The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043438	Enterobacter sp. LU1 chromosome, complete genome	4636526	1130920	1180095	4636526	head,integrase,terminase,tail	Cronobacter_phage(23.33%)	73	1130861:1130911	1180391:1180441
1130861:1130911	attL	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATTAAAT	NA	NA	NA	NA
WP_149121054.1|1130920_1131976_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	98.6	7.5e-206
WP_071886183.1|1131960_1132296_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149121053.1|1132402_1132729_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	78.1	6.2e-42
WP_149121052.1|1132738_1132978_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_149121051.1|1132940_1133303_-	DUF2591 family protein	NA	G8C7S4	Escherichia_phage	83.2	4.3e-52
WP_149121050.1|1133302_1133521_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	57.7	1.0e-16
WP_149121049.1|1133612_1133804_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	1.1e-14
WP_149121048.1|1133800_1134118_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	63.8	4.6e-34
WP_109956910.1|1134114_1134333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149121047.1|1134329_1134989_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	95.0	2.9e-123
WP_149121046.1|1134998_1136333_-	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	36.2	1.3e-34
WP_149121045.1|1136329_1136482_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	52.9	2.3e-07
WP_149121044.1|1136478_1136907_-	regulator	NA	G8C7S8	Escherichia_phage	96.5	1.2e-72
WP_047352296.1|1136903_1137584_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.2	3.8e-126
WP_149121043.1|1137580_1138498_-	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	99.3	3.1e-171
WP_063418855.1|1138507_1138792_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	95.7	2.9e-48
WP_149121042.1|1138799_1139768_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	96.9	8.7e-92
WP_149121041.1|1139838_1140036_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_149121040.1|1140328_1140514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149121039.1|1141213_1141510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032656806.1|1141520_1142225_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	66.7	1.5e-88
WP_149121038.1|1142329_1142563_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	66.7	8.6e-22
WP_149121037.1|1142592_1143135_+	regulator	NA	M9NZI6	Enterobacteria_phage	91.1	2.1e-87
WP_015571544.1|1143224_1143371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121036.1|1143363_1144263_+	DNA replication protein	NA	Q37929	Escherichia_phage	54.2	2.1e-79
WP_149121035.1|1144252_1145686_+	AAA family ATPase	NA	Q716D2	Shigella_phage	86.9	2.0e-230
WP_149121034.1|1145685_1146030_+	winged helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	98.2	4.2e-57
WP_047050266.1|1146026_1146230_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	78.1	1.5e-22
WP_149121033.1|1146226_1146562_+	hypothetical protein	NA	G8C7V0	Escherichia_phage	64.0	5.1e-07
WP_047359648.1|1147310_1147595_+	DUF4752 family protein	NA	K7PHN1	Enterobacterial_phage	45.7	8.1e-22
WP_097414431.1|1147739_1148021_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	51.6	2.3e-21
WP_032104836.1|1148233_1148689_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_149121032.1|1148688_1148859_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	94.3	1.2e-20
WP_149121031.1|1148851_1149463_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	72.4	2.9e-61
WP_063452511.1|1149459_1149684_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	80.6	4.8e-30
WP_045332081.1|1149680_1149821_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.0	2.0e-05
WP_149121030.1|1149817_1150507_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.9	2.9e-57
WP_063963200.1|1150756_1151263_+	HNH endonuclease	NA	A0A249Y0J7	Salmonella_phage	36.2	1.7e-14
WP_048961198.1|1151514_1151886_+	hypothetical protein	NA	A0A2D1GNJ3	Pseudomonas_phage	32.4	1.3e-06
WP_149121029.1|1151869_1152514_+	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	43.3	1.2e-36
WP_149121028.1|1152501_1152978_+	Rz lytic protein	NA	NA	NA	NA	NA
WP_149121026.1|1153256_1153898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149121025.1|1153952_1154171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121024.1|1154178_1154613_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	74.8	2.9e-47
WP_149121023.1|1154609_1155863_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	97.3	4.0e-214
WP_149121022.1|1156040_1157390_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	88.0	3.2e-233
WP_149121021.1|1157349_1158276_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.2	2.0e-162
WP_149121020.1|1158278_1159544_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	86.2	8.7e-209
WP_023300384.1|1159556_1160006_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	5.5e-65
WP_063928195.1|1160023_1161100_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.6	5.9e-190
WP_023296439.1|1161109_1161403_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	91.8	1.7e-43
WP_149121019.1|1161465_1161864_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	78.5	5.0e-54
WP_167497059.1|1161973_1162465_+	HNH endonuclease	NA	A0A2D2W633	Pectobacterium_phage	44.7	2.5e-23
WP_149121017.1|1162510_1162684_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	48.2	8.6e-11
WP_063158903.1|1162683_1163040_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	57.3	9.4e-28
WP_032652844.1|1163042_1163411_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	77.0	1.6e-46
