The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043214	Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 chromosome, complete genome	4751368	1618391	1647977	4751368	tail,protease,holin	Salmonella_phage(33.33%)	31	NA	NA
WP_001538284.1|1618391_1618886_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1619299_1619791_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1619780_1620044_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1620040_1622527_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1622533_1623229_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1623215_1624085_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1624200_1624650_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1624659_1625262_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888542.1|1625282_1625900_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.1e-10
WP_000990032.1|1625896_1626556_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000265997.1|1626607_1627345_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1627341_1627554_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1627550_1628030_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982517.1|1628026_1629958_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001531668.1|1629954_1630512_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238312.1|1630508_1631552_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1631595_1632243_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1632972_1633536_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1633727_1633931_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1634233_1635025_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1635321_1635525_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1635693_1638060_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1638388_1639378_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1639392_1639761_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894638.1|1639789_1641121_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_001120499.1|1641417_1641747_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1642339_1643581_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1643583_1644111_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1644488_1644932_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000884778.1|1647155_1647446_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1647473_1647977_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 2
NZ_CP043214	Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 chromosome, complete genome	4751368	1720027	1729198	4751368	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569165.1|1720027_1720975_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824857.1|1720958_1721690_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1721670_1721778_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|1721837_1722569_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1722791_1724477_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1724473_1725193_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1725239_1725707_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1725763_1726294_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1726465_1726924_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1727164_1729198_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP043214	Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 chromosome, complete genome	4751368	1797474	1807980	4751368		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111845.1|1797474_1798878_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
WP_000981469.1|1799055_1799949_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1800325_1801411_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1801410_1802310_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1802357_1803236_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1803236_1803788_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1803793_1804786_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1804782_1805556_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1805560_1806640_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1806666_1807980_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP043214	Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 chromosome, complete genome	4751368	1893974	1904575	4751368		Morganella_phage(25.0%)	12	NA	NA
WP_001219015.1|1893974_1894448_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001683376.1|1895095_1895386_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
WP_000598921.1|1895757_1896555_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500831.1|1897035_1897197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1897323_1897743_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457664.1|1897745_1899014_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000208509.1|1899468_1899681_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1899691_1899880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|1900137_1901334_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107434.1|1901984_1902296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377037.1|1902375_1903071_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157304.1|1903144_1904575_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 5
NZ_CP043214	Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 chromosome, complete genome	4751368	2803698	2880856	4751368	tail,portal,integrase,lysis,transposase,terminase,protease	Salmonella_phage(48.21%)	93	2835893:2835911	2880891:2880909
WP_000938191.1|2803698_2804379_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374046.1|2804999_2805659_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2805745_2806075_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2806071_2806353_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2806401_2807181_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2807206_2807755_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2807969_2809181_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2809238_2809556_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2809600_2810017_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847716.1|2810187_2810850_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2810944_2811403_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2811438_2813493_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2813616_2814063_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2814081_2816235_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2816221_2816827_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2817043_2817553_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2817909_2818962_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2819033_2819486_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2819671_2821432_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2821500_2822019_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2822118_2822286_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2822541_2823105_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2823101_2824742_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2824746_2826000_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2826014_2827922_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2827934_2830043_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2830141_2831251_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2831247_2831790_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2831955_2832966_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2833173_2835786_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
2835893:2835911	attL	GCTACATTTTTATAACATG	NA	NA	NA	NA
WP_071531551.1|2836220_2836718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343758.1|2836714_2837935_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_000388788.1|2838154_2838373_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
WP_000161705.1|2838585_2839308_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143158.1|2839504_2840086_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_031618324.1|2840075_2840396_-	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_001532020.1|2840896_2843272_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_000178849.1|2843325_2843568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077906512.1|2843606_2844482_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.8	2.6e-50
