The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043500	Xanthomonas translucens pv. undulosa strain P3 chromosome, complete genome	4618583	699757	753634	4618583	protease,transposase	Organic_Lake_phycodnavirus(18.18%)	44	NA	NA
WP_149569729.1|699757_700618_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	9.6e-42
WP_038237253.1|700614_700908_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003465899.1|701189_702404_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_087960474.1|702616_704704_+	S9 family peptidase	NA	F2Y2Z7	Organic_Lake_phycodnavirus	34.7	5.2e-25
WP_003465893.1|705021_705405_+	YbaN family protein	NA	NA	NA	NA	NA
WP_003465890.1|705489_705741_+	lipoprotein	NA	NA	NA	NA	NA
WP_003465888.1|705733_706588_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003465885.1|706584_707256_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_080964742.1|707252_708221_+	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	33.8	1.5e-14
WP_058364665.1|708288_708840_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_047324534.1|708954_710319_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	27.7	3.7e-40
WP_058364664.1|710557_711922_-	DUF2252 family protein	NA	NA	NA	NA	NA
WP_003465869.1|712031_713210_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_058364663.1|713269_715459_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003465861.1|715488_715944_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003465858.1|716066_716828_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_003465854.1|717018_718956_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_003465851.1|719088_720078_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	38.1	8.0e-08
WP_058364662.1|720074_720794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047324540.1|720784_721411_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003465839.1|723909_724842_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_003465837.1|725103_726150_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	1.6e-06
WP_058364661.1|726320_727391_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003465834.1|727387_727876_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_058364666.1|727883_729938_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003465831.1|729934_731053_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_058364660.1|731382_732720_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_003465827.1|732716_734126_+	endopolygalacturonase	NA	NA	NA	NA	NA
WP_047324542.1|734566_735703_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_058364659.1|735699_737202_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	49.4	2.1e-15
WP_003465820.1|737397_738609_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	41.5	3.2e-67
WP_149569730.1|739373_740336_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_047325537.1|740688_740919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058361876.1|740968_742027_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_053838422.1|742306_742585_+	DUF493 family protein	NA	NA	NA	NA	NA
WP_058364751.1|742572_743286_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003472348.1|743308_744319_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003472349.1|744559_746737_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.8	1.2e-80
WP_141697391.1|747051_747996_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_058361873.1|747880_748804_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058364752.1|748831_749710_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_003473577.1|749979_751035_+	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	45.0	1.3e-77
WP_003473576.1|751099_752524_+	nicotinate phosphoribosyltransferase	NA	A0A1B0V392	Roseobacter_phage	53.1	1.8e-130
WP_149569731.1|752671_753634_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP043500	Xanthomonas translucens pv. undulosa strain P3 chromosome, complete genome	4618583	1036532	1069202	4618583	protease,transposase	Leptospira_phage(10.0%)	21	NA	NA
WP_108084678.1|1036532_1037634_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	7.2e-42
WP_038237773.1|1038586_1039513_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.3	4.3e-24
WP_149569803.1|1039989_1044960_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_047324607.1|1045354_1048255_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003468853.1|1048284_1049229_+	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	35.1	1.7e-07
WP_047325550.1|1049529_1050207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047324608.1|1050815_1053239_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_047324345.1|1053307_1054279_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	34.1	2.8e-05
WP_003468858.1|1054684_1055260_-	bacterioferritin	NA	NA	NA	NA	NA
WP_003468860.1|1055295_1055778_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	37.0	1.3e-24
WP_003468862.1|1055947_1056415_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_058364747.1|1056551_1057448_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.9	1.3e-20
WP_003467543.1|1057729_1058113_-	response regulator	NA	W8CYM9	Bacillus_phage	33.0	9.6e-10
WP_038237239.1|1058195_1059200_-	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_003467541.1|1059342_1060488_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_003467539.1|1060484_1061345_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_003467537.1|1061521_1061707_+	DUF2065 family protein	NA	NA	NA	NA	NA
