The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043433	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 chromosome, complete genome	4685587	1414656	1420709	4685587		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|1414656_1414824_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|1414839_1414983_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|1415972_1417895_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|1417912_1418167_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|1418135_1418525_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|1419767_1420709_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 2
NZ_CP043433	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 chromosome, complete genome	4685587	1657142	1666313	4685587	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1657142_1658090_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1658073_1658805_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1658785_1658893_-	protein YohO	NA	NA	NA	NA	NA
WP_001240420.1|1658952_1659684_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_000272845.1|1659906_1661592_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1661588_1662308_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1662354_1662822_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1662878_1663409_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1663580_1664039_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1664279_1666313_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP043433	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 chromosome, complete genome	4685587	1733511	1744018	4685587		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1733511_1734915_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1735092_1735986_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1736362_1737448_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1737447_1738347_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1738394_1739273_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1739273_1739825_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1739830_1740805_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1740820_1741594_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1741598_1742678_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1742704_1744018_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP043433	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 chromosome, complete genome	4685587	1856941	1904437	4685587	plate,tail,terminase,head,protease,capsid,transposase,portal,integrase,holin	Salmonella_phage(78.18%)	65	1859842:1859856	1908032:1908046
WP_001680077.1|1856941_1858216_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_001675175.1|1858879_1859170_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
WP_000598920.1|1859541_1860339_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1859842:1859856	attL	AGGGATGCCGCTGGC	NA	NA	NA	NA
WP_000532847.1|1860630_1861620_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1861621_1861864_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061370.1|1861888_1862458_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000208076.1|1862454_1863318_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_000267991.1|1863314_1863608_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000065085.1|1863879_1864239_-	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000071068.1|1864235_1864751_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000764235.1|1864747_1864978_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1865048_1865588_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000551790.1|1865682_1866600_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_100228258.1|1866631_1866853_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	93.0	3.3e-15
WP_000078504.1|1867169_1867421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071590080.1|1867320_1867569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067433.1|1867496_1867682_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001020644.1|1867887_1868583_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_071529734.1|1868556_1868742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191666.1|1868680_1868905_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509728.1|1868933_1869488_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001087406.1|1869484_1870642_+	peptidase	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000620702.1|1870638_1870863_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096529.1|1870859_1871834_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000054227.1|1871830_1872304_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000200166.1|1872300_1873182_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000779149.1|1873190_1873580_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_001061459.1|1873596_1874457_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_012543375.1|1874464_1875454_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001047141.1|1875467_1876220_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_000357930.1|1876269_1877343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765639.1|1877355_1877928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|1878016_1878406_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226304.1|1878392_1878674_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001075993.1|1878673_1879291_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000127618.1|1879287_1879827_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001135228.1|1879850_1880201_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000501481.1|1880347_1880785_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_000257219.1|1880784_1882515_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_077905357.1|1882786_1883881_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000003793.1|1883873_1884476_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_000766103.1|1884485_1885715_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000927251.1|1885794_1886118_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000776844.1|1886114_1886519_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_001135695.1|1886490_1887003_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000779215.1|1886999_1887560_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_000497739.1|1887563_1887728_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007993.1|1887717_1889214_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000515952.1|1889213_1889570_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1889566_1889893_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785387.1|1889977_1891906_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000863817.1|1891939_1893280_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_001066630.1|1893276_1894335_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273650.1|1894334_1894868_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_000605050.1|1894872_1895286_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_000785580.1|1895278_1896358_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
WP_001207832.1|1896360_1896948_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554738.1|1896934_1898497_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_000760554.1|1898496_1899066_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000492926.1|1899350_1900358_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1900570_1900792_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_001752481.1|1901155_1901338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576155.1|1901730_1902108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176778.1|1902134_1902953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028172.1|1903414_1904437_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
1908032:1908046	attR	AGGGATGCCGCTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043433	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 chromosome, complete genome	4685587	2436624	2452568	4685587	tRNA,holin	Escherichia_phage(62.5%)	22	NA	NA