WP_020867839.1|2847028_2847733_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000606356.1|2847630_2848368_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_001152416.1|2848377_2849073_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2849162_2849696_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000410972.1|2849785_2850310_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000978295.1|2850408_2850741_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_065305406.1|2850737_2853725_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_010989009.1|2853804_2854134_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478858.1|2854130_2854529_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132755.1|2854574_2855324_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196703.1|2855335_2855737_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000453192.1|2855733_2856300_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000774239.1|2856280_2856580_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2856572_2856896_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_077906133.1|2856986_2859065_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_077906132.1|2858988_2860506_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	7.5e-175
WP_000196190.1|2860532_2860739_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989238.1|2860735_2862874_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000371784.1|2862830_2863364_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_086010216.1|2863574_2864060_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	80.4	1.1e-58
WP_000301013.1|2864376_2864916_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001682303.1|2864893_2865196_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658038.1|2865398_2865587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001158478.1|2865641_2865830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000508329.1|2865867_2866086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093260.1|2866025_2866217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2866252_2867050_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2867039_2867186_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096547.1|2867182_2867794_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001241019.1|2867796_2868003_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929790.1|2868002_2868605_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2868639_2868888_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2869004_2869238_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877758.1|2869468_2870113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208143.1|2870220_2870622_-	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000224239.1|2870632_2870890_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000215887.1|2870891_2871425_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_023602525.1|2871421_2871823_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000788826.1|2871867_2872569_-	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_031611230.1|2872565_2873471_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.3	7.7e-175
WP_015675517.1|2873562_2873937_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000992434.1|2873902_2874139_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_001230956.1|2874243_2874639_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000439725.1|2874681_2875107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091280.1|2875108_2875543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373338.1|2875569_2875776_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000186242.1|2876063_2876264_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000995352.1|2876354_2876651_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000100830.1|2876656_2877442_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000187054.1|2877438_2878119_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000189634.1|2878115_2878985_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_001682304.1|2878990_2879230_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000065276.1|2879270_2879519_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2879563_2880856_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
2880891:2880909	attR	GCTACATTTTTATAACATG	NA	NA	NA	NA
>prophage 6
NZ_CP043214	Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 chromosome, complete genome	4751368	2952266	2960289	4751368	transposase,protease	Ralstonia_phage(14.29%)	8	NA	NA
WP_001531374.1|2952266_2952644_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
WP_001117984.1|2952805_2953003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|2953276_2953735_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|2953925_2956202_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2956232_2956553_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2956876_2957098_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125890.1|2957227_2959174_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201751.1|2959170_2960289_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 7
NZ_CP043214	Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 chromosome, complete genome	4751368	3564514	3608110	4751368	portal,coat,integrase,lysis,terminase,protease	Enterobacteria_phage(44.62%)	66	3564954:3564999	3604219:3604264
WP_001683918.1|3564514_3564790_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
3564954:3564999	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3565287_3565650_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703640.1|3565646_3566579_+	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000671495.1|3566568_3568026_+	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000129930.1|3568084_3570088_-	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000287064.1|3570223_3570478_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.3	4.4e-19
WP_000749288.1|3570880_3571366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029838.1|3571456_3573454_-	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000246945.1|3573453_3574749_-	DNA injection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_000964902.1|3574758_3575451_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000627697.1|3575453_3575909_-	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000774927.1|3575908_3576610_-	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_001122424.1|3576613_3578032_-	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_001166098.1|3577991_3578492_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_000684729.1|3578475_3578685_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001196938.1|3578723_3580016_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000433852.1|3580015_3580927_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_000774656.1|3580940_3583118_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000417849.1|3583117_3584617_-|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000729925.1|3584594_3585083_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_001278047.1|3585106_3585286_-	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000807785.1|3585287_3585530_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001177703.1|3585832_3586519_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_001682204.1|3586505_3586697_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	95.2	1.1e-27
WP_001531485.1|3586731_3587169_-|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_000074137.1|3587257_3587755_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_000286100.1|3587732_3587936_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_015675486.1|3588075_3588285_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	100.0	6.7e-34
WP_001235453.1|3588374_3588998_-	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000219131.1|3588994_3589174_-	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_000149925.1|3589154_3589358_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000036317.1|3589354_3589579_-	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_001129733.1|3589575_3590187_-	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000950959.1|3590179_3590356_-	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001531428.1|3590348_3590681_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000113772.1|3590683_3590860_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000679702.1|3590826_3591000_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000736921.1|3590996_3591434_-	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_001248406.1|3591507_3592884_-	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000067075.1|3592880_3593696_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001125981.1|3593688_3593835_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424167.1|3593869_3594148_-	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_000276884.1|3594254_3594440_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|3594520_3595171_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000216175.1|3595524_3595827_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001682202.1|3595847_3596426_-	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000213983.1|3596640_3596835_+	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_000651935.1|3596871_3597108_+	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_001737461.1|3597107_3597311_+	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000776964.1|3597458_3597770_+	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_000582314.1|3597855_3598014_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000158027.1|3597994_3598183_+	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000031375.1|3598312_3598930_+	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001253481.1|3598929_3599214_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	97.9	2.6e-44
