The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	1084821	1091961	5000290		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1084821_1085460_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590384.1|1085456_1086719_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_000847985.1|1086715_1087624_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1087819_1088587_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|1088637_1089294_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1089399_1091961_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	1671394	1680836	5000290		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|1671394_1672321_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1672325_1673057_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1673037_1673145_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1673204_1673936_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1674157_1675843_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1675839_1676559_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1676605_1677076_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1677116_1677578_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|1677702_1679703_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1679699_1680836_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 3
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	1720812	1783397	5000290	tRNA,holin,capsid,protease,head,terminase,integrase,portal,tail,lysis	Enterobacteria_phage(36.76%)	78	1724045:1724060	1745591:1745606
WP_000476011.1|1720812_1722174_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001220181.1|1722276_1722573_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1722574_1722871_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000137873.1|1723602_1724325_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
1724045:1724060	attL	ATCTCTTCGATTTTTG	NA	NA	NA	NA
WP_000675149.1|1724321_1725725_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	1.6e-33
WP_000130867.1|1725721_1727137_-	MFS transporter	NA	NA	NA	NA	NA
WP_000667541.1|1727137_1730215_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001197868.1|1730215_1733338_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000678962.1|1733337_1734585_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_024234252.1|1734928_1736002_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	94.7	1.2e-190
WP_039264506.1|1735979_1736198_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
WP_001504522.1|1736282_1736906_-	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	93.3	1.3e-104
WP_001504521.1|1737228_1737789_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	5.2e-97
WP_001504519.1|1738021_1738306_-	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	89.4	2.8e-43
WP_024238365.1|1738305_1738527_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	2.1e-33
WP_001308571.1|1738625_1738907_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_032240676.1|1738917_1739109_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
WP_032240674.1|1739081_1739264_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	93.3	5.3e-27
WP_000186789.1|1739260_1739941_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	7.9e-132
WP_000100844.1|1739937_1740723_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995439.1|1740728_1741025_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000358700.1|1741099_1741243_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_001198858.1|1741235_1741376_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_024232243.1|1741448_1741817_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_000213975.1|1741999_1742200_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_157912242.1|1742324_1742462_-	hypothetical protein	NA	Q716D9	Shigella_phage	97.8	2.5e-21
WP_001504518.1|1742470_1742812_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	64.6	5.7e-30
WP_000528775.1|1743255_1744032_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_024167659.1|1744019_1744562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000250469.1|1744659_1745367_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.3	3.7e-132
WP_001180318.1|1745445_1745673_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
1745591:1745606	attR	CAAAAATCGAAGAGAT	NA	NA	NA	NA
WP_001504516.1|1745779_1746076_+	bacteriophage CII family protein	NA	A0A0N7KZD0	Stx2-converting_phage	96.9	8.3e-46
WP_052905266.1|1746108_1747008_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	98.0	5.7e-170
WP_032313406.1|1747004_1747706_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	2.2e-129
WP_000145894.1|1747702_1747993_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000229809.1|1748065_1748272_+	hypothetical protein	NA	G9L683	Escherichia_phage	94.1	1.1e-25
WP_000810176.1|1748279_1748726_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|1748722_1749250_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254221.1|1749246_1749429_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_001108084.1|1752278_1752845_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223933.1|1752819_1753422_+	hypothetical protein	NA	A0A1U9AJF8	Stx1_converting_phage	95.1	1.2e-91
WP_001505172.1|1753418_1754084_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	1.3e-131
WP_001235460.1|1754080_1754704_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|1754956_1755700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1755785_1755944_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_033816266.1|1756024_1756423_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284515.1|1756565_1756781_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001504032.1|1756780_1757278_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	99.4	2.6e-92
WP_001504033.1|1757274_1757742_+|lysis	lysis protein	lysis	H6WZK2	Escherichia_phage	97.4	9.4e-76
WP_001504034.1|1757941_1758466_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.6	1.0e-86
WP_001307652.1|1758760_1758955_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|1759344_1759890_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_149617691.1|1759864_1761790_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|1761786_1761993_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_053897481.1|1761989_1763591_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.9e-310
WP_000123236.1|1763571_1764891_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001299443.1|1764900_1765233_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_032209073.1|1765287_1766313_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	2.0e-187
WP_072162251.1|1766354_1766750_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
WP_053881501.1|1766761_1767115_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.3e-61
WP_000975054.1|1767127_1767706_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000683141.1|1767702_1768098_+|tail	phage tail protein U	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_053888056.1|1768105_1768846_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	6.6e-132
