The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043227	Escherichia coli strain Ec-050 chromosome, complete genome	4848863	79604	138234	4848863	portal,transposase,capsid,terminase,tail,head,holin,integrase,tRNA	Escherichia_phage(44.68%)	64	74699:74713	81179:81193
74699:74713	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074971.1|79604_80723_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	1.6e-84
WP_000003742.1|80691_80961_-	excisionase	NA	NA	NA	NA	NA
WP_000102136.1|81022_83464_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
81179:81193	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001070255.1|83557_83749_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|83745_83934_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001517906.1|84334_84538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|84502_84721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042046576.1|84792_85092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001420344.1|85445_85784_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|86175_86418_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|86401_86827_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|86898_87969_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|88009_88432_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000403785.1|88489_88846_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|88939_89122_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753060.1|89114_89291_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_002431311.1|90251_91793_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_000813254.1|92803_92959_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_032155008.1|93126_93405_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001221526.1|93406_94465_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_000139999.1|94465_94846_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_000762879.1|94842_95664_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_106104550.1|96058_96145_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|96633_96846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333560.1|96916_97252_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_000874243.1|97512_97701_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333561.1|97697_97859_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000372595.1|98008_98224_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193264.1|98228_98579_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992097.1|98642_99176_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_075202333.1|99392_99575_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000738421.1|99665_99959_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001135104.1|100484_100835_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_001333563.1|100982_101465_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140892.1|101464_103222_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_000811487.1|103218_103380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923134.1|103369_104596_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000766109.1|105201_106419_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719064.1|106495_106813_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_001147814.1|106821_107160_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000968644.1|107156_107606_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001206700.1|107602_107947_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000097535.1|108007_108712_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_000164661.1|108726_109098_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978926.1|109121_109400_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.7	5.3e-42
WP_000224003.1|109446_112674_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|112651_113008_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152457.1|113007_113706_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001333568.1|113711_114455_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_000090843.1|114391_115000_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_000515345.1|115060_118540_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001233546.1|118607_119207_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_001189123.1|123160_124669_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_042047081.1|126080_126611_+|tail	tail fiber domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_000241001.1|126848_127517_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|128071_128935_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|128918_130055_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|130304_131531_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|131579_132701_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|132776_134237_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|134236_134908_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|135076_136447_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|136450_137092_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|137127_138234_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP043227	Escherichia coli strain Ec-050 chromosome, complete genome	4848863	1064568	1075483	4848863		Escherichia_phage(22.22%)	10	NA	NA
WP_087523507.1|1064568_1065576_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_000704907.1|1065768_1066935_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_004206788.1|1067115_1067670_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
WP_004206787.1|1067684_1068575_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
WP_016161468.1|1068606_1069476_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
WP_049139659.1|1069502_1070567_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_000043542.1|1070791_1072198_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_099147860.1|1072369_1072762_-	serine acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	41.1	6.8e-11
WP_099147824.1|1072841_1074170_-	flippase	NA	NA	NA	NA	NA
WP_125922846.1|1074205_1075483_-	hypothetical protein	NA	A0A1V0E6Q2	Klebsiella_phage	24.5	1.1e-12
>prophage 3
NZ_CP043227	Escherichia coli strain Ec-050 chromosome, complete genome	4848863	1163747	1173190	4848863		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001551350.1|1163747_1164884_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
WP_001551351.1|1164880_1166881_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_032204114.1|1167005_1167467_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
WP_001551352.1|1167508_1167979_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001308766.1|1168025_1168745_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1168741_1170427_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|1170648_1171380_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|1171439_1171547_+	protein YohO	NA	NA	NA	NA	NA
WP_000783134.1|1171527_1172259_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|1172263_1173190_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 4
NZ_CP043227	Escherichia coli strain Ec-050 chromosome, complete genome	4848863	1185149	1285964	4848863	portal,capsid,lysis,terminase,tail,head,tRNA	Enterobacteria_phage(33.33%)	102	NA	NA
WP_001551359.1|1185149_1186097_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_001295452.1|1186335_1186734_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000968208.1|1186730_1187426_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553553.1|1187555_1188440_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920064.1|1188589_1189309_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000383045.1|1189311_1189551_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001551360.1|1189947_1191186_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_001551361.1|1191179_1192415_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275118.1|1192485_1193496_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000255032.1|1193511_1195032_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