WP_063946072.1|1163407_1163791_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.8	1.6e-41
WP_063946073.1|1163854_1164598_+	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	82.3	6.9e-73
WP_058681664.1|1164655_1165330_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	50.2	5.9e-55
WP_032668722.1|1165439_1165802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121016.1|1165859_1168376_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	37.2	8.6e-99
WP_047737995.1|1168375_1168873_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.3	1.3e-88
WP_149121015.1|1168872_1169343_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	91.7	1.7e-77
WP_149121386.1|1169356_1169722_+	NlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	91.6	1.1e-63
WP_047737989.1|1169708_1172186_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.4	0.0e+00
WP_167497060.1|1172244_1174305_+	hypothetical protein	NA	A0A1B1W279	Salmonella_phage	60.0	3.9e-49
WP_047737986.1|1174339_1175446_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	26.9	3.4e-15
WP_047737984.1|1175435_1176683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047737981.1|1176669_1177131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047737979.1|1177136_1178051_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	90.1	1.5e-157
WP_047738158.1|1178047_1178410_-	GtrA family protein	NA	U5P0S6	Shigella_phage	82.5	7.6e-49
WP_047737976.1|1178521_1178827_+	hypothetical protein	NA	I6PCW5	Cronobacter_phage	39.6	6.0e-15
WP_047737973.1|1178826_1180095_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.5	2.0e-229
1180391:1180441	attR	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATTAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP043438	Enterobacter sp. LU1 chromosome, complete genome	4636526	2176222	2217799	4636526	capsid,terminase,plate,portal,tail,protease,head	Shigella_phage(25.64%)	59	NA	NA
WP_149121374.1|2176222_2177503_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	53.0	1.0e-124
WP_149121373.1|2177502_2177715_-	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	54.3	2.4e-15
WP_149121372.1|2177868_2178057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149121371.1|2178083_2179931_-	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	32.6	5.8e-28
WP_149121370.1|2180198_2180363_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_149121369.1|2180362_2180785_-	tellurite/colicin resistance protein	NA	S4TU42	Salmonella_phage	78.6	2.4e-54
WP_167497062.1|2180873_2181065_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_058657198.1|2181015_2181210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149121367.1|2181196_2181514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058657253.1|2181704_2182205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058657203.1|2182435_2182846_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	50.4	1.1e-27
WP_058657205.1|2182926_2183166_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_058657207.1|2183165_2183579_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	67.7	6.6e-41
WP_058657254.1|2183610_2183853_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_058657255.1|2184029_2184209_+	HNH endonuclease	NA	H6WG01	Cyanophage	51.0	4.9e-09
WP_149121366.1|2184205_2185189_+	primosomal protein I	NA	A0A1C9IHW0	Salmonella_phage	69.9	1.1e-46
WP_058657210.1|2185211_2185868_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	29.2	5.8e-15
WP_058657211.1|2186279_2187041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058657213.1|2187172_2187478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115469782.1|2187504_2188491_+	hypothetical protein	NA	A0A0U1W0F5	Pseudomonas_phage	25.2	7.4e-06
WP_058657218.1|2188752_2189331_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	80.5	3.5e-88
WP_072202088.1|2189290_2190391_-	beta family protein	NA	A0A0U2S621	Escherichia_phage	73.6	6.9e-162
WP_072202087.1|2190834_2191035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121365.1|2191196_2191508_+	DUF968 domain-containing protein	NA	A0A2I7R4P0	Vibrio_phage	57.0	5.2e-22
WP_149121364.1|2191504_2192101_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	65.5	3.6e-72
WP_149121363.1|2192319_2192778_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_149121362.1|2192777_2193140_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_149121361.1|2193303_2193651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121360.1|2193643_2194000_+	serine/threonine protein kinase	NA	G4KK23	Yersinia_phage	60.3	3.5e-38
WP_149121359.1|2194106_2194652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121358.1|2194648_2195788_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_149121357.1|2196281_2196647_+	HNH endonuclease	NA	Q8SBD7	Shigella_phage	57.8	1.0e-32
WP_058657231.1|2196836_2197307_+|terminase	phage terminase small subunit P27 family	terminase	Q8W632	Enterobacteria_phage	91.7	1.8e-79
WP_149121356.1|2197303_2199034_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	90.9	0.0e+00
WP_165590720.1|2199030_2199192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121355.1|2199181_2200402_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	71.0	4.2e-168
WP_149121354.1|2200394_2200982_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	68.0	3.3e-70
WP_149121353.1|2200994_2202227_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	63.6	2.1e-143
WP_149121352.1|2202296_2202617_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	53.8	2.6e-24
