The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043211	Escherichia coli O16:H48 strain PG20180050 chromosome, complete genome	4615313	692989	700215	4615313		uncultured_Caudovirales_phage(33.33%)	9	NA	NA
WP_001209680.1|692989_693376_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
WP_000820714.1|693375_693735_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903373.1|693742_694030_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|694155_694530_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138045.1|694626_695166_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|695193_697308_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_148871284.1|697378_698470_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.1e-13
WP_046835546.1|698639_699356_+	hypothetical protein	NA	A0A1I9LJQ6	Stx_converting_phage	100.0	5.4e-139
WP_069106888.1|699420_700215_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	99.2	1.1e-153
>prophage 2
NZ_CP043211	Escherichia coli O16:H48 strain PG20180050 chromosome, complete genome	4615313	1308406	1315545	4615313		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1308406_1309045_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|1309136_1310303_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|1310299_1311208_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001300386.1|1311403_1312171_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141337.1|1312221_1312878_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|1312983_1315545_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
NZ_CP043211	Escherichia coli O16:H48 strain PG20180050 chromosome, complete genome	4615313	1689332	1701803	4615313	tail,transposase,integrase	Enterobacteria_phage(43.75%)	17	1685642:1685658	1703813:1703829
1685642:1685658	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|1689332_1689533_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|1689664_1689970_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|1689969_1690332_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|1690322_1690859_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|1690986_1691811_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|1691876_1692239_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000128175.1|1692596_1692965_+	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_001393497.1|1692961_1693456_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|1693455_1693731_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|1693780_1694299_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|1694325_1694766_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|1695064_1695346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|1695380_1696712_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_085947771.1|1697575_1698738_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000915541.1|1698886_1699249_-	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|1699401_1700559_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|1700870_1701803_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1703813:1703829	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP043211	Escherichia coli O16:H48 strain PG20180050 chromosome, complete genome	4615313	2520985	2540196	4615313	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000379575.1|2520985_2521141_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2521307_2521715_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2521798_2522029_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|2522325_2522475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2522911_2523244_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2523446_2523752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2523776_2524016_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2524015_2524303_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2524374_2524530_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2524746_2524998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2525064_2525343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2525344_2526394_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2526407_2527160_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2527437_2527527_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2527581_2527794_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2528094_2528310_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2529063_2529279_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2529283_2529595_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2529591_2530125_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2530121_2530619_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2530981_2531194_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2531204_2531393_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2531395_2531461_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2531539_2531695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2531866_2532040_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2532191_2532602_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2532659_2532893_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|2533281_2533851_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|2533801_2534764_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|2534763_2535339_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078178.1|2535436_2536027_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2536343_2536577_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2536645_2536759_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2537363_2538647_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|2538735_2540196_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 5
NZ_CP043211	Escherichia coli O16:H48 strain PG20180050 chromosome, complete genome	4615313	2700475	2764422	4615313	tRNA,lysis,transposase,integrase,tail	Escherichia_phage(39.39%)	63	2743370:2743388	2773745:2773763
WP_001254932.1|2700475_2701627_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_085947917.1|2701790_2703063_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_010723099.1|2705754_2705820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|2705923_2706514_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|2706495_2707446_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2707546_2708860_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2708886_2710092_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2710091_2710514_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|2710503_2711931_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|2711932_2712721_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2712720_2713488_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2713484_2714555_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2714562_2715060_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2715074_2715821_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2715829_2716117_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2716128_2717058_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|2717342_2719388_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|2719635_2721909_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2721966_2723466_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|2723701_2724607_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2724778_2725105_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2725112_2725298_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|2725294_2727934_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2728141_2729131_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2729241_2729664_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2729660_2729927_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|2730200_2733725_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|2734091_2735225_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|2735365_2735800_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|2736578_2736692_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2736760_2736994_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000078178.1|2737310_2737901_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2737998_2738574_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|2738573_2741936_-|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_089418980.1|2742000_2742216_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