WP_000479153.1|1768861_1769284_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1769265_1769700_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_053888054.1|1769692_1772254_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.3	0.0e+00
WP_053888053.1|1772250_1772580_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152639.1|1772579_1773278_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_053890196.1|1773283_1774027_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_149617692.1|1773963_1774596_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.1e-95
WP_114107255.1|1774655_1778054_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.5	0.0e+00
WP_053891246.1|1778120_1778720_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	2.6e-110
WP_000268905.1|1778784_1780098_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001023459.1|1780099_1780369_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000767050.1|1780589_1781132_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106409363.1|1781076_1781271_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_024167648.1|1781261_1781822_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	62.8	5.4e-62
WP_001504413.1|1782155_1783397_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	86.2	1.1e-219
>prophage 4
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	1859485	1947109	5000290	holin,capsid,head,terminase,integrase,portal,tail,transposase	Enterobacteria_phage(31.25%)	81	1881662:1881678	1909664:1909680
WP_000399648.1|1859485_1860466_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000450409.1|1861250_1861580_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001367878.1|1861680_1861815_-	ethanolamine utilization - propanediol utilization domain protein	NA	NA	NA	NA	NA
WP_000973170.1|1862038_1862584_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|1862580_1863324_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193798.1|1863335_1864415_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_072162245.1|1864476_1865412_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011461.1|1865869_1866787_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011030.1|1866888_1867839_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532923.1|1870215_1870932_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1871271_1872726_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378564.1|1872827_1874144_-	shikimate transporter	NA	NA	NA	NA	NA
WP_024232295.1|1874458_1875511_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
1881662:1881678	attL	AAGCTGTTTCTGCATTG	NA	NA	NA	NA
WP_024232503.1|1885123_1886857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024232502.1|1887049_1887934_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_053887996.1|1888788_1889049_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_024232500.1|1889198_1889453_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.2	9.4e-14
WP_024232499.1|1889449_1889911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024232498.1|1890523_1891702_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_024232497.1|1891704_1896312_+	DUF4150 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.3	1.4e-22
WP_053272361.1|1896329_1896734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024232530.1|1896898_1898161_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	36.1	1.6e-69
WP_001302302.1|1898502_1899300_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533619.1|1899535_1900561_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_000067202.1|1900560_1900764_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_024232529.1|1900822_1903294_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	1.5e-58
WP_000854559.1|1903574_1903763_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001340038.1|1904163_1904328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171943.1|1904331_1904550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379593.1|1904709_1904865_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003379.1|1905056_1905464_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|1905541_1905769_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705374.1|1905752_1906304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020543.1|1906275_1907316_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.9e-89
WP_157861261.1|1907227_1907770_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	9.8e-85
WP_001340033.1|1907876_1908077_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	93.9	5.9e-11
WP_001227887.1|1908516_1909359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000827088.1|1910397_1911771_+	ATP-binding protein	NA	NA	NA	NA	NA
1909664:1909680	attR	AAGCTGTTTCTGCATTG	NA	NA	NA	NA
WP_001124204.1|1911757_1912393_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_122993170.1|1912497_1912605_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	84.8	9.4e-08
WP_000887487.1|1912649_1912862_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	81.4	1.1e-23
WP_000980999.1|1913078_1913330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032312299.1|1913396_1913675_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_024232456.1|1913676_1914726_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	2.1e-107
WP_001217464.1|1914738_1915098_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	2.0e-38
WP_001064889.1|1915094_1915784_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	9.6e-61
WP_000216649.1|1916842_1917010_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
WP_097729387.1|1917324_1919175_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.6	0.0e+00
WP_053897820.1|1919613_1919829_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_000138558.1|1920084_1920357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1920516_1921050_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1921270_1921384_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1921605_1921791_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1922318_1922633_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1922714_1922939_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|1923341_1923851_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_052905469.1|1923822_1925751_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.5e-260
WP_000259002.1|1925734_1925941_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_052909326.1|1925937_1927530_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.6	1.9e-184
WP_001254038.1|1927519_1929025_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256818.1|1929061_1929409_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|1929466_1930495_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|1930546_1930921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|1930913_1931267_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|1931281_1931857_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|1931853_1932249_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|1932256_1933009_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|1933022_1933454_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533425.1|1933480_1933894_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_053888046.1|1933874_1936454_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.0	0.0e+00