WP_149121351.1|2202613_2203045_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	39.2	4.1e-17
WP_149121350.1|2203028_2203571_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	54.8	9.0e-46
WP_149121349.1|2203573_2204149_+	hypothetical protein	NA	Q8W624	Enterobacteria_phage	57.4	2.5e-54
WP_149121348.1|2204163_2205669_+|tail	phage tail protein	tail	Q8W623	Enterobacteria_phage	56.7	1.6e-153
WP_149121347.1|2205668_2206025_+|tail	phage tail protein	tail	Q8W622	Enterobacteria_phage	72.9	1.7e-45
WP_149121346.1|2206021_2206315_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	37.0	2.4e-13
WP_149121344.1|2206450_2208184_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	46.1	5.4e-92
WP_149121343.1|2208244_2208520_+	hypothetical protein	NA	Q8W619	Enterobacteria_phage	60.2	1.4e-26
WP_149121342.1|2208540_2209527_+	DNA circularization protein	NA	U5P4I0	Shigella_phage	39.3	1.3e-58
WP_149121341.1|2209523_2210618_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	53.6	1.4e-101
WP_149121340.1|2210617_2211361_+|plate	phage baseplate assembly protein V	plate	A0A192Y8K5	Salmonella_phage	61.2	1.1e-30
WP_149121339.1|2211357_2211774_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	55.9	2.4e-38
WP_149121338.1|2211766_2212834_+|plate	baseplate J/gp47 family protein	plate	Q8W615	Enterobacteria_phage	55.6	1.4e-114
WP_149121337.1|2212815_2213403_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	51.6	2.6e-54
WP_149121336.1|2213411_2214263_+	hypothetical protein	NA	O22004	Shigella_phage	61.1	9.5e-18
WP_149121335.1|2214265_2214691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153677157.1|2214680_2214845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149121334.1|2215035_2215998_+	hypothetical protein	NA	A0A0U2SH60	Escherichia_phage	28.1	1.1e-06
WP_032104106.1|2216372_2216648_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017693450.1|2216680_2217799_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	2.8e-33
>prophage 3
NZ_CP043438	Enterobacter sp. LU1 chromosome, complete genome	4636526	2477837	2484333	4636526		uncultured_Caudovirales_phage(57.14%)	8	NA	NA
WP_006810853.1|2477837_2478272_+	hypothetical protein	NA	B5BTV7	Ralstonia_phage	58.1	1.2e-05
WP_149121308.1|2478574_2479804_+	hypothetical protein	NA	A0A1W6DWU6	Sphingobium_phage	24.7	9.0e-09
WP_006810857.1|2480166_2480583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273865.1|2480719_2481277_+	recombinase family protein	NA	Q2A092	Sodalis_phage	42.5	2.1e-26
WP_006810858.1|2481444_2481870_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	6.8e-49
WP_047353327.1|2481885_2483175_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.3	3.4e-168
WP_006810860.1|2483221_2483542_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	7.0e-22
WP_149121307.1|2483631_2484333_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.8	3.5e-90
>prophage 4
NZ_CP043438	Enterobacter sp. LU1 chromosome, complete genome	4636526	2878428	2885865	4636526		Enterobacteria_phage(57.14%)	7	NA	NA
WP_047738840.1|2878428_2878977_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.9	1.7e-47
WP_048210193.1|2878979_2879858_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.4e-104
WP_047354497.1|2879903_2880803_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	33.8	1.7e-28
WP_047354496.1|2880799_2881888_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	1.6e-97
WP_047354495.1|2881891_2883016_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	2.4e-32
WP_047738844.1|2883402_2884299_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.8e-43
WP_032654200.1|2884473_2885865_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
>prophage 5
NZ_CP043438	Enterobacter sp. LU1 chromosome, complete genome	4636526	3348067	3472855	4636526	capsid,holin,terminase,portal,lysis,tRNA,tail,protease,integrase,head	Enterobacteria_phage(34.52%)	142	3381665:3381681	3480483:3480499
WP_149121396.1|3348067_3348616_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	79.4	3.8e-76
WP_017692897.1|3350138_3350369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032637826.1|3351464_3351734_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	83.1	1.5e-30
WP_149121243.1|3351741_3352371_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.1	9.6e-100
WP_026094305.1|3352370_3352652_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	2.8e-19
WP_015570936.1|3352638_3353025_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_047736739.1|3353203_3354175_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.0	1.3e-71
WP_006811580.1|3354736_3355108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121242.1|3355251_3356064_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	70.4	4.4e-105
WP_017692888.1|3356060_3356198_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	71.4	1.3e-09
WP_045343112.1|3356194_3356551_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	94.1	6.9e-63
WP_047736743.1|3356547_3356829_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	97.8	1.3e-45
WP_017692885.1|3356831_3357032_-	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	59.1	7.6e-19
WP_126340206.1|3357037_3357637_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	88.3	2.0e-99
WP_045341234.1|3358041_3358275_-	DinI family protein	NA	A0A0M4REN2	Salmonella_phage	77.9	5.8e-26
WP_032659798.1|3358431_3358848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032659802.1|3359296_3359677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304246.1|3360254_3360674_-	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	47.6	8.0e-10
