The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043181	Escherichia coli O2:H6 strain PG20180057 chromosome, complete genome	5044633	596010	603745	5044633		Enterobacteria_phage(33.33%)	8	NA	NA
WP_001033088.1|596010_597117_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.9	2.7e-44
WP_001219875.1|597109_597577_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001350333.1|597563_597974_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000857505.1|597991_598867_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.0e-107
WP_001023616.1|598925_599825_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000699401.1|599824_600910_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.7e-99
WP_000183037.1|601282_602176_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	5.1e-46
WP_001115964.1|602350_603745_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	3.7e-19
>prophage 2
NZ_CP043181	Escherichia coli O2:H6 strain PG20180057 chromosome, complete genome	5044633	693807	703252	5044633		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292758.1|693807_694944_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	2.5e-162
WP_001337891.1|694940_696944_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001296231.1|697068_697530_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|697570_698041_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|698087_698807_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|698803_700489_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240405.1|700710_701442_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001216963.1|701501_701609_+	protein YohO	NA	NA	NA	NA	NA
WP_000783108.1|701589_702321_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569376.1|702325_703252_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	3.3e-08
>prophage 3
NZ_CP043181	Escherichia coli O2:H6 strain PG20180057 chromosome, complete genome	5044633	1143363	1232933	5044633	tRNA,tail,head,capsid,plate,holin,integrase,portal,transposase,terminase	Enterobacteria_phage(65.62%)	107	1154499:1154515	1236600:1236616
WP_001298403.1|1143363_1143900_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190644.1|1143924_1144560_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001350304.1|1144768_1145617_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001196297.1|1145672_1145933_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
WP_000128777.1|1146126_1146207_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986038.1|1146627_1147008_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001350303.1|1147007_1147739_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399404.1|1147750_1148479_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020737.1|1148490_1149396_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|1149392_1150073_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1150344_1151319_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790169.1|1151334_1153134_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589057.1|1153330_1153810_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812041.1|1153806_1154763_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
1154499:1154515	attL	CATTGCCGCGCTGTACC	NA	NA	NA	NA
WP_001168459.1|1154762_1155413_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_052920831.1|1155445_1156021_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|1156017_1156173_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001094477.1|1156428_1158051_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001350302.1|1158035_1158773_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1158904_1160239_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001518797.1|1160271_1161153_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189223.1|1161255_1161843_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1161897_1162281_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|1162585_1163275_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997384.1|1163322_1164360_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1164566_1164986_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001350301.1|1165054_1165753_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082947.1|1165784_1168445_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1168558_1169914_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|1169959_1170283_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001350300.1|1170279_1171578_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_001331828.1|1171686_1171947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024186649.1|1172878_1173106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|1173425_1174448_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001317493.1|1174444_1175227_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_148885869.1|1182015_1184589_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040136.1|1184718_1185450_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079112.1|1185446_1186427_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1186561_1187299_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1187569_1187911_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000215756.1|1188061_1188868_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_001353016.1|1188812_1189010_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001519189.1|1189202_1189499_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_000078916.1|1189634_1189775_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_071531535.1|1189780_1189969_+	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	61.9	5.3e-06
WP_047088188.1|1189965_1190226_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|1190268_1191378_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005367.1|1191535_1192720_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
WP_000290450.1|1192719_1193232_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|1193286_1193652_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|1193687_1193816_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_148880048.1|1193802_1196610_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	99.5	0.0e+00
WP_000979945.1|1196622_1197111_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_001165544.1|1197137_1197737_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
WP_148880049.1|1197807_1198236_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	55.6	5.8e-40
WP_097292480.1|1198246_1198678_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	59.6	2.3e-44
WP_148880051.1|1198688_1199147_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	53.1	1.5e-38