WP_000847304.1|1936450_1936780_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001299882.1|1936779_1937478_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000194790.1|1937483_1938227_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_122988838.1|1938172_1938805_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.2	1.2e-102
WP_000649829.1|1938995_1939523_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515030.1|1939656_1943133_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.7	0.0e+00
WP_001408020.1|1943201_1943825_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_114107254.1|1943889_1945203_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.6	5.9e-75
WP_001101711.1|1945204_1945474_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.6	3.5e-43
WP_000950813.1|1945650_1946631_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_095111390.1|1946977_1947109_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
>prophage 5
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	2329218	2389654	5000290	holin,protease,terminase,integrase,portal,tail,lysis	Enterobacteria_phage(40.43%)	70	2341400:2341415	2378305:2378320
WP_001260840.1|2329218_2330040_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2330139_2330223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2330315_2330651_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2331047_2332301_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019527.1|2332407_2333301_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2333435_2334656_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2334780_2335476_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2335428_2336721_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2336880_2337495_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526494.1|2337537_2338392_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2338393_2339011_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342404.1|2339021_2341445_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
2341400:2341415	attL	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_000041535.1|2341505_2343932_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
WP_001295396.1|2344130_2344436_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2344543_2345254_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2345256_2345817_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2345851_2346193_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2346327_2346654_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2346859_2348074_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2348085_2349105_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|2349162_2349273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073978404.1|2349292_2350588_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	5.7e-155
WP_000005552.1|2350607_2350859_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_114107251.1|2350928_2353409_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	63.0	4.5e-60
WP_053897476.1|2353501_2353693_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_053897474.1|2353689_2353878_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_053897472.1|2354364_2354940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053897478.1|2354941_2355097_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_023307882.1|2355417_2355894_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	44.1	4.4e-12
WP_023307883.1|2356018_2356342_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	43.5	1.8e-09
WP_023307884.1|2356325_2356751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023307885.1|2356772_2357738_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	1.3e-58
WP_023307886.1|2357744_2358491_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	1.3e-111
WP_023307887.1|2358513_2359260_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.9	1.9e-110
WP_122996371.1|2359256_2359421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023307888.1|2360119_2360878_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|2361159_2361372_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001345469.1|2361539_2361818_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	2.2e-11
WP_097729342.1|2361819_2362875_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	9.8e-89
WP_053897382.1|2362875_2363253_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	4.1e-37
WP_024190351.1|2363245_2363611_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	6.4e-56
WP_024190350.1|2363646_2364045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021526743.1|2364034_2364298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021526742.1|2364313_2365195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839572.1|2366077_2366293_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_052931675.1|2366297_2366648_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	84.5	9.6e-33
WP_053897385.1|2366711_2367245_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.9	6.7e-102
WP_053897387.1|2367241_2367679_+|lysis	lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	95.9	7.9e-69
WP_053897389.1|2367881_2368436_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	87.0	1.2e-85
WP_000349509.1|2368943_2369435_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_149617697.1|2369434_2371537_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.9	0.0e+00
WP_001072975.1|2371533_2371746_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985947.1|2371745_2373254_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_149617698.1|2373198_2375226_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|2375312_2375636_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|2375628_2375904_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677112.1|2375915_2376494_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001079422.1|2376490_2376892_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|2376902_2377646_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|2377706_2378093_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|2378101_2378431_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
2378305:2378320	attR	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_001357479.1|2378402_2381468_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
WP_000447253.1|2381467_2381797_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152388.1|2381806_2382505_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	8.6e-134
WP_071987287.1|2382509_2383253_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	5.7e-152
WP_032340378.1|2383150_2383798_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	5.0e-112
