656_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	1.7e-34
WP_017692862.1|3419179_3421753_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	6.9e-128
WP_047718511.1|3421882_3422614_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_017383977.1|3422610_3423591_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863164.1|3423722_3424460_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863162.1|3424727_3425069_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100229775.1|3425173_3425221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015571567.1|3425328_3426489_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_017383978.1|3426485_3427358_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_006811631.1|3427418_3428540_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_006811632.1|3428550_3429621_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_032619209.1|3429832_3430207_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_032619208.1|3430360_3430897_+	YfiR family protein	NA	NA	NA	NA	NA
WP_017692859.1|3430889_3432110_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_017382956.1|3432122_3432608_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017382957.1|3432610_3433981_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_047718512.1|3434019_3434424_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_045359356.1|3434668_3435700_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	79.8	1.4e-164
WP_045359358.1|3435702_3436563_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	43.8	2.0e-68
WP_045359360.1|3436682_3436913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045359362.1|3436944_3437454_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	85.8	1.9e-77
WP_072050071.1|3437461_3437662_+	DUF2724 domain-containing protein	NA	A0A218M4I1	Erwinia_phage	75.8	5.7e-22
WP_045359364.1|3437625_3437964_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	75.9	2.4e-41
WP_045359367.1|3438029_3438257_+	DUF2732 family protein	NA	A0A218M4I9	Erwinia_phage	61.3	2.6e-15
WP_045359370.1|3438257_3438539_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	69.9	1.5e-28
WP_048249330.1|3438516_3440910_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	85.8	0.0e+00
WP_049108644.1|3440928_3441156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045359375.1|3441371_3441554_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	70.7	6.5e-17
WP_048249328.1|3441557_3441791_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	1.8e-35
WP_049108645.1|3442490_3443513_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.6	6.0e-168
WP_048249324.1|3443514_3445284_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.9	6.5e-303
WP_059453244.1|3445449_3446304_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	70.1	3.4e-108
WP_039671454.1|3446364_3447438_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	79.3	1.6e-158
WP_059453245.1|3447441_3448203_+|terminase	terminase endonuclease subunit	terminase	A0A218M4L0	Erwinia_phage	66.8	7.3e-78
WP_049108649.1|3448302_3448803_+|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	67.4	1.8e-56
WP_059453246.1|3448802_3449006_+|tail	phage tail protein	tail	Q858W3	Yersinia_virus	82.1	1.6e-24
WP_049108653.1|3449010_3449307_+|holin	holin	holin	O80308	Escherichia_phage	88.8	2.3e-40
WP_049108654.1|3449293_3449791_+	glycoside hydrolase family 104 protein	NA	O80309	Escherichia_phage	91.4	2.4e-85
WP_058658663.1|3449787_3450201_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	68.6	7.1e-43
WP_115877087.1|3450082_3450346_+|holin	holin	holin	S4TNY4	Salmonella_phage	69.8	4.1e-28
WP_039671463.1|3450308_3450776_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	85.8	2.2e-72
WP_039671464.1|3450768_3451218_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	1.8e-47
WP_148754528.1|3451286_3452393_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	79.9	2.4e-90
WP_039671470.1|3452385_3452916_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	85.8	2.6e-90
WP_148754530.1|3452927_3455114_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.0	1.4e-89
WP_039671472.1|3455125_3455530_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	51.1	2.6e-29
WP_063409934.1|3455654_3456845_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	90.2	3.4e-207
WP_063409933.1|3456858_3457377_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	91.3	1.5e-87
WP_058658647.1|3457438_3457714_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	83.5	1.6e-35
WP_039671477.1|3457746_3457866_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	6.7e-15
WP_063409932.1|3457858_3460402_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	70.5	6.2e-222
WP_048249321.1|3460417_3460897_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	84.3	2.6e-73
WP_048249319.1|3460896_3462042_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	78.6	3.8e-155
WP_072050070.1|3462119_3462338_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	80.6	2.1e-30
WP_002914145.1|3462497_3462845_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003863138.1|3462888_3463656_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015571575.1|3463687_3464227_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3464242_3464491_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|3464607_3465969_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014832951.1|3466135_3466927_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026094274.1|3466946_3468233_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003863126.1|3468284_3468878_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_017383004.1|3469000_3469879_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_015571579.1|3469964_3471626_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071524123.1|3471600_3471783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003863121.1|3471764_3472103_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_003863119.1|3472164_3472452_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|3472441_3472918_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|3473035_3473518_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_048249317.1|3474135_3475365_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	85.6	1.1e-205
WP_047718515.1|3475647_3477204_+	recombinase family protein	NA	Q9XJF6	Enterococcus_phage	26.9	8.4e-12
3476669:3476685	attL	TCATTGATGAAGATGAT	NA	NA	NA	NA
WP_047718519.1|3477193_3478090_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_047718520.1|3478086_3478983_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000248204.1|3479110_3479323_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	77.3	2.5e-20
WP_047718521.1|3479479_3481087_-	sporadically distributed, TIGR04141 family protein	NA	NA	NA	NA	NA
WP_001624497.1|3481105_3481741_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_148754532.1|3481737_3482850_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_047718527.1|3482842_3484231_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.5	1.4e-47
WP_047718528.1|3484230_3484503_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_003845893.1|3485556_3486117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549549.1|3486525_3486963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047718530.1|3486931_3488095_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_007666384.1|3488319_3488592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001078959.1|3488633_3489020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708681.1|3489039_3489354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000360018.1|3489404_3489830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062150.1|3489926_3490313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718533.1|3490327_3492202_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_047718536.1|3492198_3493503_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_008322898.1|3493495_3494698_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001019190.1|3494993_3495293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000795663.1|3495313_3495520_-	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
WP_001067212.1|3495799_3496645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023295270.1|3497209_3497449_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	92.4	2.2e-33
WP_023295271.1|3497512_3497875_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	70.0	3.4e-41
WP_023295272.1|3497871_3498786_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.4	1.6e-159
3497977:3497993	attR	ATCATCTTCATCAATGA	NA	NA	NA	NA
WP_047718538.1|3498786_3500259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080346129.1|3500334_3500607_-	hypothetical protein	NA	A0A0F7LDZ0	Escherichia_phage	66.1	3.4e-17
WP_015571649.1|3500795_3501401_-	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	25.7	5.4e-07