WP_001036964.1|1195092_1196091_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628659.1|1196370_1197411_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001551362.1|1197552_1198710_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139613.1|1198726_1199395_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425456.1|1199652_1200489_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000534384.1|1202790_1204260_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548286.1|1204464_1205346_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000182053.1|1205444_1206494_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873880.1|1206567_1207425_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
WP_001065004.1|1207427_1208516_+	sugar kinase	NA	NA	NA	NA	NA
WP_000382939.1|1208571_1209822_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_000415426.1|1209921_1210863_-	ribosylpyrimidine nucleosidase	NA	NA	NA	NA	NA
WP_000658598.1|1210992_1211691_+	transcriptional regulator YeiL	NA	NA	NA	NA	NA
WP_001328268.1|1211758_1213009_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_001292463.1|1213102_1214041_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_001208119.1|1214028_1214970_-	pseudouridine kinase	NA	NA	NA	NA	NA
WP_000854453.1|1215393_1217085_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091263.1|1217101_1218040_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487246.1|1218039_1219170_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551949.1|1219537_1220719_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_000389030.1|1220715_1220970_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136827.1|1221124_1221697_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_001091917.1|1221919_1223386_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.5e-42
WP_000198839.1|1223503_1224490_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001297918.1|1224528_1225242_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1225653_1226220_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000470599.1|1226400_1227957_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001316494.1|1228038_1229853_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501604.1|1229853_1230948_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_000088901.1|1230947_1231973_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087523469.1|1231974_1233564_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|1233567_1233912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|1234244_1235435_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|1235462_1236158_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|1236307_1238068_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494186.1|1238192_1238477_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1238615_1239623_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_001135667.1|1239804_1240032_+	YejL family protein	NA	NA	NA	NA	NA
WP_087523468.1|1240051_1241812_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001351450.1|1242731_1243934_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_111530668.1|1245219_1248978_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	88.7	0.0e+00
WP_001233090.1|1249042_1249642_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_111530669.1|1249712_1253210_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.2	0.0e+00
WP_000090895.1|1253270_1253903_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000194783.1|1253839_1254583_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152640.1|1254588_1255287_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.5e-133
WP_000847379.1|1255286_1255616_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_021548553.1|1255612_1258192_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.7	0.0e+00
WP_000459458.1|1258184_1258619_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_111530670.1|1258600_1259023_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_021548555.1|1259038_1259779_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	7.8e-125
WP_021548556.1|1259786_1260182_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
WP_001518407.1|1260178_1260757_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_029395143.1|1260768_1261122_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_001468354.1|1261133_1261529_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.1e-56
WP_029395141.1|1261570_1262596_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_012304872.1|1262651_1262984_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_029395138.1|1262993_1264313_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
WP_057077926.1|1264293_1265895_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
WP_000198149.1|1265891_1266098_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027321.1|1266094_1268020_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|1267994_1268540_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000105084.1|1268928_1269162_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|1269218_1269629_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_024205918.1|1269915_1270173_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	98.8	1.1e-38
WP_024174403.1|1270169_1270493_-	protein KilA	NA	A0A220NRM9	Escherichia_phage	99.1	7.9e-58
WP_001228685.1|1270576_1270762_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000075159.1|1270978_1271476_-	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
WP_052978305.1|1271475_1271691_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_096956487.1|1271758_1272133_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	93.5	4.4e-60
WP_001310393.1|1272390_1272624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|1272767_1273307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044862710.1|1273521_1274274_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	9.9e-136
WP_074527437.1|1274287_1275277_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_087604717.1|1275284_1276082_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	1.9e-148
WP_040074681.1|1276101_1276491_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	98.4	4.6e-68
WP_000210155.1|1276487_1276814_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_125316734.1|1276882_1277464_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	100.0	5.7e-115
WP_074527436.1|1277463_1277958_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	1.2e-86
WP_000104976.1|1277954_1278896_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	3.9e-153
WP_001250269.1|1278885_1279065_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515869.1|1279240_1279798_-	protein YmfL	NA	U5P4K1	Shigella_phage	96.8	8.8e-97
WP_000205494.1|1279835_1280036_-	cell division protein	NA	NA	NA	NA	NA
WP_000450737.1|1280133_1280760_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_072018922.1|1281155_1281431_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	96.7	5.9e-46
WP_000135680.1|1282031_1282394_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081280.1|1282458_1283283_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_021548838.1|1283410_1283947_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	5.3e-99
WP_001242718.1|1283937_1284300_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_021548839.1|1284296_1284512_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	92.1	3.7e-27
WP_001096409.1|1284573_1284783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741304.1|1284785_1285964_+	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.6	2.7e-31
>prophage 5
NZ_CP043227	Escherichia coli strain Ec-050 chromosome, complete genome	4848863	1823272	1836455	4848863		Escherichia_phage(50.0%)	12	NA	NA
