The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043185	Escherichia coli O16:H48 strain PG20180171 chromosome, complete genome	4593846	124334	165152	4593846	tail,lysis,tRNA,integrase,transposase	Escherichia_phage(43.75%)	46	125481:125499	155856:155874
WP_010723085.1|124334_125351_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
125481:125499	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|125623_125881_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|125930_126881_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|127032_127785_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|127979_128495_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|128505_130032_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|130068_131514_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|131513_132824_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|132999_133908_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|134237_134801_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|134821_136054_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|136308_137292_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|137769_139143_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|139271_140207_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|140258_141494_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|141495_141711_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|141789_141999_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|141991_142186_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|142242_143052_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|143044_145645_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|145746_146022_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|146096_146267_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|146266_146488_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|146929_147418_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|147414_147570_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|147580_147715_-	phage protein	NA	NA	NA	NA	NA
WP_000948459.1|148023_148500_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|148623_148920_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|148942_149365_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|149377_150235_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|150241_150988_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|151010_151571_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|151658_151844_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|152040_153498_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|153635_153899_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|153879_154239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|154346_154547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|156004_156985_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
155856:155874	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_089418980.1|157027_157243_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
WP_000279097.1|157307_160670_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000885611.1|160669_161245_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086525.1|161342_161933_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|162249_162483_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|162551_162665_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|163443_163878_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|164018_165152_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 2
NZ_CP043185	Escherichia coli O16:H48 strain PG20180171 chromosome, complete genome	4593846	359047	378258	4593846	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|359047_360508_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|360596_361880_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|362484_362598_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|362666_362900_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086525.1|363216_363807_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|363904_364480_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|364479_365442_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|365392_365962_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|366350_366584_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|366641_367052_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|367203_367377_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|367548_367704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|367782_367848_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|367850_368039_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|368049_368262_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|368624_369122_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|369118_369652_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|369648_369960_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|369964_370180_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|370933_371149_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|371449_371662_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|371716_371806_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|372083_372836_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|372849_373899_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|373900_374179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|374245_374497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|374713_374869_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|374940_375228_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|375227_375467_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|375491_375797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|375999_376332_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|376768_376918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|377214_377445_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|377528_377936_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|378102_378258_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 3
NZ_CP043185	Escherichia coli O16:H48 strain PG20180171 chromosome, complete genome	4593846	1197440	1209911	4593846	tail,transposase,integrase	Enterobacteria_phage(43.75%)	17	1195415:1195431	1213586:1213602
1195415:1195431	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|1197440_1198373_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|1198684_1199842_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|1199994_1200357_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_085947771.1|1200505_1201667_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001030215.1|1202531_1203863_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|1203897_1204179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|1204477_1204918_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|1204944_1205463_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|1205512_1205788_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|1205787_1206282_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|1206278_1206647_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|1207004_1207367_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|1207432_1208257_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|1208384_1208921_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|1208911_1209274_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|1209273_1209579_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|1209710_1209911_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
1213586:1213602	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 4
NZ_CP043185	Escherichia coli O16:H48 strain PG20180171 chromosome, complete genome	4593846	1583697	1590836	4593846		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|1583697_1586259_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|1586364_1587021_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|1587071_1587839_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|1588034_1588943_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|1588939_1590106_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|1590197_1590836_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 5
NZ_CP043185	Escherichia coli O16:H48 strain PG20180171 chromosome, complete genome	4593846	2199026	2206252	4593846		Streptococcus_phage(33.33%)	9	NA	NA
WP_069106888.1|2199026_2199821_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	99.2	1.1e-153