WP_149617699.1|2383858_2387338_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_149617700.1|2387405_2388005_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.2e-101
WP_149617701.1|2388069_2389383_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.5	7.7e-75
WP_001023999.1|2389384_2389654_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	1.7e-42
>prophage 6
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	2801269	2846127	5000290	tRNA,holin,plate,capsid,protease,head,terminase,integrase,portal,tail	Shigella_phage(45.83%)	58	2811407:2811422	2839388:2839403
WP_000943926.1|2801269_2801434_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-24
WP_149617706.1|2802250_2804140_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_032145339.1|2804173_2804401_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	81.2	1.9e-13
WP_001526916.1|2804394_2804781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526915.1|2804782_2805220_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.9	7.2e-46
WP_000639074.1|2805191_2805587_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_024232472.1|2805595_2806252_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	67.4	6.8e-72
WP_024232471.1|2806255_2806840_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	4.1e-113
WP_000785301.1|2806830_2807889_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	4.3e-201
WP_000424728.1|2807875_2808301_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_001259088.1|2808300_2808849_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_000999503.1|2808848_2809928_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
WP_024232470.1|2809924_2811253_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	97.3	2.5e-243
WP_000679479.1|2811314_2811845_-	hypothetical protein	NA	NA	NA	NA	NA
2811407:2811422	attL	TATTTTTAGGCATGGT	NA	NA	NA	NA
WP_053902272.1|2811936_2813769_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	97.4	1.8e-300
WP_000661051.1|2813910_2814180_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|2814179_2814536_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_001759749.1|2814535_2816032_-|tail	phage tail sheath family protein	tail	U5P0H3	Shigella_phage	99.0	3.4e-276
WP_016243474.1|2816015_2816186_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	6.1e-25
WP_024232326.1|2816194_2816755_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	97.3	5.7e-104
WP_016243472.1|2816751_2817258_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	98.2	7.2e-90
WP_053887938.1|2817232_2817643_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	2.5e-72
WP_016243470.1|2817639_2817963_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	96.3	4.8e-55
WP_016243469.1|2817937_2818165_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.3	1.5e-23
WP_024232325.1|2818214_2819420_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.5	8.5e-222
WP_024232324.1|2819434_2820085_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	1.1e-117
WP_000466255.1|2820062_2821304_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605606.1|2821303_2821486_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_122988410.1|2821497_2822994_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.8e-298
WP_000929173.1|2823227_2823722_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_001135100.1|2823848_2824199_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	77.6	2.3e-50
WP_000184049.1|2824297_2824687_+	hypothetical protein	NA	A0A1L5C299	Pseudoalteromonas_phage	65.5	1.7e-38
WP_000522147.1|2824868_2825138_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	72.4	5.3e-23
WP_024232323.1|2825145_2825760_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.9	8.5e-93
WP_000422365.1|2825759_2826041_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	9.7e-20
WP_001283162.1|2826027_2826414_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	99.2	9.2e-61
WP_000779379.1|2827523_2827793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032197074.1|2828007_2828760_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	4.5e-136
WP_032262265.1|2828773_2829763_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	9.9e-192
WP_024232546.1|2829770_2830568_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_001603275.1|2830587_2830977_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	1.2e-68
WP_000210164.1|2830973_2831300_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_072179006.1|2831299_2831794_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	5.6e-87
WP_000104963.1|2831790_2832732_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	8.6e-153
WP_071791755.1|2832721_2832901_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.1e-15
WP_000515845.1|2833076_2833628_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_024232543.1|2833620_2833881_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	1.3e-39
WP_001020634.1|2833978_2834671_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000159356.1|2835188_2835380_-	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
WP_024232542.1|2835899_2836436_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	95.5	3.0e-94
WP_001527050.1|2836490_2836736_+	phage excisionase	NA	NA	NA	NA	NA
WP_024232541.1|2836716_2837844_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	61.2	6.1e-121
WP_024232540.1|2837944_2838415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024232539.1|2838839_2841962_-	hypothetical protein	NA	NA	NA	NA	NA
2839388:2839403	attR	TATTTTTAGGCATGGT	NA	NA	NA	NA
WP_000444484.1|2842420_2843671_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_001248691.1|2843842_2844496_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476089.1|2844505_2844967_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001378857.1|2845020_2846127_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	3097126	3184274	5000290	tRNA,plate,capsid,protease,head,terminase,integrase,portal,tail,lysis	Salmonella_phage(57.63%)	94	3149979:3150000	3184917:3184938
WP_000886683.1|3097126_3098419_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3098509_3099853_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_024232255.1|3099863_3100475_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077016.1|3100629_3104697_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3104831_3105326_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3105870_3106836_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043620.1|3106958_3108725_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_053902285.1|3108725_3110447_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	8.4e-21