WP_000019448.1|2742258_2743239_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2743370:2743388	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_001755909.1|2744696_2744897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091628.1|2745004_2745364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|2745344_2745608_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|2745745_2747203_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2747399_2747585_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|2747672_2748233_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|2748255_2749002_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|2749008_2749866_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|2749878_2750301_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|2750323_2750620_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2750743_2751220_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000233809.1|2751528_2751663_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|2751673_2751829_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2751825_2752314_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2752755_2752977_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2752976_2753147_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2753221_2753497_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|2753598_2756199_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|2756191_2757001_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2757057_2757252_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2757244_2757454_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2757532_2757748_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2757749_2758985_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|2759036_2759972_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2760100_2761474_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2761951_2762935_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2763189_2764422_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2773745:2773763	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP043211	Escherichia coli O16:H48 strain PG20180050 chromosome, complete genome	4615313	2955726	2970107	4615313	tail,portal,integrase,plate	Escherichia_phage(26.32%)	25	2953102:2953115	2971133:2971146
2953102:2953115	attL	AAAATAAGATGAAT	NA	NA	NA	NA
WP_000332303.1|2955726_2956458_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2956678_2957083_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|2957135_2957246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|2957782_2958106_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000943927.1|2958208_2958373_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_000557907.1|2958606_2959440_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000905001.1|2959546_2960101_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_024184299.1|2960172_2960667_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000548498.1|2960666_2961269_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|2961240_2961654_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000554703.1|2961655_2962285_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_000383574.1|2962288_2962873_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|2962863_2963655_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|2963581_2964055_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|2964054_2964237_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|2964248_2965616_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|2965605_2965785_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|2965960_2966518_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_000649480.1|2966561_2966762_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|2966852_2967527_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|2967701_2968010_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|2967947_2968289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|2968405_2968717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|2968753_2968999_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|2968979_2970107_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
2971133:2971146	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 7
NZ_CP043211	Escherichia coli O16:H48 strain PG20180050 chromosome, complete genome	4615313	3360709	3411054	4615313	lysis,terminase,protease,head,integrase,capsid,tail,portal,holin	Enterobacteria_phage(75.36%)	70	3387962:3387977	3412762:3412777
WP_001295303.1|3360709_3361999_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
WP_000767389.1|3362057_3362534_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000889231.1|3363389_3364967_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000735931.1|3364963_3365854_+	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000162952.1|3366444_3367677_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_016063193.1|3367805_3368390_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_001407643.1|3368389_3370714_-	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_001246632.1|3370778_3371399_-	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_000515496.1|3371460_3374859_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_000090889.1|3374919_3375552_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000194780.1|3375488_3376232_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|3376237_3376936_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3376935_3377265_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840207.1|3377261_3379823_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000459457.1|3379815_3380250_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3380231_3380654_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|3380669_3381410_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|3381417_3381813_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|3381809_3382388_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|3382399_3382753_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158919.1|3382764_3383163_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000063280.1|3383204_3384230_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|3384285_3384618_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123343.1|3384627_3385947_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001359455.1|3385927_3387529_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|3387525_3387732_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|3387728_3389654_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
3387962:3387977	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453580.1|3389628_3390174_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001421937.1|3390562_3390757_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3390921_3391128_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_012775990.1|3391413_3391824_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_000738492.1|3392113_3392407_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012738274.1|3392497_3392680_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000229403.1|3392896_3393373_-	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_000783735.1|3393356_3393680_-|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_012767708.1|3394050_3394245_-	hypothetical protein	NA	C6ZCW9	Enterobacteria_phage	100.0	1.0e-28
WP_001235459.1|3394356_3394980_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_001271136.1|3394976_3395642_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_000144614.1|3395619_3395826_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001108044.1|3395822_3396434_-	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000566997.1|3396426_3396597_-	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_000113775.1|3396593_3396776_-	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000984218.1|3396742_3396916_-	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000611491.1|3396912_3397785_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000736903.1|3397781_3398222_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145933.1|3398295_3398586_-	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000788910.1|3398582_3399284_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000185505.1|3399280_3400180_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000251069.1|3400212_3400506_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|3400624_3400825_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000104863.1|3400925_3401639_+	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000788349.1|3401751_3402591_+	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_001245922.1|3402606_3403041_+	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_001564525.1|3403505_3403829_+	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_000281856.1|3403829_3404312_-	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213975.1|3404578_3404779_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000065374.1|3404961_3405330_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3405402_3405567_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3405535_3405679_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995451.1|3405753_3406050_+	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000100844.1|3406055_3406841_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186853.1|3406837_3407518_+	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000149542.1|3407514_3407697_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000548551.1|3407669_3407861_+	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000763367.1|3408252_3408474_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001289873.1|3408470_3409019_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000026224.1|3409210_3409492_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_000545733.1|3409580_3409748_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_002414258.1|3409787_3410006_+	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000533640.1|3409983_3411054_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