WP_039023140.1|1823272_1825834_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|1825939_1826596_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|1826646_1827414_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847984.1|1827609_1828518_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_000590403.1|1828514_1829777_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|1829773_1830412_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|1830416_1831193_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|1831281_1832646_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|1832739_1833732_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1833794_1834934_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1835073_1835700_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1835693_1836455_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 6
NZ_CP043227	Escherichia coli strain Ec-050 chromosome, complete genome	4848863	3150426	3198570	4848863	tail,tRNA,integrase,transposase	Escherichia_phage(52.0%)	48	3149809:3149823	3184778:3184792
3149809:3149823	attL	CGATGTTATTCAGCG	NA	NA	NA	NA
WP_000560983.1|3150426_3150864_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|3150908_3151850_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001295676.1|3152702_3152921_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|3153138_3153381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027703.1|3153710_3154640_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|3154636_3155272_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|3155268_3156171_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077248221.1|3156183_3159234_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753617.1|3159427_3160261_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001295677.1|3160413_3161469_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931299.1|3161518_3163267_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001019486.1|3163266_3164337_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446015.1|3164326_3165778_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|3165788_3166235_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619493.1|3166535_3166850_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179741.1|3166859_3167684_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001311268.1|3168134_3169394_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144073.1|3169390_3170860_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217137.1|3171147_3171984_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000863142.1|3171967_3172906_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063517.1|3172902_3173937_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000122641.1|3174221_3174842_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001166063.1|3175101_3176085_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|3176233_3176908_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3177013_3178387_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|3178383_3179082_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|3179231_3179732_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|3179918_3180899_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|3180968_3181262_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|3181398_3181671_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|3181840_3182341_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|3182404_3182629_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277952.1|3182628_3182931_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|3182930_3183155_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027659.1|3183151_3183427_+	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_000839179.1|3187524_3187929_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
3184778:3184792	attR	CGCTGAATAACATCG	NA	NA	NA	NA
WP_000612626.1|3187925_3188273_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|3188321_3189857_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_062914736.1|3189864_3190467_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001286718.1|3190526_3191717_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251408.1|3191729_3192248_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|3192304_3192580_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|3192612_3192732_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069960.1|3192724_3195172_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000978889.1|3195186_3195666_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882940.1|3195665_3196829_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000468308.1|3196910_3197129_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_085947770.1|3197201_3198570_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 7
NZ_CP043227	Escherichia coli strain Ec-050 chromosome, complete genome	4848863	3568780	3626831	4848863	transposase,holin,tRNA,integrase,protease	Enterobacteria_phage(20.0%)	52	3577704:3577719	3606655:3606670
WP_001162184.1|3568780_3570133_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232255.1|3570187_3570574_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106227.1|3570618_3571083_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.1	1.2e-51
WP_087523559.1|3571242_3573381_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	3.4e-266
WP_001333756.1|3573774_3575430_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|3575479_3576901_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|3577019_3577967_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
3577704:3577719	attL	GAACGCTGGCAGCATG	NA	NA	NA	NA
WP_001387276.1|3578151_3578205_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|3578345_3581042_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_024176429.1|3581247_3581634_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3581706_3582168_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013049.1|3582180_3583116_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.3e-52
WP_001296693.1|3583119_3583254_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230272.1|3583534_3583930_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500681.1|3584060_3584774_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256665.1|3584844_3585438_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001333754.1|3585582_3586035_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_001333753.1|3586157_3587579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111530660.1|3587565_3587871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654804.1|3587916_3588885_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_000012906.1|3589023_3590028_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002954.1|3590189_3590606_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001333751.1|3590651_3591155_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001014711.1|3591347_3592535_+	DUF898 family protein	NA	NA	NA	NA	NA
WP_000416404.1|3592586_3595442_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|3595441_3595885_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3596238_3597750_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3598016_3599117_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3599116_3600199_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294554.1|3600359_3601862_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
WP_001299662.1|3601989_3603009_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_000772653.1|3603453_3604716_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.6	2.4e-65
WP_001066505.1|3604745_3605384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455467.1|3605761_3605992_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000235891.1|3606088_3606274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023258408.1|3606461_3606638_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_001246998.1|3606630_3606990_+	hypothetical protein	NA	NA	NA	NA	NA