WP_089706663.1|1199146_1199758_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.5	1.0e-82
WP_148880050.1|1199764_1200241_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.6	4.6e-46
WP_096859101.1|1200251_1200746_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	58.5	3.8e-43
WP_148885871.1|1200756_1202364_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	55.8	3.0e-137
WP_000071724.1|1202360_1202969_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_148880053.1|1202961_1203858_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	3.0e-155
WP_000213447.1|1203861_1204212_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_107200155.1|1204208_1204790_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.6e-101
WP_023151575.1|1204786_1205422_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_000920594.1|1205414_1205882_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_072005442.1|1205868_1206048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107200154.1|1206019_1206415_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	91.9	2.0e-58
WP_032152536.1|1206411_1206957_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	87.7	2.2e-92
WP_000104344.1|1207011_1207335_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	92.5	4.8e-47
WP_000864897.1|1207337_1207538_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_148880054.1|1207537_1208032_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.0e-88
WP_111990542.1|1208135_1208936_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.7	8.4e-125
WP_001055107.1|1208981_1210034_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	3.9e-194
WP_148880055.1|1210057_1210894_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	1.9e-148
WP_148880056.1|1211047_1212799_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087812.1|1212798_1213845_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001519213.1|1214329_1214737_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	90.0	3.4e-21
WP_054192285.1|1214733_1215066_-	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	95.5	1.2e-53
WP_000211255.1|1215129_1215441_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	1.9e-48
WP_096860751.1|1215445_1216405_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.4e-179
WP_148880057.1|1216481_1219307_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.7	0.0e+00
WP_000564227.1|1219303_1219693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013452.1|1219765_1219996_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	89.5	3.6e-28
WP_023140813.1|1220363_1221194_-	SPFH/Band 7/PHB domain protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.6	3.3e-132
WP_001036813.1|1221190_1221394_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_000991530.1|1221405_1221705_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	1.5e-39
WP_000153674.1|1221701_1221947_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000985161.1|1221943_1222147_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000021656.1|1222233_1222347_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514277.1|1222343_1222586_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159462.1|1222597_1222876_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000813365.1|1222886_1223228_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_001001394.1|1223246_1223573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001242988.1|1223668_1223971_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_000974887.1|1224037_1225027_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_001386991.1|1225194_1225242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200124.1|1225340_1226501_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_148885873.1|1226543_1227665_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_148885874.1|1227675_1228746_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	3.4e-89
WP_001298694.1|1228955_1229321_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|1229467_1229986_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969007.1|1229975_1231202_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|1231217_1231700_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1231776_1232124_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1232165_1232933_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
1236600:1236616	attR	CATTGCCGCGCTGTACC	NA	NA	NA	NA
>prophage 4
NZ_CP043181	Escherichia coli O2:H6 strain PG20180057 chromosome, complete genome	5044633	1316328	1323468	5044633		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|1316328_1318890_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141289.1|1318995_1319652_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_001298167.1|1319702_1320470_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_000847998.1|1320665_1321574_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_148885880.1|1321570_1322833_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
WP_001279001.1|1322829_1323468_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 5
NZ_CP043181	Escherichia coli O2:H6 strain PG20180057 chromosome, complete genome	5044633	1560918	1614253	5044633	tRNA,transposase,integrase,protease	Staphylococcus_phage(20.0%)	42	1584942:1584957	1610474:1610489
WP_148885886.1|1560918_1561677_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000105562.1|1561880_1562801_-	agmatinase	NA	NA	NA	NA	NA
WP_000758887.1|1562936_1563668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|1563813_1565790_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|1565798_1565930_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001062128.1|1566584_1567739_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|1568175_1569570_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_000858396.1|1569646_1570144_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001305312.1|1570238_1570946_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|1571025_1571757_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593259.1|1571769_1572720_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|1572828_1573392_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|1573391_1573808_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001305314.1|1573981_1574962_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997807.1|1574979_1575684_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|1575701_1576268_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|1576264_1576555_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|1576562_1577156_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239956.1|1577148_1578285_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745227.1|1578349_1579357_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394107.1|1579473_1580520_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|1580695_1581415_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107565.1|1581598_1581925_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786915.1|1581924_1582644_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001298265.1|1582804_1583857_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|1583884_1584160_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|1584224_1585304_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
