The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053572	Serratia marcescens strain S7.1 chromosome, complete genome	5088187	1604339	1613449	5088187		Hokovirus(16.67%)	8	NA	NA
WP_149558767.1|1604339_1605764_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.5	2.1e-54
WP_149558766.1|1605778_1607152_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	29.3	3.6e-35
WP_130017480.1|1607328_1608345_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.2	4.0e-79
WP_130017481.1|1608759_1609293_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	59.8	1.7e-60
WP_130017482.1|1609292_1610159_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	39.8	5.8e-39
WP_130017483.1|1610329_1611178_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_074054655.1|1611300_1612134_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_130017484.1|1612123_1613449_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.8e-15
>prophage 2
NZ_CP053572	Serratia marcescens strain S7.1 chromosome, complete genome	5088187	1952938	1956458	5088187	integrase	Pectobacterium_phage(33.33%)	6	1950313:1950329	1953619:1953635
1950313:1950329	attL	GCAGCATCGCCGCGCCG	NA	NA	NA	NA
WP_149559953.1|1952938_1953295_-|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	42.3	8.6e-13
WP_149559949.1|1953341_1953941_+	hypothetical protein	NA	H9C171	Pectobacterium_phage	31.2	2.2e-29
1953619:1953635	attR	GCAGCATCGCCGCGCCG	NA	NA	NA	NA
WP_149559948.1|1953931_1954240_+	hypothetical protein	NA	H9C171	Pectobacterium_phage	63.2	2.6e-18
WP_149559947.1|1954354_1955365_+	hypothetical protein	NA	I6NRL3	Burkholderia_virus	48.9	1.1e-86
WP_175089902.1|1955642_1956086_-	hypothetical protein	NA	U5P096	Shigella_phage	35.5	6.1e-16
WP_149559945.1|1956257_1956458_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	47.3	6.3e-05
>prophage 3
NZ_CP053572	Serratia marcescens strain S7.1 chromosome, complete genome	5088187	2121515	2152738	5088187	protease,coat	Moraxella_phage(33.33%)	26	NA	NA
WP_149559631.1|2121515_2122448_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_175089996.1|2122468_2124889_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_107226900.1|2124956_2125721_-	molecular chaperone	NA	NA	NA	NA	NA
WP_165384381.1|2125745_2126294_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025302583.1|2126299_2126803_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_063989658.1|2126805_2127345_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_149559632.1|2127619_2129056_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_063989660.1|2129158_2131789_-	PqiB family protein	NA	NA	NA	NA	NA
WP_063990337.1|2131757_2133005_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_019454877.1|2133260_2133758_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_149559633.1|2133854_2134565_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033642845.1|2134584_2136633_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.5e-85
WP_033638291.1|2136943_2137822_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_149559634.1|2138059_2138767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063989663.1|2138867_2140262_-	MFS transporter	NA	NA	NA	NA	NA
WP_149559635.1|2140494_2141286_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_063989665.1|2141332_2142136_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_130017967.1|2142138_2143002_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_130017968.1|2143003_2144140_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.2	2.2e-25
WP_149559636.1|2144136_2145147_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_149559637.1|2145321_2146041_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_063989668.1|2146196_2147300_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_063989669.1|2147309_2148119_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_004931456.1|2149753_2150302_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.1	1.4e-06
WP_149559638.1|2150727_2151393_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_107226891.1|2151457_2152738_-|protease	protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP053572	Serratia marcescens strain S7.1 chromosome, complete genome	5088187	3406529	3427982	5088187	tail,holin	Klebsiella_phage(27.78%)	25	NA	NA
WP_149559607.1|3406529_3408011_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1I9SF20	Klebsiella_phage	40.7	5.9e-31
WP_149559606.1|3408014_3409172_-|tail	tail fiber domain-containing protein	tail	A0A1V0E5M2	Salmonella_phage	51.9	1.4e-48
WP_149559605.1|3409221_3410211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149559604.1|3410212_3413419_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	63.9	0.0e+00
WP_149559603.1|3413472_3414099_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	54.7	3.7e-51
WP_130017857.1|3414156_3414516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130017856.1|3414882_3415221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130017855.1|3415258_3415963_-	C40 family peptidase	NA	K7PGR2	Enterobacteria_phage	74.9	2.4e-107
WP_165384378.1|3415972_3416725_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	65.2	2.4e-97
WP_004935824.1|3416734_3417073_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.0	1.1e-33
WP_149559602.1|3417072_3419412_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.1	2.9e-16
WP_149559601.1|3419404_3419626_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	53.5	2.9e-11
WP_149559600.1|3419643_3420009_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	45.0	6.5e-24