WP_001241678.1|3110488_3111193_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3111477_3111696_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3112380_3114657_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3114687_3115008_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3115330_3115555_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188193.1|3115627_3117574_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|3117570_3118686_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001309384.1|3118842_3119793_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599820.1|3119789_3121448_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001440575.1|3121873_3122569_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3123063_3123963_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3124106_3125759_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3125770_3126739_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3126871_3128590_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_024232379.1|3128626_3129628_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3129638_3131069_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3131167_3132181_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|3132177_3133008_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3133004_3133328_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3133453_3133969_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3134186_3134915_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3134932_3135664_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3135670_3136387_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3136386_3137055_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3137346_3138078_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149732.1|3138252_3139380_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3139420_3139909_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3139968_3140814_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|3140810_3141764_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996025.1|3141773_3142907_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000126072.1|3143001_3144114_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3144465_3144942_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3145029_3145932_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|3145992_3146715_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3146698_3146986_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3147145_3147403_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3147432_3147810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3148079_3149765_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3149979:3150000	attL	TGGCGACAAAATGGCGGCAGCG	NA	NA	NA	NA
WP_000972391.1|3150000_3150219_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_149617707.1|3150309_3151410_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.1	7.6e-177
WP_000980387.1|3151406_3151892_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_024238380.1|3151888_3154966_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.5	0.0e+00
WP_000763311.1|3154958_3155078_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3155092_3155395_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3155449_3155965_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046120.1|3155974_3157147_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_000905032.1|3157289_3157856_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_024238379.1|3157886_3158426_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	61.4	1.8e-54
WP_149617732.1|3158425_3159028_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	85.0	4.9e-93
WP_024238377.1|3158999_3159443_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.4	4.3e-22
WP_149617708.1|3159447_3160887_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.4	7.7e-153
WP_001086836.1|3160883_3161489_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000268280.1|3161481_3162390_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_000177590.1|3162376_3162736_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993775.1|3162732_3163311_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000829146.1|3163379_3163826_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_033863274.1|3163818_3164250_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	1.7e-71
WP_021578444.1|3164345_3164774_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.1e-46
WP_024238779.1|3164770_3165148_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	38.4	2.0e-15
WP_024238780.1|3165149_3165662_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	5.2e-88
WP_000171568.1|3165642_3165858_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_024238781.1|3165861_3166065_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	5.7e-30
WP_000673523.1|3166064_3166529_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_024238782.1|3166624_3167275_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	5.6e-111
WP_024238783.1|3167278_3168337_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000216257.1|3168353_3169187_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_001098411.1|3169329_3171096_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_024238784.1|3171095_3172133_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.6	1.7e-173
WP_023352533.1|3172179_3172518_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_023352532.1|3172517_3173492_-	hypothetical protein	NA	A4PE73	Ralstonia_virus	41.1	6.1e-53
WP_021561694.1|3173966_3174392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3174551_3174785_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3174795_3174984_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_149617709.1|3175136_3177551_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.9	0.0e+00
WP_053902320.1|3177547_3178405_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	5.2e-157
WP_053902321.1|3178401_3178704_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	53.4	4.4e-10
WP_000752613.1|3178700_3178928_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_053902322.1|3178927_3179161_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	4.1e-32
WP_053902323.1|3179228_3179570_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	2.5e-54
WP_149617710.1|3179687_3179984_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460901.1|3179991_3180501_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_000191881.1|3180533_3180755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001420841.1|3181445_3182579_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_149617711.1|3182582_3182903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149617712.1|3182899_3183175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290920.1|3183254_3184274_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	55.6	3.4e-102
3184917:3184938	attR	TGGCGACAAAATGGCGGCAGCG	NA	NA	NA	NA
>prophage 8
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	3265604	3317588	5000290	holin,protease,head,integrase,tail,lysis	Enterobacteria_phage(47.92%)	57	3291858:3291873	3319296:3319311
WP_001389241.1|3265604_3266894_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