1584942:1584957	attL	ACCGCCGGGAAAGATG	NA	NA	NA	NA
WP_001298251.1|1585505_1586762_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000839787.1|1586810_1588946_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234491.1|1589344_1590052_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218890.1|1590430_1591693_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.3	6.9e-81
WP_000842052.1|1592674_1593511_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000335052.1|1594576_1594834_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001282135.1|1596628_1597018_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	86.8	3.1e-56
WP_001021067.1|1599287_1599797_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001021366.1|1599818_1600301_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_148885888.1|1600421_1606982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350121.1|1607189_1608437_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000835431.1|1608497_1610645_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.9	3.2e-22
1610474:1610489	attR	ACCGCCGGGAAAGATG	NA	NA	NA	NA
WP_000823710.1|1610669_1611914_-	TolC family protein	NA	NA	NA	NA	NA
WP_001350119.1|1611972_1612275_-	PbsX family transcriptional regulator	NA	NA	NA	NA	NA
WP_000255944.1|1613230_1614253_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 6
NZ_CP043181	Escherichia coli O2:H6 strain PG20180057 chromosome, complete genome	5044633	2919708	2962724	5044633	tRNA,tail,lysis,protease,integrase,portal,terminase	Enterobacteria_phage(61.82%)	60	2914280:2914295	2971603:2971618
2914280:2914295	attL	CGCAACGTCAGCAAGT	NA	NA	NA	NA
WP_001093916.1|2919708_2919990_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_023145273.1|2920026_2920599_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	5.5e-110
WP_023145274.1|2920598_2921339_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	77.6	1.3e-76
WP_000212745.1|2921342_2921630_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	98.9	3.5e-49
WP_021529121.1|2921631_2922417_-	ead/Ea22-like family protein	NA	A0A2R2Z312	Escherichia_phage	76.1	8.0e-104
WP_000476209.1|2922403_2922652_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	94.8	5.5e-35
WP_000111289.1|2922644_2922848_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_001242718.1|2922844_2923207_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_000008177.1|2923197_2923734_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
WP_000081270.1|2923862_2924687_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000135680.1|2924752_2925115_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_032293128.1|2925503_2925758_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	92.3	8.8e-12
WP_001345148.1|2925837_2926530_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_023141118.1|2926503_2926656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191669.1|2926627_2926888_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000515849.1|2926880_2927432_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	100.0	2.6e-101
WP_023145337.1|2927428_2928580_+	phage regulatory protein, Rha family	NA	K7PLX4	Enterobacteria_phage	99.5	3.1e-213
WP_000620698.1|2928576_2928801_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_021527492.1|2928797_2929616_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
WP_001305611.1|2929612_2930107_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_021551567.1|2930106_2930760_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	4.3e-127
WP_000210170.1|2930756_2931083_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001402832.1|2931079_2931469_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	4.6e-68
WP_001061380.1|2931488_2932298_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
WP_021538841.1|2932305_2933295_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001204819.1|2933312_2933678_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_001038608.1|2933762_2934209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|2934480_2934684_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|2934834_2935887_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|2935954_2936170_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_029404484.1|2936174_2936489_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	97.1	5.4e-51
WP_001274714.1|2936544_2937078_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_122632647.1|2937099_2937291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175967.1|2937294_2937501_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	2.0e-30
WP_032144328.1|2937958_2938159_+	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	90.9	3.9e-31
WP_000349509.1|2938317_2938809_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934130.1|2938808_2940911_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
WP_001072975.1|2940907_2941120_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072134767.1|2941047_2942628_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001136583.1|2942572_2944600_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|2944686_2945010_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|2945002_2945278_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|2945289_2945868_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_032165709.1|2945864_2946266_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	3.2e-72
WP_000211128.1|2946276_2947020_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298500.1|2947080_2947467_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|2947475_2947805_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372033.1|2947776_2950833_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	97.6	0.0e+00
WP_000447253.1|2950832_2951162_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152385.1|2951171_2951870_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_039722397.1|2951874_2952618_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	1.1e-150
WP_021538849.1|2952515_2953163_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	9.5e-111