WP_016926946.1|3420132_3420588_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	74.8	1.2e-56
WP_130017850.1|3420629_3421022_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	46.8	1.6e-20
WP_130017849.1|3421018_3421408_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	42.1	2.4e-24
WP_149559599.1|3421464_3421905_-	glycoside hydrolase family protein	NA	A0A0M5M782	Salmonella_phage	61.6	7.5e-43
WP_019453678.1|3421891_3422212_-|holin	phage holin family protein	holin	F1C5D1	Cronobacter_phage	81.0	2.5e-40
WP_019453679.1|3423005_3423368_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	1.6e-38
WP_130017847.1|3423577_3424255_+	S26 family signal peptidase	NA	K7PK07	Enterobacteria_phage	43.2	5.1e-06
WP_025303630.1|3424679_3425009_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_063989015.1|3425136_3425604_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_107227620.1|3425711_3426290_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063989013.1|3426283_3426700_-	VOC family protein	NA	NA	NA	NA	NA
WP_025303634.1|3426851_3427982_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.3	8.8e-104
>prophage 5
NZ_CP053572	Serratia marcescens strain S7.1 chromosome, complete genome	5088187	3803835	3899495	5088187	tail,portal,terminase,protease,integrase,tRNA,holin	Enterobacterial_phage(19.61%)	95	3856855:3856876	3899735:3899756
WP_025159556.1|3803835_3805110_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016929756.1|3805249_3806371_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_063990535.1|3806416_3807391_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_063990649.1|3807380_3808130_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_063990536.1|3808228_3809425_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_004941424.1|3809662_3810088_-	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	37.3	3.5e-13
WP_130018141.1|3810250_3811081_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_063990538.1|3811170_3812466_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.1	7.7e-35
WP_006327336.1|3812689_3812890_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_046897754.1|3812922_3813258_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_149559481.1|3813260_3815111_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.1	1.8e-101
WP_063990540.1|3815143_3815665_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004941410.1|3815727_3816051_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	1.2e-21
WP_004941408.1|3816105_3816492_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.7	2.2e-54
WP_016929764.1|3816516_3817731_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	33.1	2.5e-35
WP_004941404.1|3817785_3818280_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_025303916.1|3818473_3819208_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_004941400.1|3819327_3820131_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_130018139.1|3820187_3821210_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_033651572.1|3821200_3821836_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_063990545.1|3823285_3824431_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_025303922.1|3824587_3825841_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.3	1.7e-100
WP_149559482.1|3826198_3827389_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_107227807.1|3827426_3828611_-	cytochrome c	NA	NA	NA	NA	NA
WP_149559483.1|3828607_3830518_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_149559484.1|3830598_3832023_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_033648928.1|3832058_3832865_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025303927.1|3832854_3833799_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_063990551.1|3833800_3834829_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	5.7e-25
WP_033635611.1|3834882_3836037_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_149559485.1|3836110_3837574_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_149559486.1|3837689_3838613_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004847623.1|3838828_3839167_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_063990554.1|3839178_3840801_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.5	1.4e-94
WP_025303931.1|3840931_3842272_-	two-component system response regulator GlrR	NA	NA	NA	NA	NA
WP_107227802.1|3842268_3843141_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_107227801.1|3843144_3844581_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.7	9.8e-15
WP_175090014.1|3845468_3849362_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	3.6e-128
WP_063990557.1|3849636_3851097_+	membrane-bound lytic murein transglycosylase MltF	NA	G0YQ82	Erwinia_phage	38.8	4.8e-09
WP_063990558.1|3851097_3851604_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	32.2	4.5e-07
WP_100396633.1|3851721_3852774_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_149559488.1|3852821_3853478_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_107227800.1|3853481_3854849_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_063990562.1|3854867_3855761_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_016929788.1|3855928_3856777_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
3856855:3856876	attL	TGTATCAACTGCGACATGTGCG	NA	NA	NA	NA
WP_149559489.1|3857077_3857317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149559490.1|3857446_3858217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149559491.1|3860534_3863882_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	58.3	1.2e-297