WP_000767389.1|3266952_3267429_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001121571.1|3267932_3268586_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000354291.1|3268598_3268820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|3268903_3269284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001448642.1|3269484_3270060_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_021351651.1|3270503_3270875_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000652081.1|3270998_3271826_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_000950982.1|3272049_3272931_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001189228.1|3273036_3273285_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.3	2.8e-39
WP_149617714.1|3286669_3287083_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.5	4.7e-55
WP_001358225.1|3288192_3288525_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
3291858:3291873	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453611.1|3293518_3294064_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001307652.1|3294451_3294646_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_024232585.1|3294833_3295451_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	5.5e-92
WP_000092318.1|3295600_3296038_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|3296034_3296532_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|3296531_3296747_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000340705.1|3297185_3297659_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	99.4	3.8e-85
WP_000499454.1|3299324_3299483_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001097238.1|3300490_3301180_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3301194_3301317_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3301651_3302611_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|3302822_3303011_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|3303007_3303370_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002251.1|3303366_3303657_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001286917.1|3303649_3303862_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950962.1|3303854_3304031_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_000386661.1|3304030_3304390_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_001254220.1|3304392_3304569_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_000153280.1|3304565_3305093_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736904.1|3305089_3305530_-	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_000145931.1|3305603_3305894_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788869.1|3305890_3306592_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000185522.1|3306588_3307488_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	2.1e-172
WP_001177650.1|3307522_3307801_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000276886.1|3307909_3308095_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001095981.1|3308175_3308826_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_001358311.1|3309138_3309411_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
WP_001066169.1|3309427_3310009_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000065374.1|3310269_3310638_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3310710_3310875_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3310843_3310987_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995467.1|3311061_3311358_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_001358309.1|3311363_3312149_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_000186848.1|3312145_3312826_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682305.1|3312822_3313005_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
WP_000548514.1|3312977_3313169_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001395510.1|3313179_3313461_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763369.1|3313559_3313781_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	5.5e-34
WP_000111054.1|3313777_3314029_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	5.8e-32
WP_000748282.1|3314327_3314942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129736.1|3315235_3315574_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	6.4e-50
WP_000762731.1|3315602_3316031_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_000545741.1|3316114_3316282_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|3316321_3316540_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3316517_3317588_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3319296:3319311	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 9
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	3539252	3603916	5000290	tRNA,capsid,head,protease,transposase,terminase,integrase,portal,tail,lysis	Enterobacteria_phage(44.23%)	68	3547733:3547779	3593709:3593755
WP_000420810.1|3539252_3540389_+|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_000383951.1|3540657_3542895_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_149617717.1|3542881_3545854_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|3545854_3546745_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|3546927_3547689_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3547733:3547779	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201810.1|3548202_3549156_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_120795384.1|3552049_3552163_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3552231_3552465_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|3552781_3553372_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_053888049.1|3553469_3554045_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279133.1|3554044_3557443_-	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_053891083.1|3557507_3558107_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.5	6.3e-109
WP_053888051.1|3558177_3561675_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.8	0.0e+00
WP_149617692.1|3561734_3562367_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.1e-95
WP_053890196.1|3562303_3563047_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|3563052_3563751_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_053888053.1|3563750_3564080_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_053888054.1|3564076_3566638_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.3	0.0e+00
WP_000459457.1|3566630_3567065_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3567046_3567469_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_053888056.1|3567484_3568225_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	6.6e-132
WP_000683141.1|3568232_3568628_-|tail	phage tail protein U	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975054.1|3568624_3569203_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_053881501.1|3569215_3569569_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.3e-61
WP_072184952.1|3569580_3569976_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	1.7e-57
WP_053902342.1|3570017_3571043_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.5	8.4e-186