WP_046835546.1|2199885_2200602_-	hypothetical protein	NA	A0A1I9LJQ6	Stx_converting_phage	100.0	5.4e-139
WP_148871284.1|2200771_2201863_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.1e-13
WP_000124700.1|2201933_2204048_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138045.1|2204075_2204615_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2204711_2205086_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|2205211_2205499_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|2205506_2205866_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|2205865_2206252_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 6
NZ_CP043185	Escherichia coli O16:H48 strain PG20180171 chromosome, complete genome	4593846	3620610	3681245	4593846	transposase,integrase	Acinetobacter_phage(28.57%)	57	3630432:3630447	3687627:3687642
WP_000006255.1|3620610_3621108_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|3621331_3623071_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|3623030_3623801_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|3623871_3624927_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|3624978_3625272_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|3625274_3625673_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|3625682_3626135_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|3626440_3626707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|3626639_3627176_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|3627232_3628690_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|3628950_3629409_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|3629500_3630745_+	esterase FrsA	NA	NA	NA	NA	NA
3630432:3630447	attL	AACAGGTGCCGGAAAT	NA	NA	NA	NA
WP_072647358.1|3630802_3631132_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_001102108.1|3633018_3633738_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3634264_3635119_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|3635344_3636670_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3636778_3637015_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3637026_3637620_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_085947771.1|3638892_3640055_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000020224.1|3640101_3640989_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|3642103_3642205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3642568_3642832_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3642831_3642972_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3643006_3643234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3644057_3644600_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3644674_3645262_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3645319_3645988_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3646013_3648539_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3648528_3650172_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3650140_3650851_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3651163_3651493_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3651740_3652355_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3652772_3653462_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3653458_3654415_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|3654411_3656610_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3656619_3657576_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111342.1|3657554_3657965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|3658249_3659650_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|3659766_3660207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|3660203_3660428_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072039.1|3660546_3661401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214248.1|3661427_3662126_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|3662397_3663024_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|3663114_3663846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281825.1|3665040_3666045_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001121657.1|3666183_3666942_+	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_000406871.1|3666946_3668557_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_000192863.1|3668568_3669951_-	MFS transporter	NA	NA	NA	NA	NA
WP_000151261.1|3670177_3672145_-	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_001136613.1|3672159_3673068_-	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_010723086.1|3673362_3674517_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001030800.1|3674610_3674961_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000015532.1|3674983_3675322_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_000192349.1|3676543_3677590_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000081352.1|3677698_3678631_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001393629.1|3678617_3680021_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_010723085.1|3680228_3681245_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
3687627:3687642	attR	AACAGGTGCCGGAAAT	NA	NA	NA	NA
>prophage 7
NZ_CP043185	Escherichia coli O16:H48 strain PG20180171 chromosome, complete genome	4593846	3855327	3919622	4593846	protease,terminase,lysis,tRNA,integrase,transposase	Enterobacteria_phage(48.28%)	65	3902280:3902326	3923582:3923628
WP_001295836.1|3855327_3855951_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|3855921_3856608_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|3856604_3859019_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|3859449_3863730_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|3863769_3864138_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|3864828_3865089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|3866320_3867415_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|3867483_3868410_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|3868639_3869122_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|3869199_3870015_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|3870104_3871886_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|3871898_3872675_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|3872774_3873653_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|3873821_3875276_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|3875335_3876697_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|3876753_3878055_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|3878076_3879222_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|3879449_3880235_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|3880245_3881481_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|3881502_3882552_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|3882868_3884536_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|3884545_3885805_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|3885815_3886631_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|3886627_3887521_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|3887715_3888783_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|3888779_3889289_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|3889406_3890129_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|3890131_3890626_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|3890799_3892185_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|3892220_3892742_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3892849_3893062_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|3893063_3893930_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|3894400_3894943_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|3895162_3895855_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|3895885_3898489_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|3898467_3899508_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|3899518_3900034_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_085947917.1|3900479_3901752_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