WP_149559492.1|3863942_3864449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149559493.1|3864551_3865151_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	65.1	1.7e-61
WP_149559494.1|3865184_3865610_-	hypothetical protein	NA	A0A1B0VMK5	Pseudomonas_phage	41.4	3.8e-23
WP_149559541.1|3865653_3866355_-	Mov34/MPN/PAD-1 family protein	NA	A0A1W6JP31	Morganella_phage	59.3	1.5e-80
WP_149559495.1|3866357_3867107_-|tail	phage minor tail protein L	tail	K7P6G9	Enterobacteria_phage	59.6	1.9e-86
WP_079450662.1|3867115_3867469_-|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	42.1	3.2e-20
WP_149559496.1|3867468_3870594_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	30.8	3.4e-113
WP_060431778.1|3870586_3870886_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	56.6	1.5e-23
WP_149559542.1|3870906_3871317_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	43.6	5.8e-21
WP_046898588.1|3871361_3872099_-|tail	phage tail protein	tail	K7P6G8	Enterobacteria_phage	66.9	1.5e-88
WP_089196901.1|3872110_3872512_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	4.3e-45
WP_170913160.1|3872508_3873078_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.7	4.4e-51
WP_043138198.1|3873082_3873358_-	ATP-binding protein	NA	K7PH55	Enterobacterial_phage	51.2	2.2e-16
WP_033646496.1|3873350_3873674_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	58.9	8.0e-26
WP_149559497.1|3873759_3875784_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	K7PKX4	Enterobacterial_phage	75.9	7.4e-295
WP_149559498.1|3875725_3877237_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	70.9	1.1e-205
WP_033646499.1|3877233_3877449_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	71.4	4.4e-20
WP_149559499.1|3877445_3879551_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	71.6	2.7e-308
WP_149559500.1|3879550_3880045_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	64.6	1.9e-50
WP_149559543.1|3880554_3880758_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	70.5	2.8e-16
WP_101456476.1|3880953_3881373_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_149559501.1|3881369_3881996_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	62.2	1.1e-68
WP_060446429.1|3882000_3882279_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	44.8	2.5e-12
WP_033655082.1|3882268_3882655_-	hypothetical protein	NA	F1C592	Cronobacter_phage	43.5	8.1e-17
WP_149559502.1|3882728_3883757_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	62.1	2.8e-120
WP_149559503.1|3884056_3884542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149559504.1|3884543_3884825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149559505.1|3884894_3885122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149559506.1|3885326_3885998_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	44.5	1.1e-45
WP_149559507.1|3885994_3886573_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	64.1	6.0e-40
WP_033655077.1|3886556_3887543_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	61.3	7.2e-110
WP_046687494.1|3887539_3889069_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	66.0	4.9e-198
WP_033653818.1|3889255_3889555_-	hypothetical protein	NA	A0A0N7BYT1	Escherichia_phage	45.3	1.9e-13
WP_149559508.1|3889589_3890123_-	DNA-binding protein	NA	S5FXP0	Shigella_phage	53.5	1.1e-43
WP_060559931.1|3890181_3890394_-	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	53.7	5.4e-07
WP_149559509.1|3890501_3891212_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	67.2	4.0e-86
WP_139639883.1|3891628_3891823_+	hypothetical protein	NA	G1CSS4	Cronobacter_virus	45.2	3.2e-06
WP_149559510.1|3892552_3892915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149559511.1|3892957_3893779_+	DUF2303 family protein	NA	R9TSA8	Rhizobium_phage	29.4	1.6e-17
WP_060437564.1|3893851_3894685_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	59.4	3.3e-87
WP_046687501.1|3894681_3894900_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.7	7.8e-09
WP_149559512.1|3894920_3895796_+	DNA cytosine methyltransferase	NA	A0A120HUM8	Bacillus_phage	26.2	6.1e-20
WP_126179973.1|3896015_3896306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126179974.1|3896333_3897227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149559513.1|3897301_3897871_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	63.7	6.3e-66
WP_072021608.1|3897885_3898101_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149559514.1|3898097_3899495_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3899735:3899756	attR	TGTATCAACTGCGACATGTGCG	NA	NA	NA	NA
>prophage 6
NZ_CP053572	Serratia marcescens strain S7.1 chromosome, complete genome	5088187	4696820	4705751	5088187		environmental_Halophage(16.67%)	7	NA	NA
WP_107227957.1|4696820_4698899_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	71.9	1.3e-52
WP_107227958.1|4698939_4700157_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.3	1.2e-26
WP_063991677.1|4700288_4700864_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.6	3.0e-68
WP_063991678.1|4700936_4702463_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.3	1.5e-77
WP_046688553.1|4702614_4703340_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_130018343.1|4703339_4705025_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.7	2.0e-224
WP_063991680.1|4705181_4705751_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.0	1.7e-07