WP_097745615.1|2953223_2956703_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_029404498.1|2956770_2957370_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.0	1.4e-103
WP_148885940.1|2957434_2959498_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.0	1.5e-125
WP_000654175.1|2959494_2959773_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	9.9e-25
WP_021538853.1|2959785_2960073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217553.1|2960190_2960439_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000332269.1|2960500_2961598_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543841.1|2961686_2962724_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2971603:2971618	attR	ACTTGCTGACGTTGCG	NA	NA	NA	NA
>prophage 7
NZ_CP043181	Escherichia coli O2:H6 strain PG20180057 chromosome, complete genome	5044633	3316325	3393512	5044633	tRNA,tail,lysis,protease,holin,integrase,portal,terminase	Enterobacteria_phage(46.43%)	89	3316076:3316095	3361200:3361219
3316076:3316095	attL	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
WP_001218287.1|3316325_3317540_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653746.1|3317915_3318911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001061363.1|3319284_3319479_-	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	93.8	2.5e-30
WP_000206728.1|3319478_3320099_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.6	1.2e-118
WP_001242728.1|3320098_3320461_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
WP_000008232.1|3320451_3320988_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081256.1|3321115_3321940_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000135680.1|3322005_3322368_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000500990.1|3322836_3323349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298691.1|3323664_3324357_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	7.3e-125
WP_071587574.1|3324330_3324483_+	amino acid permease	NA	NA	NA	NA	NA
WP_001191672.1|3324454_3324715_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	9.3e-41
WP_000515840.1|3324707_3325259_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
WP_001087311.1|3325255_3326092_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	92.4	1.1e-138
WP_024179079.1|3326096_3326321_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
WP_000061519.1|3326317_3327136_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_001315196.1|3327132_3327627_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_000066917.1|3327626_3328280_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210180.1|3328276_3328603_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
WP_000767113.1|3328599_3328989_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061422.1|3329008_3329851_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
WP_001540821.1|3329858_3330848_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001205460.1|3330865_3331207_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|3331219_3331768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148885957.1|3331754_3332681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917727.1|3332945_3333149_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
WP_000799673.1|3333299_3334352_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
WP_001120490.1|3334428_3334755_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_001197768.1|3334758_3335235_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
WP_001298489.1|3335231_3335675_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	93.9	1.5e-70
WP_000084843.1|3335713_3336088_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	87.9	2.5e-55
WP_001205132.1|3336186_3336369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001335599.1|3336367_3336568_+	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	93.9	2.3e-31
WP_000373423.1|3336726_3337221_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000934116.1|3337220_3339323_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|3339319_3339532_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072134767.1|3339459_3341040_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001136583.1|3340984_3343012_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|3343098_3343422_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|3343414_3343690_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|3343701_3344280_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_032165709.1|3344276_3344678_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	3.2e-72
WP_000211128.1|3344688_3345432_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298500.1|3345492_3345879_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|3345887_3346217_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_019842932.1|3346188_3349254_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|3349253_3349583_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152410.1|3349592_3350291_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.9e-133
WP_000194752.1|3350296_3351040_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.2e-151
WP_032143682.1|3350937_3351585_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	3.0e-112
WP_148885959.1|3351645_3355128_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_148885961.1|3355186_3357247_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	54.9	8.8e-126
WP_021512830.1|3357243_3357522_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	5.8e-25
WP_000355361.1|3357534_3357828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000050924.1|3358303_3360187_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000415965.1|3360404_3360632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217549.1|3360689_3360938_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	4.1e-38
WP_000202563.1|3361157_3362744_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
3361200:3361219	attR	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
WP_001295748.1|3363136_3363742_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3363868_3364030_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001298490.1|3364151_3365225_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563047.1|3365221_3366001_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088368.1|3366217_3367081_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143206.1|3367052_3368603_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|3368860_3369640_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477811.1|3369717_3371040_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_000816471.1|3371091_3372315_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224879.1|3372371_3373091_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001293112.1|3373257_3374589_+	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000105870.1|3374589_3375606_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124608.1|3375633_3376278_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132964.1|3376383_3377352_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|3377400_3378783_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093834.1|3378803_3380036_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001298496.1|3380127_3380460_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000007436.1|3380461_3380746_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000046741.1|3380801_3382469_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.5	1.3e-39
