The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	0	9076	5444610	tail	Stx2-converting_phage(80.0%)	5	NA	NA
WP_149888766.1|89_2513_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	83.7	0.0e+00
WP_072608461.1|2579_3179_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	2.0e-110
WP_072608474.1|3243_4557_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.8	5.3e-76
WP_001023407.1|4558_4828_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_021501344.1|5689_9076_-	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	99.2	0.0e+00
>prophage 2
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	14517	21680	5444610		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|14517_15039_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024949.1|15040_15643_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_010723105.1|15713_15779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|15917_16529_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|16537_17548_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571476.1|17793_18579_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|18575_19331_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_149888710.1|19409_20342_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|20357_21680_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 3
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	25678	27154	5444610		Cyanophage(100.0%)	1	NA	NA
WP_000301737.1|25678_27154_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 4
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	36654	39680	5444610		Pectobacterium_phage(50.0%)	5	NA	NA
WP_000916763.1|36654_36885_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|37023_37398_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879314.1|37401_38274_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|38286_38628_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812736.1|39023_39680_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
>prophage 5
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	47177	49226	5444610		Moraxella_phage(100.0%)	1	NA	NA
WP_001055778.1|47177_49226_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
>prophage 6
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	54558	54768	5444610		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|54558_54768_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 7
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	60409	61966	5444610		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|60409_61966_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 8
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	65828	73934	5444610	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_149888711.1|65828_67190_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
WP_000457334.1|67263_67443_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|67562_67922_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|68283_68628_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|68759_70670_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_072608472.1|70727_71423_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290570.1|71462_72044_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001302040.1|72248_73934_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	2.6e-35
>prophage 9
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	88687	93264	5444610		Bacillus_phage(100.0%)	3	NA	NA
WP_000766134.1|88687_90178_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
WP_149888712.1|90358_91834_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000219686.1|91980_93264_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 10
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	96582	97437	5444610		Indivirus(100.0%)	1	NA	NA
WP_001186359.1|96582_97437_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.3	4.3e-10
>prophage 11
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	109679	110321	5444610		Tupanvirus(100.0%)	1	NA	NA
WP_021500218.1|109679_110321_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.3	6.5e-19
>prophage 12
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	116038	118000	5444610		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235841.1|116038_118000_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	7.0e-40
>prophage 13
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	123598	124252	5444610		Planktothrix_phage(100.0%)	1	NA	NA
WP_001302822.1|123598_124252_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.7	8.4e-14
>prophage 14
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	131016	132237	5444610		Klosneuvirus(100.0%)	1	NA	NA
WP_000082019.1|131016_132237_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	5.5e-27
>prophage 15
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	139713	140541	5444610		Bacillus_virus(100.0%)	1	NA	NA
WP_000175032.1|139713_140541_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 16
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	146670	148932	5444610		Tupanvirus(100.0%)	1	NA	NA
WP_000082743.1|146670_148932_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 17
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	160228	179821	5444610	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144201.1|160228_162157_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	9.4e-130
WP_001700733.1|162160_162703_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|162799_162997_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|163049_163406_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001299131.1|163532_163667_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|163855_164839_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672328.1|164853_167241_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|167245_167545_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_072608470.1|167645_168626_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154193.1|168688_169240_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029463.1|169239_169989_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209780.1|170066_170531_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001302301.1|170777_171491_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175641.1|171553_172990_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|172993_173185_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082219.1|173316_174363_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	2.5e-84
WP_000368046.1|174519_175353_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069325.1|175685_178064_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.8	1.9e-172
WP_000553648.1|178120_179821_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	4.7e-32
>prophage 18
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	187223	188537	5444610	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_085949318.1|187223_188436_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_072608469.1|188402_188537_+|transposase	transposase	transposase	A0A0N7BTS3	Escherichia_phage	100.0	3.4e-07
>prophage 19
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	199727	204811	5444610		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367171.1|199727_200096_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
WP_001302084.1|200104_201592_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948872.1|201601_202348_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000907999.1|202322_203594_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144581.1|203590_204811_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	1.7e-92
>prophage 20
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	213100	215367	5444610		Escherichia_phage(50.0%)	3	NA	NA
WP_001412436.1|213100_213769_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.5	1.3e-22
WP_001069991.1|213765_214551_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587574.1|214554_215367_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
>prophage 21
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	220871	229663	5444610		Orpheovirus(20.0%)	9	NA	NA
WP_000493949.1|220871_221513_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098902.1|221552_222701_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	7.2e-85
WP_001182346.1|222991_224203_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|224315_225248_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|225244_226270_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|226568_226658_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_072608468.1|226823_227993_+	MFS transporter	NA	NA	NA	NA	NA
WP_149888713.1|228138_228720_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101201.1|228847_229663_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 22
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	238466	239965	5444610		Indivirus(50.0%)	2	NA	NA
WP_000250655.1|238466_239255_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.1e-07
WP_001296937.1|239443_239965_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 23
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	246875	248150	5444610	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|246875_248150_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 24
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	279840	281142	5444610		Bacillus_phage(100.0%)	1	NA	NA
WP_000732491.1|279840_281142_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	3.2e-17
>prophage 25
