The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043504	Lysinimonas sp. KACC 19322 chromosome, complete genome	2557894	772617	779800	2557894	protease,tRNA	Streptomyces_phage(16.67%)	7	NA	NA
WP_149324603.1|772617_773889_+	NlpC/P60 family protein	NA	A0A1J0GW44	Streptomyces_phage	45.5	1.9e-17
WP_149324604.1|773908_774400_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	49.7	1.6e-38
WP_149326171.1|774484_775549_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_149324605.1|775647_776199_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	28.2	6.2e-10
WP_149324606.1|776381_778397_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.6	8.9e-107
WP_149324607.1|778403_779006_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	47.0	8.8e-34
WP_149324608.1|779002_779800_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.5	4.6e-22
>prophage 2
NZ_CP043504	Lysinimonas sp. KACC 19322 chromosome, complete genome	2557894	1396713	1446899	2557894	integrase,protease,tRNA,transposase	Agrobacterium_phage(20.0%)	46	1431728:1431748	1457309:1457329
WP_149325127.1|1396713_1397712_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_149325128.1|1397817_1398297_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_149325129.1|1398549_1399140_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	51.4	1.3e-42
WP_149326228.1|1399211_1399868_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	45.5	1.2e-39
WP_149325130.1|1399951_1400530_-	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_149325131.1|1400526_1401258_-	DUF1775 domain-containing protein	NA	NA	NA	NA	NA
WP_149325132.1|1401331_1401928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149325133.1|1402041_1403319_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.2	7.6e-136
WP_149325134.1|1403394_1404582_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_149325135.1|1404529_1404982_-	aromatic ring-opening dioxygenase LigA	NA	NA	NA	NA	NA
WP_149325136.1|1405000_1406272_+	MFS transporter	NA	NA	NA	NA	NA
WP_149325137.1|1406264_1408292_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_149325138.1|1408405_1409209_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_149325139.1|1409254_1409446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149325140.1|1409445_1409889_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_149325141.1|1409890_1412551_-|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	37.1	4.9e-153
WP_149326229.1|1412685_1413039_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149325142.1|1413035_1414058_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_149325143.1|1414340_1417529_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	34.3	3.2e-151
WP_149325144.1|1417704_1419084_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_149325145.1|1419080_1419545_+	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_149325146.1|1419541_1419967_+	nucleoside-diphosphate kinase	NA	A0A2K9L0Y6	Tupanvirus	43.8	1.6e-26
WP_168200393.1|1420043_1420880_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_149325148.1|1420945_1421608_-	vitamin K epoxide reductase family protein	NA	NA	NA	NA	NA
WP_149325149.1|1421934_1424211_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_149325150.1|1424427_1424706_-	DUF4031 domain-containing protein	NA	NA	NA	NA	NA
WP_149325151.1|1424776_1425316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149325152.1|1425463_1425772_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_149325153.1|1425786_1426041_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_149325154.1|1426138_1427644_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_149325155.1|1427640_1428426_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	47.4	7.9e-35
WP_149325156.1|1428471_1429386_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_149325157.1|1429472_1430204_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149325158.1|1430333_1431599_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.8	4.2e-94
WP_149325159.1|1431663_1431852_+	hypothetical protein	NA	NA	NA	NA	NA
1431728:1431748	attL	TCGCGGCGGTCGCCGCCGCCA	NA	NA	NA	NA
WP_149325160.1|1431861_1432464_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_168200394.1|1432460_1434209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149325161.1|1434234_1434609_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_149326230.1|1434953_1435175_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149325162.1|1435171_1436458_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4B2E0	Arthrobacter_phage	34.5	7.8e-48
WP_149325163.1|1436843_1437356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149325164.1|1437526_1442917_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_149325165.1|1442924_1444817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149325166.1|1444900_1445122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149325167.1|1445118_1445424_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_149324224.1|1445714_1446899_-|transposase	IS481 family transposase	transposase	A0A1U8Y5U2	Small_ruminant_lentivirus	31.0	1.1e-06
1457309:1457329	attR	TCGCGGCGGTCGCCGCCGCCA	NA	NA	NA	NA