3606655:3606670	attR	GAACGCTGGCAGCATG	NA	NA	NA	NA
WP_001027153.1|3607021_3607306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075579.1|3607302_3607686_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000155331.1|3607682_3610355_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	4.1e-59
WP_001066218.1|3610755_3611499_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000126947.1|3611495_3612047_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185344.1|3612052_3612325_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	6.3e-08
WP_000993028.1|3612970_3613939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422112.1|3613940_3614873_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.4	1.8e-25
WP_001189123.1|3617034_3618543_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_049828170.1|3620033_3620423_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
WP_000145481.1|3620473_3620692_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085949416.1|3620758_3621920_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
WP_000625669.1|3622200_3623478_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|3623540_3625538_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|3625691_3626831_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
>prophage 8
NZ_CP043227	Escherichia coli strain Ec-050 chromosome, complete genome	4848863	3931244	4004090	4848863	tRNA,plate,transposase,protease	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_001295561.1|3931244_3932597_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3932626_3935059_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3935180_3935666_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|3935669_3936695_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3936799_3937255_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3937258_3938047_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|3938046_3939195_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|3939191_3939788_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|3939824_3943307_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|3943319_3944279_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|3944377_3946519_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|3946575_3946965_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|3947029_3948328_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3948376_3948637_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3948623_3948824_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|3948989_3949535_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|3949531_3949954_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|3949967_3950678_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|3950877_3951702_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|3951755_3953474_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|3953585_3954293_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|3954289_3954694_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|3954811_3955627_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|3955666_3956320_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|3956312_3957344_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|3957531_3958107_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|3963868_3964672_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|3964668_3965583_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3965823_3966624_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644685.1|3967298_3968657_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|3968728_3969484_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|3969517_3970240_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3970236_3970704_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|3970768_3971500_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|3972036_3972822_+	lipoprotein	NA	NA	NA	NA	NA
WP_001236653.1|3972958_3973438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087523582.1|3973447_3974362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|3974405_3974888_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|3974911_3976264_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122545204.1|3976274_3979709_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|3979817_3981230_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|3981234_3981978_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614325.1|3981974_3984740_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|3984748_3985510_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|3985514_3986846_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|3986848_3987373_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113709.1|3987369_3988650_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|3988674_3989757_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|3989720_3991571_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|3991574_3991988_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|3991994_3993470_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|3993520_3993745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|3993779_3994280_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|3994974_3995493_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001297813.1|3995525_3995663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032329316.1|3995702_3997844_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_039023185.1|3997919_4002152_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_024198219.1|4002129_4002363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000008098.1|4002346_4002523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420818.1|4002953_4004090_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP043227	Escherichia coli strain Ec-050 chromosome, complete genome	4848863	4022980	4041429	4848863	integrase	Enterobacteria_phage(21.43%)	20	4023587:4023601	4030238:4030252
WP_039023169.1|4022980_4024036_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
4023587:4023601	attL	ACCGCTGGCGCGTTT	NA	NA	NA	NA
WP_001285288.1|4024323_4025427_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|4025438_4026692_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_021531046.1|4027047_4028262_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_074525659.1|4028654_4028858_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000412539.1|4028857_4029289_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
WP_087523546.1|4029301_4030111_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	53.6	3.0e-29
WP_033554327.1|4030103_4030286_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
4030238:4030252	attR	ACCGCTGGCGCGTTT	NA	NA	NA	NA
WP_077900594.1|4030279_4031347_+	ash family protein	NA	NA	NA	NA	NA
WP_001065738.1|4031339_4031534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|4031530_4031794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|4031790_4032012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058739.1|4032004_4032607_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_087523544.1|4032619_4035376_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	2.6e-298
WP_001018522.1|4035960_4036134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016231259.1|4036138_4037605_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.3	1.4e-106
WP_016231258.1|4037604_4039710_+	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	36.2	1.4e-86
WP_016231257.1|4039772_4040210_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_000678612.1|4040693_4040894_-	hypothetical protein	NA	H6WRV2	Salmonella_phage	43.1	1.3e-05
WP_000230707.1|4040973_4041429_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	2.9e-45
>prophage 1
NZ_CP043230	Escherichia coli strain Ec-050 plasmid pEc-050-NDM-5, complete sequence	99461	2788	60257	99461	transposase,integrase	Macacine_betaherpesvirus(27.78%)	50	40126:40185	57528:57632