WP_032654595.1|3360670_3360931_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	73.5	1.1e-28
WP_045349313.1|3360934_3361621_-	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
WP_032654601.1|3361632_3362325_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	59.6	1.3e-78
WP_032654604.1|3362308_3363301_-	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
WP_032659815.1|3363474_3363729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006811599.1|3363737_3364280_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	54.4	1.1e-46
WP_022651660.1|3364282_3364510_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	41.3	3.8e-14
WP_032645736.1|3364625_3365036_+	helix-turn-helix domain-containing protein	NA	A0A0H5BBV1	Pseudomonas_phage	42.0	1.5e-05
WP_022651662.1|3365334_3365520_+	YebW family protein	NA	NA	NA	NA	NA
WP_167497065.1|3365529_3365688_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	75.0	5.3e-15
WP_022651664.1|3365771_3366059_+	hypothetical protein	NA	H6WRX2	Salmonella_phage	67.4	5.4e-34
WP_032659825.1|3366181_3369247_+	exodeoxyribonuclease	NA	K7PJT5	Enterobacteria_phage	67.7	0.0e+00
WP_063959361.1|3369256_3370342_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	53.0	1.0e-104
WP_149121241.1|3370376_3370988_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	50.5	3.6e-43
WP_017692869.1|3370974_3371217_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	7.8e-34
WP_149121240.1|3371263_3371548_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	76.1	6.4e-35
WP_141421123.1|3371626_3372094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167497066.1|3372078_3372216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149121239.1|3372322_3373552_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	H6WRW7	Salmonella_phage	94.6	4.0e-235
WP_063946202.1|3373983_3374460_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_003860717.1|3374456_3375410_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_015572138.1|3375409_3376060_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3376091_3376667_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_017692868.1|3377092_3378712_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_017383553.1|3378696_3379434_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_017383554.1|3379566_3380895_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860727.1|3380947_3381331_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_003860729.1|3381646_3382336_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
3381665:3381681	attL	TGGCATGACGTGCTGGC	NA	NA	NA	NA
WP_017383555.1|3382375_3383461_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860733.1|3383665_3384085_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_047718866.1|3384155_3384854_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_063946201.1|3384889_3387553_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_006811620.1|3387662_3389018_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003860739.1|3389063_3389387_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_017383558.1|3389383_3390691_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	3.5e-43
WP_032619240.1|3390842_3391295_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	2.3e-34
WP_045337481.1|3396950_3399524_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	9.0e-128
WP_040118001.1|3399653_3400385_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_017383977.1|3400381_3401362_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863164.1|3401493_3402231_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863162.1|3402498_3402840_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100229775.1|3402945_3402993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022649058.1|3403100_3404261_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_047055254.1|3404257_3405130_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_149121238.1|3405190_3406312_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_006811632.1|3406322_3407393_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_032669369.1|3407605_3407980_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_032672087.1|3408133_3408670_+	YfiR family protein	NA	NA	NA	NA	NA
WP_017692859.1|3408662_3409883_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_017382956.1|3409895_3410381_+	OmpA family protein	NA	NA	NA	NA	NA
WP_047738490.1|3410383_3411754_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_023304265.1|3411792_3412197_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3412329_3412677_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003863138.1|3412720_3413488_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015571575.1|3413519_3414059_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3414074_3414323_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|3414439_3415801_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014832951.1|3415967_3416759_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026094274.1|3416778_3418065_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003863126.1|3418116_3418710_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_017383004.1|3418832_3419711_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_015571579.1|3419796_3421458_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071524123.1|3421432_3421615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003863121.1|3421596_3421935_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_017383006.1|3422043_3422331_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|3422320_3422797_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|3422914_3423397_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_149121237.1|3424121_3424361_+	DinI-like family protein	NA	K7P797	Enterobacteria_phage	94.9	1.2e-34