WP_003467534.1|1061976_1063269_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
WP_058364748.1|1063689_1064913_+	DUF1444 family protein	NA	NA	NA	NA	NA
WP_058361810.1|1065048_1067706_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	29.8	3.0e-78
WP_149569734.1|1068030_1069202_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	60.5	1.1e-88
>prophage 3
NZ_CP043500	Xanthomonas translucens pv. undulosa strain P3 chromosome, complete genome	4618583	1415414	1462580	4618583	protease,plate,transposase,tRNA	Vibrio_phage(16.67%)	40	NA	NA
WP_058364570.1|1415414_1417481_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_149569740.1|1417479_1417788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467096.1|1417736_1418189_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_087960486.1|1418442_1418832_-	VOC family protein	NA	NA	NA	NA	NA
WP_003467100.1|1418834_1419200_-	bleomycin resistance family protein	NA	NA	NA	NA	NA
WP_003467103.1|1419346_1420822_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_047324715.1|1420811_1421765_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003467112.1|1421932_1423810_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_003467117.1|1424103_1424877_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_058364571.1|1424882_1425560_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	26.4	4.6e-07
WP_108085092.1|1425564_1425711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003467122.1|1425729_1426179_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_003467126.1|1426326_1427190_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.2	1.0e-11
WP_058364579.1|1427389_1428013_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_058364572.1|1428271_1430914_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.0	1.5e-173
WP_003470922.1|1431065_1431668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003470923.1|1431751_1432786_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080964752.1|1432782_1433622_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003470927.1|1433677_1434100_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_081045896.1|1434143_1435256_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_003470932.1|1435278_1435749_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_038238953.1|1435926_1438695_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.9	3.6e-50
WP_003470934.1|1438860_1439529_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_003470935.1|1439766_1440504_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_003470936.1|1440637_1441204_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003470937.1|1441203_1442694_+	ribonuclease G	NA	NA	NA	NA	NA
WP_058364574.1|1442828_1446740_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_058364575.1|1446804_1448247_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_003467666.1|1448412_1449015_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_047324725.1|1449080_1450445_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_047324726.1|1450713_1451091_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_003467682.1|1451524_1452031_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_058364576.1|1452041_1453541_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467690.1|1453646_1454150_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003467692.1|1454187_1455030_+	ImpE protein	NA	NA	NA	NA	NA
WP_003467697.1|1455017_1455521_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_058364577.1|1455520_1457398_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_047324728.1|1457361_1458375_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_058364578.1|1458402_1461234_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.6	1.9e-78
WP_108084761.1|1461448_1462580_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.5	2.2e-54
>prophage 4
NZ_CP043500	Xanthomonas translucens pv. undulosa strain P3 chromosome, complete genome	4618583	2236435	2264330	4618583	terminase,tail,integrase	Siphoviridae_environmental_samples(40.91%)	37	2242633:2242652	2265876:2265895
WP_058364328.1|2236435_2236930_+	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	53.7	2.2e-35
WP_058364329.1|2236931_2237390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058195492.1|2237386_2237878_+	hypothetical protein	NA	Q2NPA5	Xanthomonas_phage	40.8	4.2e-26
WP_058364330.1|2238001_2238253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058364331.1|2238249_2238759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058364332.1|2238958_2239438_+|terminase	terminase small subunit	terminase	U5PZD3	Bacillus_phage	52.1	2.0e-09
WP_081045863.1|2239388_2240921_+|terminase	phage terminase large subunit	terminase	H9C0U8	Aeromonas_phage	38.7	5.8e-74
WP_058364333.1|2240920_2242297_+	DUF1073 domain-containing protein	NA	L7TRA1	Rhizobium_phage	53.6	3.9e-130
WP_058364334.1|2242300_2243434_+	DUF2213 domain-containing protein	NA	A0A2R3UA67	Siphoviridae_environmental_samples	57.0	4.0e-104
2242633:2242652	attL	CGCCGCGGCGATCACCGCCT	NA	NA	NA	NA
WP_058195497.1|2243437_2243884_+	DUF2190 family protein	NA	A0A2R3UAC1	Siphoviridae_environmental_samples	66.7	1.0e-42
WP_108085338.1|2243932_2244844_+	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	70.3	1.6e-119