WP_001067855.1|2788_3493_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001137892.1|4722_5307_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|5306_6545_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|6541_7447_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|7568_8273_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024193849.1|8297_8672_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_000255956.1|9751_10774_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001297096.1|10773_11553_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000977394.1|12291_13083_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001496335.1|13089_15060_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001322642.1|16302_16575_+	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001072358.1|17421_18591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309252.1|18957_19146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066953.1|19266_20007_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361611.1|20291_21269_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_000949005.1|24250_25165_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|25164_25992_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_001101723.1|25988_26846_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|26842_27700_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001318207.1|28942_29323_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000095526.1|29702_30896_-	MFS transporter	NA	NA	NA	NA	NA
WP_000602863.1|31031_32756_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000011908.1|32756_33704_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015721.1|33703_35446_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|35442_36720_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973519.1|36801_39003_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
40126:40185	attL	CTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGG	NA	NA	NA	NA
WP_000361402.1|40468_41491_-	helicase UvrD	NA	NA	NA	NA	NA
WP_001128474.1|41475_43041_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001034044.1|43115_43532_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261286.1|43528_43759_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000813630.1|44318_44537_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|44538_44844_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016970.1|44844_45651_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|46372_47128_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|47715_48882_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|48881_49853_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_064766247.1|50590_51493_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032181561.1|51877_52561_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
WP_001104873.1|52561_52783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546462.1|52796_53231_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001006251.1|53275_54046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001666994.1|54582_54885_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|54931_55354_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_086625069.1|55350_55521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086625070.1|55459_56236_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	3.3e-09
WP_000139363.1|56290_56851_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_005012601.1|56984_57197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|57641_58319_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
57528:57632	attR	CCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGTGTAACCGGCTCATTTAAACCGTCTGGTCTGTTTCCTCCGGCTCT	NA	NA	NA	NA
WP_000624622.1|58318_58666_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_023149734.1|58685_60257_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
>prophage 1
NZ_CP043228	Escherichia coli strain Ec-050 plasmid pEc-050-TEM-30, complete sequence	115935	10983	51962	115935	integrase,transposase	Escherichia_phage(20.0%)	46	35511:35570	51204:52026
WP_000038339.1|10983_11925_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.0	3.5e-61
WP_001247862.1|11989_12256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|12347_12782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117609.1|13510_14011_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	26.9	9.3e-05
WP_000978012.1|14473_15070_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
WP_001276261.1|15066_15786_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845897.1|15782_16217_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145453.1|16271_18230_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.9	3.6e-20
WP_000006014.1|18288_18522_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001276110.1|18579_19107_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_001762494.1|20274_21942_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	52.8	6.2e-162
WP_001027500.1|22219_22411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271729.1|22407_22830_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_072132163.1|22876_23179_-	antirestriction protein	NA	NA	NA	NA	NA
WP_015059345.1|23274_23847_-	YubH family protein	NA	NA	NA	NA	NA
WP_000274403.1|24540_24975_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104887.1|24986_25208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086178.1|25208_25892_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.0e-30
WP_010891263.1|25968_26280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273918.1|26276_27179_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|27596_27845_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|27841_28279_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457492.1|28278_29553_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.2	1.7e-143
WP_001278818.1|29554_29971_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000688514.1|29963_30944_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_000030199.1|31357_31666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|31752_32397_-	ParA family protein	NA	NA	NA	NA	NA
WP_001164198.1|32576_33356_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
WP_000465036.1|33357_33771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290416.1|34302_35229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001596999.1|35273_35531_+	hypothetical protein	NA	NA	NA	NA	NA
35511:35570	attL	TTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067858.1|35564_36269_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000845048.1|36965_37979_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000777555.1|38135_38609_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_001206317.1|38701_39493_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|39656_40004_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001067858.1|40859_41564_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_021561477.1|41685_42546_+	inhibitor-resistant class A broad-spectrum beta-lactamase TEM-30	NA	Q1MVP3	Enterobacteria_phage	99.7	3.9e-160
WP_001447541.1|45408_46293_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_039026029.1|46509_47724_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	3.2e-19
WP_001255015.1|47751_48057_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|48168_49662_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|49692_49944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|49837_50140_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|50226_51042_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001067858.1|51257_51962_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
51204:52026	attR	TTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGTTGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGTGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