WP_001111313.1|3599260_3599557_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_001682200.1|3599567_3599732_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_000812182.1|3599728_3600355_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001289978.1|3600351_3600837_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000224223.1|3600838_3601102_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_000208013.1|3601112_3601799_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_001277769.1|3601895_3602075_+	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000016640.1|3602175_3602811_+	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_000051900.1|3603040_3604204_+|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000893221.1|3604409_3605660_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
3604219:3604264	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3605671_3606775_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043660.1|3607057_3608110_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
>prophage 8
NZ_CP043214	Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 chromosome, complete genome	4751368	4349696	4397217	4751368	tail,tRNA,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182224.1|4349696_4350695_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039342.1|4350782_4352093_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4352339_4352855_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4352953_4353163_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4353184_4353298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128112.1|4353294_4354620_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4354798_4355407_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4355515_4355884_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4356054_4358475_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4358573_4359446_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4359459_4359957_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4360137_4361055_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4361218_4362577_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4362665_4363775_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4364136_4365327_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4365458_4367003_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4367017_4367908_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4368073_4368484_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4368626_4370723_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4370722_4371460_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4371456_4372125_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4372158_4372401_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4372844_4374494_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4374838_4376188_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4376320_4376668_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4377243_4377531_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4377533_4378139_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4378151_4378466_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4378625_4379081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4379077_4379275_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4379264_4380692_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907497.1|4380691_4381216_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_001003642.1|4381267_4381585_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4381544_4381673_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4381769_4384124_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271420.1|4384123_4385077_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4385076_4385286_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4385273_4386317_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4386326_4387049_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4387376_4387739_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4387735_4388665_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4388664_4390212_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4390375_4390735_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951734.1|4390725_4391841_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_000359509.1|4391833_4392466_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000368193.1|4392468_4394127_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_001151758.1|4394133_4394748_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084336.1|4394744_4395200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024132246.1|4395580_4395997_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000587739.1|4396575_4397217_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
>prophage 1
NZ_CP043215	Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.1-IncAC2, complete sequence	165649	81962	119988	165649	integrase,transposase	Escherichia_phage(38.46%)	48	110838:110853	122994:123009
WP_000844627.1|81962_82205_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|82236_82914_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|82992_84192_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|84458_84764_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214119.1|84791_86006_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_001447541.1|86222_87107_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|87137_88631_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|88841_89066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|89062_89800_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001550559.1|89906_90398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|90431_91136_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|91686_92391_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001102700.1|92490_92715_+	2Fe-2S ferredoxin-like protein	NA	NA	NA	NA	NA
WP_000026577.1|92776_93166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176699.1|93155_93608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000164429.1|93588_93888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651508.1|93945_94137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337696.1|94181_94559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000209093.1|94750_95095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410925.1|95172_95475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201432.1|95552_97178_+	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
WP_015058950.1|97193_97670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093867.1|97743_98298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042274.1|98530_98917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001187969.1|99004_101458_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000050847.1|101659_101863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|101934_102540_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000184110.1|102532_102802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|102815_103034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064432.1|103107_103665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|103739_104591_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_001077336.1|105049_105436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122922.1|105613_107341_+	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|107327_107606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714163.1|107678_107900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427619.1|108081_109086_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|109164_112137_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
110838:110853	attL	GCGCATCGGCGGGCAC	NA	NA	NA	NA
WP_001162012.1|112139_112697_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001447826.1|112734_113058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|113002_114016_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000777554.1|114172_114646_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_000706306.1|114739_115219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000679427.1|115349_115697_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|115690_116530_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|116459_116639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|116657_117158_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|117692_118475_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|118464_119988_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
122994:123009	attR	GCGCATCGGCGGGCAC	NA	NA	NA	NA