WP_000409427.1|3382675_3384613_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068677.1|3384702_3385029_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001350367.1|3385101_3385629_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000942350.1|3385680_3386328_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371658.1|3386324_3387194_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|3387404_3387878_+	protein CreA	NA	NA	NA	NA	NA
WP_001188687.1|3387890_3388580_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219580.1|3388579_3390004_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	2.5e-10
WP_000920356.1|3390061_3391414_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3391473_3392190_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001295754.1|3392285_3392426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223197.1|3392825_3393512_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP043181	Escherichia coli O2:H6 strain PG20180057 chromosome, complete genome	5044633	4229877	4306997	5044633	head,tail,lysis,capsid,protease,integrase,portal,plate,terminase	Salmonella_phage(64.81%)	84	4229777:4229803	4265023:4265049
4229777:4229803	attL	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290937.1|4229877_4230930_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000102108.1|4231009_4232341_-	NTPase	NA	R9TRQ8	Vibrio_phage	27.1	3.2e-20
WP_148886008.1|4232354_4232537_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	54.2	1.6e-07
WP_001350184.1|4232552_4233122_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_000188450.1|4233267_4233471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460900.1|4233535_4234045_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	2.9e-86
WP_001350183.1|4234052_4234286_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	86.1	5.2e-11
WP_000166365.1|4234233_4234692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085961902.1|4234885_4235152_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	83.3	1.1e-15
WP_000996717.1|4235269_4235611_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244228.1|4235678_4235912_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|4235911_4236139_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104133.1|4236135_4236993_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	2.1e-158
WP_000017610.1|4236989_4239404_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
WP_001154434.1|4239557_4239746_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|4239756_4239990_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000552033.1|4240311_4242204_+	NTPase KAP	NA	NA	NA	NA	NA
WP_000885505.1|4242727_4243399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520388.1|4243451_4244501_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.9	6.4e-173
WP_001098443.1|4244500_4246267_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216237.1|4246409_4247243_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742511.1|4247259_4248318_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059209.1|4248321_4248972_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.9e-111
WP_000673509.1|4249067_4249532_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.7	2.7e-75
WP_000868175.1|4249531_4249735_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4249738_4249954_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069913.1|4249934_4250447_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	2.4e-88
WP_000730951.1|4250448_4250826_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	1.8e-16
WP_001080919.1|4250822_4251251_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	1.7e-47
WP_001177676.1|4251180_4251384_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	74.6	2.0e-22
WP_001039944.1|4251346_4251778_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_000829132.1|4251770_4252223_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.8	5.9e-59
WP_000833215.1|4252258_4253011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993764.1|4253103_4253682_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_000177590.1|4253678_4254038_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268277.1|4254024_4254933_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	3.5e-143
WP_000104751.1|4255526_4257074_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.6	3.0e-195
WP_001001157.1|4257073_4257676_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	85.9	9.8e-94
WP_000046111.1|4257811_4258984_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	88.5	5.6e-202
WP_001207656.1|4258993_4259509_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001281016.1|4259563_4259866_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_000763311.1|4259880_4260000_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282737.1|4259992_4263070_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.6	0.0e+00
WP_000980395.1|4263066_4263552_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_001011776.1|4263548_4264649_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	7.6e-177
WP_000972391.1|4264739_4264958_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|4265195_4266881_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
4265023:4265049	attR	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681104.1|4267150_4267528_+	membrane protein	NA	NA	NA	NA	NA
WP_001195231.1|4267557_4267815_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201570.1|4267974_4268262_+	YbjC family protein	NA	NA	NA	NA	NA
WP_000189176.1|4268245_4268968_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4269028_4269931_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4270018_4270495_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|4270844_4271957_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|4272051_4273185_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105432.1|4273194_4274148_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|4274144_4274990_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4275049_4275538_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149693.1|4275578_4276706_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	7.9e-28