WP_149121236.1|3425652_3426618_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.0	7.4e-59
WP_149121235.1|3426619_3430459_-	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	60.4	0.0e+00
WP_045357639.1|3430512_3431097_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	53.1	1.9e-54
WP_023296258.1|3431096_3431807_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
WP_006809150.1|3431809_3432568_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	1.0e-95
WP_149121234.1|3432564_3432903_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	60.7	4.3e-38
WP_149121233.1|3432905_3436160_-|tail	phage tail tape measure protein	tail	K7PM96	Enterobacterial_phage	77.1	0.0e+00
WP_126496713.1|3436223_3436823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112001095.1|3436890_3437175_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	97.8	1.7e-43
WP_001549114.1|3437183_3437567_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_006809155.1|3437575_3438019_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_022648886.1|3438078_3438426_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_047731783.1|3438422_3438872_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	99.3	2.6e-75
WP_149121232.1|3438868_3439207_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	3.1e-36
WP_149121231.1|3439215_3439542_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	81.5	1.5e-48
WP_058679255.1|3439585_3440797_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.5	1.5e-194
WP_020898875.1|3440806_3441655_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.1	1.4e-138
WP_149121230.1|3441668_3442973_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.8	1.6e-234
WP_149121229.1|3442972_3444709_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.1	0.0e+00
WP_045326830.1|3444708_3445206_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	84.8	5.5e-74
WP_053004003.1|3445321_3445885_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_149121228.1|3445899_3446256_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	76.3	7.0e-47
WP_149121395.1|3446553_3447159_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	85.7	3.7e-101
WP_045626411.1|3447322_3447544_+	hypothetical protein	NA	Q38575	Escherichia_phage	69.9	6.3e-22
WP_149121227.1|3447655_3449113_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	91.1	1.2e-273
WP_149121226.1|3449185_3449767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121225.1|3450179_3450698_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	91.2	2.4e-80
WP_149121224.1|3450694_3451234_-	glycoside hydrolase family protein	NA	K7PM52	Enterobacteria_phage	79.8	8.5e-81
WP_008499363.1|3451235_3451484_-|lysis	phage lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	35.1	1.9e-06
WP_048209458.1|3451852_3452674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121394.1|3453204_3453549_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	80.5	1.0e-50
WP_149121223.1|3453626_3454598_-	DNA primase	NA	F1C597	Cronobacter_phage	79.3	6.1e-154
WP_149121222.1|3454594_3456214_-	DEAD/DEAH box helicase family protein	NA	F1C598	Cronobacter_phage	87.6	9.9e-282
WP_149121221.1|3456640_3456937_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	82.5	4.9e-30
WP_109740585.1|3456920_3457154_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	52.9	8.1e-12
WP_162876076.1|3457274_3457964_+	helix-turn-helix domain-containing protein	NA	F1C5C2	Cronobacter_phage	65.8	4.3e-85
WP_149121220.1|3458148_3458469_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	57.8	7.4e-24
WP_116363850.1|3458458_3458653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125366207.1|3458827_3459052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125366205.1|3459052_3459418_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	76.9	2.7e-46
WP_149121219.1|3459410_3459665_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	89.3	1.0e-36
WP_149121218.1|3459854_3460268_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	66.4	4.7e-47
WP_149121217.1|3460371_3460683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121216.1|3460836_3462012_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	94.8	5.1e-211
WP_023317197.1|3462500_3463409_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	97.0	2.4e-168
WP_149121215.1|3463728_3464922_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.4	2.1e-108
WP_128771958.1|3464965_3465712_-	hypothetical protein	NA	S5W9H2	Leptospira_phage	25.9	9.6e-06
WP_149121214.1|3465708_3466530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149121213.1|3467038_3467602_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.2	1.0e-60
WP_149121212.1|3467630_3467849_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	67.7	3.9e-16
WP_149121211.1|3467851_3468595_-|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_047737302.1|3469145_3469412_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	4.4e-30
WP_059353804.1|3469408_3469966_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.7	5.4e-30
WP_017692848.1|3469962_3470190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149121209.1|3470186_3470507_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_149121208.1|3470521_3472855_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.2	0.0e+00
3480483:3480499	attR	GCCAGCACGTCATGCCA	NA	NA	NA	NA