WP_001082296.1|2436624_2437059_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2437108_2437447_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000089155.1|2437439_2437592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802786.1|2438292_2438838_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2438834_2439116_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2439105_2439294_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2439215_2439611_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2441781_2442318_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2442314_2442605_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2442604_2443204_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|2443727_2443940_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556390.1|2444309_2445242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2445238_2445793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2445954_2446284_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2446556_2447024_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2447408_2447564_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2447671_2448193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2448630_2448852_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2448936_2449254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2449281_2449899_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2450215_2451151_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2451194_2452568_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP043433	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 chromosome, complete genome	4685587	2676993	2693108	4685587	tail,integrase,lysis,holin	Salmonella_phage(30.77%)	17	2673623:2673652	2693244:2693273
2673623:2673652	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|2676993_2677857_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|2680497_2681193_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2681282_2681816_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2682710_2683190_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2683207_2683660_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2683643_2683973_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2684248_2684935_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2685295_2685745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2686118_2686643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2686739_2687429_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2687558_2687786_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2687782_2688382_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|2688445_2688751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001676972.1|2689173_2689365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2689382_2691362_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2691775_2692054_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2692028_2693108_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2693244:2693273	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP043433	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 chromosome, complete genome	4685587	2865500	2906198	4685587	tail,protease	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|2865500_2866181_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2866799_2867459_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2867545_2867875_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2867871_2868153_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2868201_2868981_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2869006_2869555_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2869769_2870981_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2871038_2871356_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|2871400_2871817_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2871987_2872650_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2872744_2873203_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2873238_2875293_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2875416_2875863_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2875881_2878035_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2878021_2878627_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2878843_2879353_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2879709_2880762_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2880833_2881286_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2881471_2883232_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2883300_2883819_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2883918_2884086_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2884341_2884905_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2884901_2886542_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2886546_2887800_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2887814_2889722_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2889734_2891843_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2891941_2893051_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2893047_2893590_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2893755_2894766_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2894973_2897586_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2898012_2898204_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2898474_2899161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2899520_2900147_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2900794_2901763_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2901988_2902237_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2902240_2902822_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2902821_2904531_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2904527_2905154_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2905137_2905767_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|2905787_2906198_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 8
NZ_CP043433	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 chromosome, complete genome	4685587	2977477	2984790	4685587	integrase,protease	Ralstonia_phage(16.67%)	7	2972274:2972288	2983526:2983540
2972274:2972288	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2977477_2977855_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2978016_2978214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2978426_2980703_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2980733_2981054_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2981377_2981599_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2981728_2983675_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2983526:2983540	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2983671_2984790_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP043434	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 plasmid pPT1-1, complete sequence	59372	0	1905	59372		Stx_converting_phage(100.0%)	2	NA	NA
WP_015059604.1|1304_1466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751876.1|1518_1905_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	46.9	3.0e-27
>prophage 2
NZ_CP043434	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 plasmid pPT1-1, complete sequence	59372	11473	12031	59372		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000725064.1|11473_12031_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	37.4	5.8e-24
>prophage 3
NZ_CP043434	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 plasmid pPT1-1, complete sequence	59372	29215	36123	59372	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|29215_29638_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|29637_30912_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_077681951.1|30993_31971_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000427676.1|31967_33173_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|33587_34529_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|34525_35131_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|35187_35523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|35706_36123_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 4
NZ_CP043434	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 plasmid pPT1-1, complete sequence	59372	39671	40232	59372		Ralstonia_phage(100.0%)	1	NA	NA
WP_001240330.1|39671_40232_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
>prophage 5
NZ_CP043434	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 plasmid pPT1-1, complete sequence	59372	45738	45903	59372		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|45738_45903_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 6
NZ_CP043434	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 plasmid pPT1-1, complete sequence	59372	50845	51678	59372	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_000064919.1|50845_51271_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
WP_001541541.1|51327_51678_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 7
NZ_CP043434	Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 plasmid pPT1-1, complete sequence	59372	54738	55521	59372	integrase	Macacine_betaherpesvirus(100.0%)	1	51013:51024	57721:57732
51013:51024	attL	TATTTACCATCA	NA	NA	NA	NA
WP_000082169.1|54738_55521_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_000082169.1|54738_55521_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
57721:57732	attR	TGATGGTAAATA	NA	NA	NA	NA