WP_001295905.1|4276734_4277466_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|4277690_4278359_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001692.1|4278358_4279075_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756578.1|4279081_4279813_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|4279830_4280559_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001295906.1|4280776_4281292_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4281417_4281741_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255185.1|4281737_4282568_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001305933.1|4282564_4283578_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136523.1|4283676_4285107_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566398.1|4285117_4286119_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815373.1|4286155_4287874_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000178690.1|4288006_4288975_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458845.1|4288986_4290639_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|4290782_4291682_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|4292002_4292698_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|4293123_4294782_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001400542.1|4294778_4295735_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746478.1|4295885_4297001_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188133.1|4296997_4298944_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4299016_4299241_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4299563_4299884_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4299914_4302191_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097883.1|4302783_4303767_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	3.4e-43
WP_001101561.1|4303763_4306997_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.1	1.3e-83
>prophage 9
NZ_CP043181	Escherichia coli O2:H6 strain PG20180057 chromosome, complete genome	5044633	4608963	4712544	5044633	tRNA,tail,head,lysis,capsid,holin,integrase,portal,terminase	Enterobacteria_phage(42.86%)	126	4637946:4637962	4695997:4696013
WP_148886029.1|4608963_4610082_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	4.5e-84
WP_000003742.1|4610050_4610320_-	excisionase	NA	NA	NA	NA	NA
WP_148886030.1|4610381_4612820_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.8	5.9e-113
WP_148886032.1|4612913_4613105_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854564.1|4613101_4613290_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_148886034.1|4613805_4614321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053099141.1|4614434_4614587_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_148886036.1|4614906_4615383_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_032223163.1|4615508_4615832_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	8.0e-10
WP_034173003.1|4615815_4616241_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_135247427.1|4616276_4616471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344866.1|4616475_4616871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205825.1|4616950_4618036_+	DNA-binding protein	NA	V5URT9	Shigella_phage	60.2	7.2e-111
WP_148886038.1|4618076_4618508_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.6	2.3e-60
WP_148886040.1|4618831_4619071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148886041.1|4619073_4619670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148886043.1|4619893_4621618_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_148886045.1|4621855_4621963_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	1.9e-08
WP_000935258.1|4622007_4622220_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_001341173.1|4622386_4622659_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
WP_148886047.1|4622660_4623710_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	7.7e-110
WP_148886048.1|4623722_4624097_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	9.0e-37
WP_034173000.1|4624093_4624915_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	4.6e-78
WP_000917768.1|4625141_4625339_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_148886050.1|4625488_4626547_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	93.5	2.2e-197
WP_148886052.1|4628686_4630645_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	67.7	5.2e-261
WP_148886054.1|4630808_4630985_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	62.3	5.2e-11
WP_148886056.1|4631010_4631316_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000284510.1|4631393_4631609_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_148886058.1|4631613_4632147_+	glycoside hydrolase family protein	NA	A0A088CC28	Shigella_phage	94.9	1.2e-98
WP_148886060.1|4632445_4632913_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	89.0	2.9e-69
WP_034172990.1|4633359_4633869_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	34.5	1.5e-13
WP_148886061.1|4633840_4635769_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	8.8e-261
WP_148886063.1|4635752_4635959_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	53.8	3.3e-09
WP_148886065.1|4635955_4637548_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_148886066.1|4637537_4639043_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.4	9.3e-101
4637946:4637962	attL	TTTGACTGCGCTGACAT	NA	NA	NA	NA
WP_148886068.1|4639079_4639427_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	2.2e-21
WP_148886070.1|4639484_4640513_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	6.6e-114
WP_053265031.1|4640564_4640948_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_034172983.1|4640940_4641294_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_148886072.1|4641308_4641887_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	88.0	5.6e-70
WP_034172981.1|4641883_4642279_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	5.7e-58
WP_034172980.1|4642286_4643036_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.8	1.3e-130
WP_034172979.1|4643055_4643487_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	69.4	2.5e-43
WP_049590271.1|4643513_4643927_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	86.9	8.4e-44
WP_148886074.1|4643907_4646490_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.4	0.0e+00
WP_148886075.1|4646486_4646816_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	79.8	1.1e-46
WP_148886077.1|4647049_4648213_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	5.5e-141