WP_058195499.1|2244893_2245199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058195500.1|2245202_2245715_+	hypothetical protein	NA	A0A059VG19	Pseudomonas_phage	54.1	1.7e-41
WP_058364335.1|2245711_2246068_+	hypothetical protein	NA	A0A2D0W8Z7	Bordetella_virus	31.4	9.2e-07
WP_058364336.1|2246067_2247162_+	hypothetical protein	NA	M4R217	Salicola_phage	37.8	4.5e-60
WP_058195532.1|2247235_2247568_+	hypothetical protein	NA	A0A076G8G8	Sinorhizobium_phage	43.6	2.2e-15
WP_058363611.1|2247564_2247975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058195504.1|2248003_2248228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058195505.1|2248468_2248936_+	hypothetical protein	NA	W6EKF5	Rhizobium_phage	51.3	2.9e-37
WP_058363612.1|2249031_2249406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058363613.1|2249426_2249765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058364337.1|2249768_2253104_+	hypothetical protein	NA	A0A2R3UAA7	Siphoviridae_environmental_samples	33.7	5.1e-83
WP_058195509.1|2253103_2253436_+|tail	phage tail protein	tail	A0A2R3UA73	Siphoviridae_environmental_samples	51.8	1.3e-23
WP_058364338.1|2253445_2253952_+	hypothetical protein	NA	A0A2R3UA85	Siphoviridae_environmental_samples	40.2	1.3e-25
WP_058195511.1|2253951_2254227_+	hypothetical protein	NA	A0A0A0YUD8	Pseudomonas_phage	55.2	4.3e-12
WP_058195512.1|2254223_2254544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058364339.1|2254540_2255239_+|tail	phage minor tail protein L	tail	A0A2R3UA90	Siphoviridae_environmental_samples	71.7	2.6e-98
WP_058364353.1|2255303_2256047_+	C40 family peptidase	NA	A0A2R3UAR4	Siphoviridae_environmental_samples	57.6	3.1e-81
WP_058364340.1|2256043_2256649_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	54.6	6.3e-48
WP_058364341.1|2256645_2260137_+	host specificity protein J	NA	A0A2R3UA88	Siphoviridae_environmental_samples	58.8	0.0e+00
WP_141695968.1|2260136_2260529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141697342.1|2260528_2261263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149569750.1|2261429_2261630_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_141697344.1|2261622_2262147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058363619.1|2262133_2262364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058363620.1|2262360_2262624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058363621.1|2263370_2264330_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	47.9	3.0e-76
2265876:2265895	attR	CGCCGCGGCGATCACCGCCT	NA	NA	NA	NA
>prophage 5
NZ_CP043500	Xanthomonas translucens pv. undulosa strain P3 chromosome, complete genome	4618583	2353837	2386956	4618583	integrase,transposase	Xanthomonas_phage(44.44%)	32	2350737:2350754	2373816:2373833
2350737:2350754	attL	ATACGGATGGGCGAACCA	NA	NA	NA	NA
WP_149569749.1|2353837_2354972_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	63.5	4.9e-94
WP_038237253.1|2355311_2355605_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_108084895.1|2355601_2356462_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	3.3e-42
WP_058358319.1|2356514_2357234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081045949.1|2357619_2358732_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_108084546.1|2358643_2359448_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.7	5.0e-08
WP_058361713.1|2360195_2362130_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_047324923.1|2362126_2364157_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_058364688.1|2364244_2365333_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_080964775.1|2365437_2366382_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_081045917.1|2366305_2366965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003474447.1|2367516_2368686_-	hypothetical protein	NA	A0A077JGB2	Xanthomonas_phage	61.5	1.3e-134
WP_080603019.1|2368682_2369000_-	DUF2523 domain-containing protein	NA	A0A077JCZ2	Xanthomonas_phage	85.7	3.6e-47
WP_003474438.1|2370656_2370899_-	hypothetical protein	NA	A0A077JBM7	Xanthomonas_phage	73.5	1.3e-17
WP_087960554.1|2370904_2371099_-	hypothetical protein	NA	A0A077JGA5	Xanthomonas_phage	60.0	1.8e-09
WP_003474436.1|2371111_2371399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149569754.1|2371581_2372202_-	replication endonuclease	NA	NA	NA	NA	NA
WP_003474433.1|2372497_2372686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003474432.1|2372714_2372924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128809029.1|2372920_2373103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081045918.1|2373342_2373696_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080627710.1|2373837_2374233_+	hypothetical protein	NA	NA	NA	NA	NA
2373816:2373833	attR	TGGTTCGCCCATCCGTAT	NA	NA	NA	NA
WP_003472166.1|2374338_2376069_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.8	4.0e-39
WP_003472164.1|2376065_2376986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003472162.1|2376990_2377467_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_058359162.1|2377463_2380706_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_038239542.1|2380707_2381112_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_038239539.1|2381108_2382263_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_080964776.1|2382424_2383141_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_058364689.1|2383452_2384163_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_003471895.1|2384185_2385394_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_149569755.1|2385785_2386956_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	60.2	1.4e-88