WP_001358225.1|3571098_3571431_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123248.1|3571440_3572760_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001358226.1|3572740_3574342_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	8.8e-312
WP_000198149.1|3574338_3574545_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_114107258.1|3574541_3576467_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|3576441_3576987_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001421937.1|3577376_3577571_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3577735_3577942_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|3578227_3578638_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|3578928_3579222_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3579312_3579495_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3579711_3580209_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|3580208_3580424_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|3581012_3582110_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|3582299_3582683_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001358249.1|3582700_3583690_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_001061408.1|3583697_3584495_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_000767127.1|3584514_3584904_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210176.1|3584900_3585227_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_001573323.1|3585226_3585721_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000104957.1|3585717_3586659_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|3586648_3586828_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515870.1|3587003_3587555_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	1.7e-100
WP_000205494.1|3587592_3587793_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3587890_3588517_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000559922.1|3588744_3589260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3589730_3590093_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|3590158_3590983_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|3591110_3591647_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|3591637_3592000_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_053888029.1|3591999_3592305_+	hypothetical protein	NA	U5P0J0	Shigella_phage	94.1	3.2e-48
WP_000051902.1|3592531_3593695_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|3594029_3594662_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3593709:3593755	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|3594664_3595180_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691054.1|3595190_3596198_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001347862.1|3596210_3598820_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988379.1|3598850_3599543_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_024232318.1|3599762_3600305_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|3600785_3601652_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3601653_3601866_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3601973_3602495_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3602530_3603916_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 10
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	3902432	3922252	5000290	transposase,plate	uncultured_Caudovirales_phage(50.0%)	15	NA	NA
WP_050553122.1|3902432_3903533_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_033882877.1|3903532_3904669_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_000786991.1|3905092_3905350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508713.1|3905351_3909845_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.0e-22
WP_053888043.1|3909920_3912062_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|3912271_3912790_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|3913486_3913987_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3914021_3914246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056975.1|3914296_3915772_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611738.1|3915778_3916192_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393855.1|3916195_3918046_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3918009_3919092_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|3919116_3920397_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3920393_3920918_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246449.1|3920920_3922252_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 11
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	4373044	4432145	5000290	protease,transposase,tRNA,integrase	Vibrio_phage(14.29%)	56	4423117:4423133	4434482:4434498
WP_000811566.1|4373044_4373320_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_053887943.1|4373436_4375062_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943987.1|4375145_4376309_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
WP_000101649.1|4376311_4376950_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4376959_4377358_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|4377375_4378035_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|4378085_4378784_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|4378802_4379204_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4379330_4380062_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|4380241_4382683_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177644.1|4382721_4383147_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4383351_4384650_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4384753_4384951_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4385032_4386037_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4386039_4387299_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4387384_4388665_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4388740_4389049_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4389134_4390085_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122507.1|4390077_4391925_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990321.1|4391934_4393272_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4393290_4393752_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|4393723_4395271_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|4395269_4396409_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4396391_4396445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4397187_4397733_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4397827_4398880_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000933227.1|4398976_4399945_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236806.1|4399966_4403290_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001307536.1|4403440_4404943_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|4405161_4406139_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|4406463_4408272_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4408264_4408999_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|4409009_4409405_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|4409415