The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041699	Salmonella enterica subsp. enterica serovar Indiana strain FJC33 chromosome, complete genome	4941329	628081	722386	4941329	portal,holin,tail,capsid,terminase,plate,transposase,integrase,head	Cronobacter_phage(46.3%)	95	693940:693999	715402:716222
WP_023226578.1|628081_628480_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|628482_628788_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|628829_629198_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917512.1|629342_629726_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|629729_630392_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|630841_632086_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|632340_633309_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_023226577.1|633578_634577_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951045.1|634664_635357_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|635508_636006_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_023226576.1|636091_637228_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_023226575.1|637308_639327_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|639497_640877_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_064441647.1|641306_642827_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_000478462.1|643991_645560_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
WP_089541743.1|645556_646204_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023226573.1|646435_647203_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_001748617.1|647413_648451_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|648437_649331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|649359_649938_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|650057_650279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|650309_650813_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|650822_651050_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|651039_651465_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|651464_651866_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|652012_652189_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|652179_652776_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|652772_653102_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|653091_653952_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|653948_655970_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|656089_656296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|656269_656593_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|656589_657651_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|657647_659423_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|659583_660384_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|660445_661468_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|661471_662176_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|662179_662374_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_023181179.1|662470_662923_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	2.3e-63
WP_000084220.1|662919_663426_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|663422_664130_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|664126_665254_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|665250_665706_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|665715_666009_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|666005_666347_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|666346_666679_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|666825_667083_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|667270_669241_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|669237_669567_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|669563_670748_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|670740_671328_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_001215677.1|673349_673880_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|673869_674595_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|674566_675112_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000977529.1|675111_676815_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_001128281.1|677402_677564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290290.1|678028_679345_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	3.5e-35
WP_000268404.1|679474_680071_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
WP_001067855.1|680248_680953_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|681066_681843_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|682071_683097_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|683518_684271_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_170628443.1|686207_686567_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|686763_687854_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_149442391.1|687943_688759_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|688845_689148_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|689041_689293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|690217_690922_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|691006_691408_-	hypothetical protein	NA	NA	NA	NA	NA
693940:693999	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|693991_694696_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002914189.1|695015_696191_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_000347934.1|696214_699367_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|699436_699916_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|700007_700712_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000503573.1|700913_701702_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|701832_702306_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_000845048.1|702463_703477_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|703679_704030_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|704155_704716_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015059496.1|709559_709793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|710454_710685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|711021_711483_+	hypothetical protein	NA	A0A2H4IBJ0	Erwinia_phage	37.9	7.7e-14
WP_000074418.1|711512_711920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|711970_712288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|712664_713015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|714704_715409_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049824851.1|715418_715889_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_014839978.1|715908_716697_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
715402:716222	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGTAAAGGCGGCCTTATCCACCATTTCCCGAACAAGCAGGCGCTAATATTCGCCCTGTTCGCGCGTCTGCTGGCAATCATGGAAGAAGCGATTACCGCGCTGATGCAACAGGATGGCGTGAGCTATGGCCGGTTTACCCGCGCCTATCTGAACTATCTGGCGGATCTCACGGACACCCATGAAAGCCGCCAGCTTATGGTTTTGTCGCTGGCAATGCCCGATGAACCGGTGCTGCGCAAATGCTGGCGCGACTGGATGCTGGAGAAACTGGCGCAGGGCGATGAGCTGGATAACAGCCCAACCGGCACGCTGGTGCGCTACGCCGCTGACGGCATCTGGCTTTCGGAGTTGACGGAAGGGATCACCATGAGCGCCGACCACCGTCGCGCGCTGGTTGACTCCCTGAATAAAATGACGCTTCCCGCGTGAAGCACAGACTGAGGCCGCGATGCGCTACAACATCAATGCCCGTTTTATCTACGACGCCACCGACGGAACCCTGACGCTGCCGCAAAGCGATGAACCGGACAGCCAGCTATCCCTCACCGCCAGCGCCCTGTTTAACTATTTTCTGCGCCATACCGAGATTGTCAGCCGGGAAGATGTTCTGAAAAAAGTCTGGGATGACAATGGATTAACCTCATCCAACAGCAATCTGAATCAGTATCTCAGCATGCTGCGGAAGACCTTTCGCCATTACGGCGTCGATAACATCATCGTCACCGTCTCGCGCGGCTATTTGCAGCTTAATCCCGAGGTCAT	NA	NA	NA	NA
WP_014839979.1|716696_717215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|717219_717636_-	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
WP_001067858.1|718021_718726_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001235713.1|719030_719588_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|719770_720631_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|720800_721556_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067855.1|721681_722386_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP041699	Salmonella enterica subsp. enterica serovar Indiana strain FJC33 chromosome, complete genome	4941329	1313352	1395988	4941329	head,portal,holin,tail,capsid,terminase,transposase,integrase,tRNA	Cronobacter_phage(47.5%)	81	1321329:1321344	1350354:1350369