3902280:3902326	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|3902339_3903503_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|3903622_3903886_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|3904208_3904304_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|3904366_3905528_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|3905839_3906172_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|3906219_3906369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|3906426_3907953_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|3908417_3908969_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|3908978_3909776_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|3909892_3909994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|3909990_3910446_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|3910445_3910616_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|3910608_3910899_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|3910895_3911258_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|3911254_3911395_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|3911480_3911864_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|3912261_3913278_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|3913282_3914350_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|3914922_3915138_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|3915137_3915635_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|3915851_3916034_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|3916124_3916418_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|3916708_3917119_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|3917404_3917611_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|3917775_3917970_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|3918358_3918904_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|3918878_3919622_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
3923582:3923628	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 8
NZ_CP043185	Escherichia coli O16:H48 strain PG20180171 chromosome, complete genome	4593846	4144940	4195285	4593846	portal,tail,terminase,protease,lysis,head,capsid,integrase,holin	Enterobacteria_phage(75.36%)	70	4143218:4143233	4168018:4168033
4143218:4143233	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533640.1|4144940_4146011_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
WP_002414258.1|4145988_4146207_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000545733.1|4146246_4146414_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|4146502_4146784_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|4146975_4147524_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763367.1|4147520_4147742_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000548551.1|4148133_4148325_-	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000149542.1|4148297_4148480_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186853.1|4148476_4149157_-	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000100844.1|4149153_4149939_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|4149944_4150241_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000372937.1|4150315_4150459_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|4150427_4150592_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|4150664_4151033_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|4151215_4151416_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|4151682_4152165_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001564525.1|4152165_4152489_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_001245922.1|4152953_4153388_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|4153403_4154243_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_000104863.1|4154355_4155069_-	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000437875.1|4155169_4155370_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|4155488_4155782_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|4155814_4156714_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|4156710_4157412_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145933.1|4157408_4157699_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|4157772_4158213_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000611491.1|4158209_4159082_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|4159078_4159252_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113775.1|4159218_4159401_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000566997.1|4159397_4159568_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_001108044.1|4159560_4160172_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000144614.1|4160168_4160375_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271136.1|4160352_4161018_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_001235459.1|4161014_4161638_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_012767708.1|4161749_4161944_+	hypothetical protein	NA	C6ZCW9	Enterobacteria_phage	100.0	1.0e-28
WP_000783735.1|4162314_4162638_+|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_000229403.1|4162621_4163098_+	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_012738274.1|4163314_4163497_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|4163587_4163881_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012775990.1|4164170_4164581_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_001031427.1|4164866_4165073_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|4165237_4165432_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453580.1|4165820_4166366_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|4166340_4168266_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
4168018:4168033	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000198149.1|4168262_4168469_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|4168465_4170067_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123343.1|4170047_4171367_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001297109.1|4171376_4171709_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|4171764_4172790_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158919.1|4172831_4173230_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|4173241_4173595_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|4173606_4174185_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|4174181_4174577_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|4174584_4175325_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|4175340_4175763_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|4175744_4176179_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840207.1|4176171_4178733_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000847379.1|4178729_4179059_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|4179058_4179757_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|4179762_4180506_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090889.1|4180442_4181075_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000515496.1|4181135_4184534_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_001246632.1|4184595_4185216_+	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_001407643.1|4185280_4187605_+	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_016063193.1|4187604_4188189_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_000162952.1|4188317_4189550_-	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_000735931.1|4190140_4191031_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000889231.1|4191027_4192605_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000767389.1|4193460_4193937_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001295303.1|4193995_4195285_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 9
NZ_CP043185	Escherichia coli O16:H48 strain PG20180171 chromosome, complete genome	4593846	4585887	4593706	4593846	portal,plate,integrase	Shigella_phage(45.45%)	14	4582442:4582454	4589570:4589582
4582442:4582454	attL	GAAGCGGCTGACT	NA	NA	NA	NA
WP_000741310.1|4585887_4587015_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|4586995_4587241_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|4587277_4587589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|4587705_4588047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|4587984_4588293_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|4588467_4589142_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|4589232_4589433_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|4589476_4590034_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
4589570:4589582	attR	GAAGCGGCTGACT	NA	NA	NA	NA
WP_001250269.1|4590209_4590389_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|4590378_4591746_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|4591757_4591940_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|4591939_4592413_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|4592339_4593131_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|4593121_4593706_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