>prophage 6
NZ_CP043500	Xanthomonas translucens pv. undulosa strain P3 chromosome, complete genome	4618583	2609289	2670862	4618583	transposase,tRNA	uncultured_Mediterranean_phage(12.5%)	55	NA	NA
WP_047324989.1|2609289_2610240_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_047324990.1|2610239_2611139_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	35.5	1.9e-24
WP_087960521.1|2611485_2613426_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	41.8	4.1e-117
WP_003471335.1|2613479_2614112_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_003471333.1|2614178_2614484_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_003471330.1|2614503_2614878_+	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_038239194.1|2615074_2615893_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_003471327.1|2615871_2616486_-	DedA family protein	NA	NA	NA	NA	NA
WP_003474035.1|2616550_2617228_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	4.6e-39
WP_003471322.1|2617224_2618004_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	55.6	2.9e-77
WP_003471319.1|2618105_2618639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081045847.1|2618655_2619720_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_058364122.1|2619716_2620208_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_087960520.1|2620280_2620985_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003471312.1|2620981_2621332_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_058362355.1|2621335_2622628_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	62.0	9.4e-142
WP_047324991.1|2622810_2623647_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.1	3.4e-52
WP_058362996.1|2623837_2625502_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.7	8.9e-145
WP_003471305.1|2625639_2625894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058364121.1|2626060_2627950_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	32.9	1.1e-90
WP_149569759.1|2628486_2630037_+	S10 family peptidase	NA	NA	NA	NA	NA
WP_058358990.1|2630141_2631263_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_003471294.1|2631348_2631975_-	DUF47 family protein	NA	NA	NA	NA	NA
WP_003471292.1|2632225_2633569_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003471285.1|2633552_2634203_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003471284.1|2634673_2635669_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003471283.1|2635968_2636775_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_058358988.1|2636871_2637612_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003471281.1|2637640_2638006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038239202.1|2638071_2638515_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_058364119.1|2638528_2639791_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_038239135.1|2639816_2642003_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	34.7	2.2e-18
WP_058364118.1|2642208_2643834_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_058364141.1|2643960_2645253_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_003471266.1|2645550_2645874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003471264.1|2645883_2646864_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003471263.1|2647053_2649543_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	4.5e-07
WP_058364117.1|2649539_2650493_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_058364116.1|2650587_2652315_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003470786.1|2652406_2653678_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_003470782.1|2654192_2654885_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003470779.1|2654893_2656312_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_047324998.1|2656518_2656950_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	32.5	1.2e-08
WP_003470770.1|2658402_2659536_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_058364115.1|2659532_2660297_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	2.1e-40
WP_003470766.1|2660293_2661199_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003470764.1|2661266_2662094_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_047325001.1|2662093_2662456_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047325002.1|2662452_2662851_+	EamA family transporter	NA	NA	NA	NA	NA
WP_149569760.1|2663187_2664308_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	8.4e-46
WP_081045951.1|2666795_2667203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108084998.1|2667478_2668704_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	69.9	1.4e-110
WP_149569761.1|2668900_2670072_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	60.5	2.9e-89
WP_146169985.1|2670092_2670572_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	30.2	2.7e-09
WP_038237253.1|2670568_2670862_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043500	Xanthomonas translucens pv. undulosa strain P3 chromosome, complete genome	4618583	3174729	3249032	4618583	holin,transposase	Leptospira_phage(30.0%)	59	NA	NA
WP_047324397.1|3174729_3175032_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	48.8	1.0e-11