WP_000469807.1|1313352_1314120_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1314160_1314508_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1314663_1315884_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1315876_1316395_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1316834_1317905_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1317914_1319036_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1319093_1320002_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1319962_1321123_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1321222_1321270_-	hypothetical protein	NA	NA	NA	NA	NA
1321329:1321344	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1321433_1322426_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1322492_1322792_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1322900_1323239_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_172621893.1|1323403_1324631_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	3.8e-169
WP_149442398.1|1324606_1324933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1324942_1325512_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1325514_1325733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1325771_1328429_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_001264830.1|1328456_1328726_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	78.4	5.1e-34
WP_054175273.1|1328779_1329799_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_023375469.1|1331790_1332627_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1332661_1333690_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1333701_1334400_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1334498_1334951_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1334947_1335430_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1335426_1336131_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1336127_1337255_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1337251_1337707_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1337719_1338016_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1338012_1338354_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1338353_1338686_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1338832_1339090_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1339277_1341245_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1341241_1341571_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_001001824.1|1342743_1343331_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1343340_1345353_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1345355_1345886_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1345875_1346601_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|1346572_1347118_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_089541748.1|1347117_1348821_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.9e-223
WP_001748131.1|1349854_1350241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1350398_1350737_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1350354:1350369	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1351008_1351746_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1351877_1352858_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1352854_1353586_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1353715_1356289_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1362237_1362693_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1362796_1364098_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1364094_1364418_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1364462_1365818_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1365932_1368593_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1368646_1369327_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1369399_1369819_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1370022_1371060_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1371175_1371865_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1372183_1372567_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1372628_1373216_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1373318_1374218_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1374235_1375570_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1375699_1376437_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1376421_1378044_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1378307_1378472_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1378468_1379044_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1379075_1379726_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1379725_1380682_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1380678_1381158_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1381409_1383209_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1383225_1384200_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1384473_1385154_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1385150_1386056_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1386067_1386796_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1386807_1387539_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1387538_1387919_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1388030_1388291_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1388328_1389255_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1389370_1390567_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1390588_1391506_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1391543_1392392_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1392507_1393401_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1393411_1394773_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1394776_1395412_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1395436_1395988_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041699	Salmonella enterica subsp. enterica serovar Indiana strain FJC33 chromosome, complete genome	4941329	1607713	1614574	4941329	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1607713_1607860_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1607875_1608019_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1609008_1610931_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1610937_1611204_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1611172_1611562_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1611673_1612378_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1613632_1614574_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 4
NZ_CP041699	Salmonella enterica subsp. enterica serovar Indiana strain FJC33 chromosome, complete genome	4941329	1846132	1855303	4941329	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1846132_1847080_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1847063_1847795_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1847775_1847883_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1847942_1848674_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1848896_1850582_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1850578_1851298_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1851344_1851812_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1851868_1852399_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1852570_1853029_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1853269_1855303_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_CP041699	Salmonella enterica subsp. enterica serovar Indiana strain FJC33 chromosome, complete genome	4941329	1934335	1944842	4941329		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1934335_1935739_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1935916_1936810_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1937186_1938272_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1938271_1939171_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1939218_1940097_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1940097_1940649_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1940654_1941629_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1941644_1942418_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1942422_1943502_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1943528_1944842_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP041699	Salmonella enterica subsp. enterica serovar Indiana strain FJC33 chromosome, complete genome	4941329	2054964	2066254	4941329	integrase	Burkholderia_phage(25.0%)	12	2049218:2049233	2063565:2063580