3412762:3412777	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 8
NZ_CP043211	Escherichia coli O16:H48 strain PG20180050 chromosome, complete genome	4615313	3609292	3655515	4615313	lysis,terminase,transposase,protease,integrase,capsid	Enterobacteria_phage(53.85%)	50	3632367:3632413	3653669:3653715
WP_001300563.1|3609292_3610405_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3610481_3610634_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001130654.1|3611086_3612205_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|3612270_3612519_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3612583_3612952_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|3613045_3613699_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3613806_3615054_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000786319.1|3615134_3616511_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3616612_3619756_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3619767_3620991_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3621006_3621339_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3621496_3622870_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3623026_3623710_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|3623699_3625142_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|3625291_3627529_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|3627515_3630488_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|3630488_3631379_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|3631561_3632323_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3632367:3632413	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|3632836_3633790_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3634039_3634789_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|3635691_3636318_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071592174.1|3636262_3636400_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_001027248.1|3636372_3637116_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453566.1|3637090_3637636_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|3638024_3638219_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3638383_3638590_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|3638875_3639286_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|3639576_3639870_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3639960_3640143_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3640359_3640857_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|3640856_3641072_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|3641644_3642712_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|3642716_3643733_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|3644130_3644514_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3644599_3644740_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3644736_3645099_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|3645095_3645386_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|3645378_3645549_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|3645548_3646004_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|3646000_3646102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3646218_3647016_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3647025_3647577_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|3648041_3649568_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|3649625_3649775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|3649822_3650155_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_085947771.1|3650465_3651628_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000145909.1|3651690_3651786_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|3652108_3652372_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|3652491_3653655_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_085947917.1|3654241_3655515_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
3653669:3653715	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 9
NZ_CP043211	Escherichia coli O16:H48 strain PG20180050 chromosome, complete genome	4615313	3828103	3882632	4615313	transposase	Shigella_phage(11.76%)	50	NA	NA
WP_085947771.1|3828103_3829265_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000556438.1|3829293_3830754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295337.1|3831277_3832252_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004027.1|3832358_3833210_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114620.1|3833206_3834034_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939375.1|3834030_3834798_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
WP_001018417.1|3834810_3835773_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000362028.1|3836388_3836946_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_120795375.1|3836925_3837045_-	protein YkiC	NA	NA	NA	NA	NA
WP_000860444.1|3837069_3838266_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_085947917.1|3838425_3839699_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000012218.1|3839717_3840161_+	transferase	NA	NA	NA	NA	NA
WP_000596084.1|3840162_3840936_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_001141271.1|3841123_3841399_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842106.1|3841433_3842543_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
WP_000419081.1|3842636_3843470_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001096705.1|3843693_3844233_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000107627.1|3844334_3845546_-	3-(3-hydroxy-phenyl)propionate transporter	NA	NA	NA	NA	NA
WP_001013499.1|3846123_3847137_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|3847133_3848084_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_000160710.1|3848080_3848890_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000121907.1|3848899_3849766_-	2-hydroxy-6-oxonona-2,4-dienedioate hydrolase	NA	NA	NA	NA	NA
WP_000543457.1|3849783_3850728_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001007407.1|3850729_3852394_-	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_001310587.1|3852470_3853418_+	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
WP_000805902.1|3853494_3854577_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177906.1|3854699_3857774_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
WP_000749863.1|3859693_3860749_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|3861036_3862140_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|3862151_3863405_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000854672.1|3863976_3864318_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|3864338_3864656_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|3864674_3864896_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|3864904_3865381_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|3865396_3865855_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|3865952_3866192_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|3866268_3866736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|3866758_3867202_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|3867201_3867429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|3867832_3868654_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|3868745_3869609_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|3869937_3870831_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|3871251_3872403_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|3874749_3875766_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|3875973_3877377_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|3877363_3878296_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|3878404_3879451_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|3880672_3881011_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|3881033_3881384_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_010723086.1|3881477_3882632_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