WP_148886079.1|4648418_4649117_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	89.7	9.3e-120
WP_034173014.1|4649122_4649866_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.1	4.0e-145
WP_072019665.1|4649763_4650402_+|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	97.8	1.6e-94
WP_148886081.1|4650647_4654124_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	86.9	0.0e+00
WP_000078852.1|4654320_4654461_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_148886083.1|4654602_4655982_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	73.9	9.1e-103
WP_042022542.1|4655991_4656216_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_148886085.1|4656212_4656887_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	77.3	4.8e-97
WP_000799399.1|4657526_4658390_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531578.1|4658373_4659510_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|4659759_4660986_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|4661034_4662156_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|4662231_4663692_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4663691_4664363_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|4664532_4665903_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001295971.1|4665906_4666548_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001298466.1|4666583_4667690_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4667743_4668205_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248679.1|4668214_4668868_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4669039_4670290_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741333.1|4670403_4671546_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.7	1.4e-205
WP_000088653.1|4671535_4671772_-	excisionase	NA	NA	NA	NA	NA
WP_000488402.1|4671911_4672151_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	92.4	2.0e-37
WP_000763364.1|4672198_4672417_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000151206.1|4672515_4672731_-	hypothetical protein	NA	M1FPM2	Enterobacteria_phage	97.2	6.5e-32
WP_000581109.1|4672738_4673491_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	100.0	6.4e-151
WP_000682312.1|4673487_4673646_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	98.1	1.5e-22
WP_000186789.1|4673642_4674323_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	7.9e-132
WP_001350280.1|4674319_4675105_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	99.6	3.1e-148
WP_000995418.1|4675110_4675407_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|4675483_4675690_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_072612786.1|4676277_4677882_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	1.2e-93
WP_000712399.1|4677992_4678685_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_000184665.1|4678795_4679023_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182872.1|4679053_4679593_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	5.2e-62
WP_148886119.1|4679679_4680609_+	replication protein	NA	M1FN81	Enterobacteria_phage	68.1	4.0e-110
WP_000788854.1|4680605_4681307_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	5.4e-128
WP_021580677.1|4681303_4681606_+	phage exclusion protein Ren	NA	A0A0N6WES4	Escherichia_phage	94.6	7.5e-42
WP_001070442.1|4681673_4682006_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032341026.1|4682054_4682204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524011.1|4682261_4683788_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	30.8	2.7e-31
WP_115785030.1|4684137_4685181_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072093903.1|4685530_4685632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|4685628_4686084_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|4686083_4686254_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774478.1|4686246_4686537_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	6.7e-48
WP_021540904.1|4686533_4686896_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	93.2	6.2e-59
WP_001568558.1|4686892_4687033_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	1.3e-09
WP_024241115.1|4687029_4687719_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	1.9e-56
WP_000544528.1|4688040_4688346_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_033556682.1|4688332_4688809_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	1.9e-84
WP_001228695.1|4689025_4689208_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|4689298_4689592_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|4690072_4690399_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_032157928.1|4690521_4690875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337542.1|4690762_4691083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000867489.1|4691349_4691895_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	1.2e-79
WP_042024084.1|4691869_4693795_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.3	0.0e+00
WP_042024082.1|4693791_4693998_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_032358757.1|4693994_4695596_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000123275.1|4695576_4696896_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	1.0e-231
4695997:4696013	attR	TTTGACTGCGCTGACAT	NA	NA	NA	NA
WP_001298472.1|4696905_4697238_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
WP_000063225.1|4697293_4698319_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	6.9e-188
WP_000158869.1|4698360_4698756_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752960.1|4698767_4699121_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000985116.1|4699132_4699711_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000683140.1|4699707_4700103_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	4.2e-69
WP_001298481.1|4700110_4700851_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.6e-128
WP_000479168.1|4700866_4701289_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	1.2e-69
WP_000459484.1|4701270_4701705_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	5.0e-63
WP_000840199.1|4701697_4704265_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.5	0.0e+00
WP_041983119.1|4704261_4704591_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	1.1e-57
WP_001152619.1|4704590_4705289_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_001519691.1|4705294_4706038_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090917.1|4705974_4706607_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_148886086.1|4706667_4710150_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_021518115.1|4710208_4712269_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
WP_000654168.1|4712265_4712544_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