2049218:2049233	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|2054964_2056146_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|2056146_2056893_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|2056994_2058251_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|2058731_2058893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|2059019_2059439_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|2059441_2060710_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|2061164_2061377_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2061387_2061576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|2061834_2063013_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|2063663_2063975_+	hypothetical protein	NA	NA	NA	NA	NA
2063565:2063580	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|2064054_2064750_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|2064823_2066254_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP041699	Salmonella enterica subsp. enterica serovar Indiana strain FJC33 chromosome, complete genome	4941329	2247003	2286159	4941329	integrase,protease,transposase	Shigella_phage(37.5%)	30	2263440:2263456	2278027:2278043
WP_023227614.1|2247003_2247600_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2247596_2248328_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2248346_2250140_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2250136_2251255_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2251748_2253014_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|2255576_2256804_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2258242_2260753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2260756_2263321_+	hypothetical protein	NA	NA	NA	NA	NA
2263440:2263456	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
WP_000716184.1|2263627_2263942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2263953_2264472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2264525_2265053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2265065_2265335_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2265455_2265836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2265993_2266536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2266558_2267047_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_172621894.1|2267174_2267570_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2267630_2267990_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2268099_2268717_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000213673.1|2268793_2269741_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.2e-10
WP_000870315.1|2269954_2270401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2270665_2270860_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2270861_2271734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165488789.1|2271943_2273172_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_001218334.1|2273428_2277331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2277652_2279338_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
2278027:2278043	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
WP_000151475.1|2279347_2280013_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2280013_2281411_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2283328_2284108_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2284749_2285088_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2285007_2286159_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
>prophage 8
NZ_CP041699	Salmonella enterica subsp. enterica serovar Indiana strain FJC33 chromosome, complete genome	4941329	2380491	2386303	4941329		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2380491_2381298_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2381299_2382292_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2382291_2383182_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2383305_2383707_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_170967352.1|2384006_2384891_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2385200_2385470_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2385824_2385965_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2386003_2386303_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 9
NZ_CP041699	Salmonella enterica subsp. enterica serovar Indiana strain FJC33 chromosome, complete genome	4941329	2850333	2857796	4941329	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2850333_2850573_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2851446_2852256_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2852328_2852706_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2852853_2853396_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2853587_2854316_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2854332_2854746_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2855696_2856821_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2857337_2857796_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 10
NZ_CP041699	Salmonella enterica subsp. enterica serovar Indiana strain FJC33 chromosome, complete genome	4941329	3680205	3735355	4941329	protease,coat,portal,terminase,lysis,transposase,integrase	Enterobacteria_phage(72.06%)	75	3688782:3688827	3731464:3731509
WP_089541817.1|3680205_3681433_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000062033.1|3682186_3682723_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000781485.1|3682784_3683546_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_064441706.1|3683529_3686091_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
WP_000899098.1|3686095_3687421_+	fimbrial usher protein StbD	NA	NA	NA	NA	NA
WP_023227313.1|3687386_3688145_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_023227314.1|3688192_3688387_-	hypothetical protein	NA	NA	NA	NA	NA
3688782:3688827	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3689115_3689478_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3689474_3690407_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3690396_3691854_+	glucosyltransferase domain-containing protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3691912_3693916_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3694051_3694300_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3694320_3694614_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3694752_3696729_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3696728_3698165_-	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3698175_3698865_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3698867_3699323_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3699322_3700024_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3700027_3701446_-	packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3701405_3701906_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3701889_3702450_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3702490_3703783_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3703782_3704691_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3704704_3706870_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3706870_3708370_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3708347_3708836_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3708839_3709244_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3709243_3709633_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3709636_3709879_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3710101_3710632_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3710844_3711312_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_089541817.1|3711796_3713024_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000286100.1|3713119_3713323_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3713753_3714527_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3714523_3714703_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3714683_3714887_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3714883_3715108_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3715104_3715716_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3715708_3715885_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3715877_3716219_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3716221_3716398_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3716364_3716538_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3716534_3716972_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3717045_3717315_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3717311_3718688_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3718684_3719506_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3719492_3719654_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3719688_3719970_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3720080_3720296_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3720406_3721096_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3721260_3722340_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3722378_3722582_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3722945_3723248_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3723260_3723848_-	super-infection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3724061_3724256_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3724339_3724954_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000713613.1|3724987_3725275_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3725550_3725865_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3725949_3726108_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_051129356.1|3726088_3726244_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	4.7e-24
WP_000902092.1|3726266_3726410_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3726406_3727114_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3727113_3727398_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3727444_3727738_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3727748_3727919_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3727915_3728425_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3728421_3728655_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_025617570.1|3728641_3729286_+	ead/Ea22-like family protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3729285_3729570_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3729562_3729847_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3729915_3730056_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3730285_3731449_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893225.1|3731654_3732905_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3731464:3731509	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3732916_3734020_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3734302_3735355_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 11
NZ_CP041699	Salmonella enterica subsp. enterica serovar Indiana strain FJC33 chromosome, complete genome	4941329	4350644	4414074	4941329	integrase,tRNA,protease,transposase	Vibrio_phage(18.18%)	53	4386393:4386409	4423230:4423246
WP_001232417.1|4350644_4351649_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312505.1|4351651_4352911_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_000460338.1|4353125_4354406_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051875.1|4354477_4354786_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001000734.1|4354868_4355819_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_023226964.1|4357675_4358998_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
WP_000981984.1|4359014_4359476_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000968675.1|4359447_4360995_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001615111.1|4360993_4362133_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001595273.1|4363217_4363958_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001271546.1|4364019_4364565_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
WP_000041945.1|4364671_4365724_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934949.1|4365815_4366784_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236755.1|4366802_4370129_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000074655.1|4370195_4370510_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000149872.1|4370561_4372064_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004797.1|4372289_4373267_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.7e-26
WP_001192954.1|4373589_4375380_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829509.1|4375372_4376107_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208749.1|4376117_4376513_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609650.1|4376523_4376883_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001221670.1|4376994_4377528_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.2e-47
WP_000118469.1|4377544_4377862_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000912959.1|4378117_4378705_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000239598.1|4378735_4378882_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_001595192.1|4378989_4379124_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_000257282.1|4379185_4379752_-	elongation factor P	NA	NA	NA	NA	NA
WP_017441214.1|4379792_4380821_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001229227.1|4381102_4381960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558210.1|4382007_4382361_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729126.1|4382604_4384251_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
WP_000027827.1|4384294_4384588_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_023227722.1|4384863_4386105_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267291.1|4386163_4386640_-	membrane protein FxsA	NA	NA	NA	NA	NA
4386393:4386409	attL	AAGCCAGCGATGATCAG	NA	NA	NA	NA
WP_000069440.1|4386980_4388417_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000637595.1|4388531_4389833_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000887832.1|4389953_4390301_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_001748740.1|4390276_4391980_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188504.1|4392016_4392592_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218742.1|4392960_4394145_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.7e-121
WP_000053331.1|4394294_4395305_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000253907.1|4395400_4397527_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001083368.1|4397589_4398867_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813678.1|4398866_4400297_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_001037798.1|4400491_4401886_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_023181049.1|4402825_4403101_-|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.8e-45
WP_001282653.1|4403956_4404712_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_023181050.1|4404728_4406264_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_024179174.1|4406973_4408647_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001238009.1|4408699_4408897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001100175.1|4409299_4410871_-	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_001207400.1|4410917_4411997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172621893.1|4412845_4414074_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	3.8e-169
4423230:4423246	attR	CTGATCATCGCTGGCTT	NA	NA	NA	NA