WP_149569770.1|3175049_3175406_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_108084761.1|3175467_3176599_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.5	2.2e-54
WP_149569771.1|3177170_3177980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003466971.1|3178626_3179238_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038237018.1|3179377_3180298_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003466965.1|3180294_3182775_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_058364597.1|3183018_3184074_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_058364596.1|3184159_3185062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058364595.1|3186872_3187871_-	farnesyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_003466960.1|3188022_3189366_-	cytochrome P450	NA	NA	NA	NA	NA
WP_053838765.1|3189365_3190208_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.3e-14
WP_003466955.1|3190194_3190497_-	ferredoxin	NA	NA	NA	NA	NA
WP_058364592.1|3190498_3191788_-	cytochrome P450	NA	NA	NA	NA	NA
WP_038237017.1|3191880_3193083_-	cytochrome P450	NA	NA	NA	NA	NA
WP_081045898.1|3193091_3194054_-	cytochrome P450	NA	NA	NA	NA	NA
WP_141695984.1|3194356_3194692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003466948.1|3195057_3195411_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_038237024.1|3195495_3196803_-	MFS transporter	NA	NA	NA	NA	NA
WP_003466943.1|3196979_3198575_+|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	30.8	1.1e-51
WP_003466940.1|3198609_3199506_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003466936.1|3199787_3201176_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003466932.1|3201934_3202393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139115840.1|3202731_3203055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003466930.1|3203698_3204094_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003466929.1|3204206_3205313_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_149507761.1|3205280_3205535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003472763.1|3205715_3206147_-	NfeD family protein	NA	NA	NA	NA	NA
WP_003472760.1|3206150_3207119_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	33.3	4.3e-22
WP_139116015.1|3207228_3207315_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_003472758.1|3207462_3207786_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.9	3.6e-26
WP_081045912.1|3207782_3208712_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003472753.1|3208837_3209638_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_087960535.1|3209634_3210204_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_038240012.1|3210263_3211655_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.4	5.9e-09
WP_047325134.1|3211645_3212377_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_058364650.1|3212866_3215473_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003472212.1|3215838_3216861_-	ROK family protein	NA	NA	NA	NA	NA
WP_058364651.1|3217658_3220343_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_081045910.1|3220449_3222144_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_058361890.1|3222157_3223213_+	glycosyl hydrolase	NA	A0A2P1CFB9	Microbacterium_phage	23.8	1.3e-08
WP_047325137.1|3223268_3225758_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_058364652.1|3225775_3228475_+	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
WP_149569772.1|3228516_3231204_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_058363361.1|3231552_3234240_+	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
WP_047325140.1|3234239_3234434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003471177.1|3234565_3236023_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_003471175.1|3236131_3238474_+	alpha-1,2-mannosidase	NA	NA	NA	NA	NA
WP_058364653.1|3238598_3240446_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_141697110.1|3240753_3241329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149569773.1|3241325_3241742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149569774.1|3242060_3242948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081045911.1|3243502_3243754_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_058195942.1|3243792_3244026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141696173.1|3244053_3244263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627695.1|3244261_3244975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149569775.1|3244922_3245291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108084678.1|3245357_3246460_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	7.2e-42
WP_108084678.1|3247929_3249032_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	7.2e-42
>prophage 8
NZ_CP043500	Xanthomonas translucens pv. undulosa strain P3 chromosome, complete genome	4618583	3910693	3917037	4618583		Escherichia_phage(33.33%)	6	NA	NA
WP_003466794.1|3910693_3912040_+	phosphoglucomutase/phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	27.5	1.1e-31
WP_058361293.1|3912088_3913492_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.1	3.8e-48
WP_003466792.1|3913571_3914486_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.2	1.3e-25
WP_003466791.1|3914482_3915040_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.4	1.3e-44
WP_003466790.1|3915036_3915924_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.5	1.1e-93
WP_058364068.1|3915981_3917037_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.7	5.2e-74