_4409775_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|4409837_4410971_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|4411059_4411593_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|4411589_4411907_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|4412088_4412235_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|4412345_4412471_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4412522_4413089_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|4413130_4414159_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008078.1|4414548_4415418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|4415620_4415974_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4416111_4417758_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4417801_4418095_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|4418370_4419627_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|4419642_4420119_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4420455_4421892_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|4422009_4423311_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
4423117:4423133	attL	GCTTCTTTCGCTGCGGT	NA	NA	NA	NA
WP_000883407.1|4423426_4423765_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068928.1|4423740_4425438_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|4425474_4426050_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218875.1|4426429_4427692_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	2.2e-79
WP_032216534.1|4428144_4428576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032216533.1|4428704_4429856_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	4.4e-42
WP_149003591.1|4430916_4432145_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	1.4e-171
4434482:4434498	attR	GCTTCTTTCGCTGCGGT	NA	NA	NA	NA
>prophage 12
NZ_CP041678	Escherichia coli strain ESBL 15 chromosome, complete genome	5000290	4557253	4603050	5000290	tRNA,protease,terminase,integrase,portal,tail,lysis	Enterobacteria_phage(57.14%)	57	4549612:4549626	4564794:4564808
4549612:4549626	attL	CGGCATATCAGCCAG	NA	NA	NA	NA
WP_000543828.1|4557253_4558291_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|4558379_4559477_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_166806853.1|4559830_4560007_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	52.9	7.7e-07
WP_166806854.1|4560013_4560421_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	77.4	6.7e-54
WP_025237848.1|4563624_4563894_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	3.8e-45
WP_025237849.1|4563895_4565209_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	2.5e-81
4564794:4564808	attR	CTGGCTGATATGCCG	NA	NA	NA	NA
WP_059274540.1|4565273_4565873_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.5	6.3e-109
WP_149617722.1|4565943_4569357_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001309913.1|4569417_4570065_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_032151194.1|4569962_4570706_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
WP_001152385.1|4570711_4571410_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447247.1|4571419_4571749_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_149617723.1|4571748_4574814_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|4574785_4575115_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|4575123_4575510_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211121.1|4575570_4576314_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	100.0	1.6e-133
WP_001079419.1|4576324_4576726_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000677114.1|4576722_4577313_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.6	5.5e-81
WP_001283153.1|4577324_4577600_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097045.1|4577592_4577916_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_149617698.1|4578002_4580030_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_011478361.1|4579974_4581555_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|4581482_4581695_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_149617697.1|4581691_4583794_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.9	0.0e+00
WP_000373425.1|4583793_4584288_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000232224.1|4584741_4585104_-	hypothetical protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
WP_001228685.1|4585187_4585373_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000075159.1|4585589_4586087_-	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
WP_000839596.1|4586086_4586302_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799653.1|4586368_4587421_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	1.4e-207
WP_000917724.1|4587571_4587775_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000217632.1|4587998_4588424_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_001047112.1|4588704_4589457_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	6.9e-137
WP_024185670.1|4589470_4590460_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001061444.1|4590467_4591277_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4591296_4591686_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|4591682_4592009_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_149617724.1|4592008_4592503_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	93.2	8.4e-83
WP_016240791.1|4592499_4593318_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	2.3e-122
WP_149617725.1|4593314_4593539_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	97.3	1.8e-37
WP_149617726.1|4593535_4594699_-	peptidase	NA	K7PLX4	Enterobacteria_phage	83.7	2.0e-175
WP_063268627.1|4594695_4595247_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	99.5	7.6e-101
WP_001191669.1|4595239_4595500_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001345148.1|4595597_4596290_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_000135682.1|4596993_4597356_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|4597421_4598246_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_149617727.1|4598373_4598910_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.2e-100
WP_001242733.1|4598900_4599263_+	phage protein	NA	S5MC15	Escherichia_phage	100.0	1.6e-67
WP_000111288.1|4599259_4599463_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	100.0	4.7e-32
WP_000476212.1|4599455_4599695_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
WP_040092683.1|4599691_4600246_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	99.5	4.1e-102
WP_001014290.1|4600247_4600439_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	3.3e-27
WP_058100692.1|4600441_4601209_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	56.4	2.1e-77
WP_001061339.1|4601208_4601781_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093917.1|4601817_4602099_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_000654815.1|4602146_4602320_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956556.1|4602516_4603050_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	99.4	4.0e-99