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	291242	386204	5444610	terminase,portal,head,protease,holin,tail,transposase,capsid	Stx2-converting_phage(32.79%)	104	NA	NA
WP_001260835.1|291242_292064_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|292163_292247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|292339_292675_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|293071_294325_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|294431_295325_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|295459_296680_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|296804_297500_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|297452_298745_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|298902_299517_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|299559_300414_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|300415_301033_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|301043_303467_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|303527_305954_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|306152_306458_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|306565_307276_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|307278_307839_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|307873_308215_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|308349_308676_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|308848_308974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|309664_309901_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|309988_312460_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|312552_312744_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|312740_312929_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|313329_313494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|313497_313716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|313787_314087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|314439_314718_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|314719_314911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|314931_315303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|315400_315703_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000095669.1|316146_317109_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|317115_317856_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|318666_319062_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|319118_319703_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|319818_319923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|320111_320324_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|320491_320770_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|320771_321821_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|321833_322193_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|322189_322879_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302069.1|322909_323032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303509.1|323516_323945_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_070081082.1|324423_326274_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_000411805.1|326722_326929_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|326933_327278_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992148.1|327328_327862_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|328132_328702_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|328701_328848_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|329075_329261_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|329685_329913_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|329954_330320_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|330609_331173_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|331169_332831_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|332894_334832_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|334876_335098_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|335043_337545_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|337624_337951_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|337960_338311_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|338307_338754_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|338750_339095_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|339153_339870_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|339875_340250_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|340345_340555_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212922.1|340607_343850_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.7	0.0e+00
WP_000807954.1|343842_344184_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179481.1|344183_344882_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|344892_345636_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|345581_346214_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|346556_347732_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|347683_350029_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|350096_350696_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|350847_352161_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|352162_352432_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|353459_354785_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_024262009.1|355052_355241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106409364.1|356382_356505_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|356611_357523_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000289510.1|357563_358091_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|359056_360595_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|360644_360992_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001303943.1|361708_361987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|362414_362561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|362697_363345_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|363528_364119_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001302903.1|365847_366276_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_000147167.1|366869_367088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|367589_368096_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|368141_368642_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|368727_368907_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|369287_370094_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|370093_371287_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|371298_372657_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|372660_374256_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|374255_375818_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|375909_375954_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|376091_376973_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|376969_377590_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|377617_379201_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|379413_380286_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|380325_380916_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|380912_381671_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|381890_382940_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|382975_383227_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|383606_386204_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 26
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	391128	391719	5444610		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|391128_391719_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 27
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	399534	401469	5444610		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485019.1|399534_401469_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	2.4e-32
>prophage 28
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	410398	412420	5444610		Salmonella_phage(50.0%)	2	NA	NA
WP_021500199.1|410398_411562_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	1.1e-27
WP_000573412.1|411613_412420_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 29
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	425210	426476	5444610		Klosneuvirus(100.0%)	1	NA	NA
WP_000069223.1|425210_426476_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	7.8e-24
>prophage 30
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	440487	441570	5444610		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057976.1|440487_441570_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 31
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	459732	460248	5444610		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945010.1|459732_460248_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.1	2.4e-24
>prophage 32
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	466573	472569	5444610	tRNA	Bacillus_phage(25.0%)	6	NA	NA
WP_000628061.1|466573_467806_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|468060_469044_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_124056621.1|469332_469563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|469521_470895_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|471023_471959_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001295593.1|472134_472569_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 33
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	478782	479772	5444610		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|478782_479772_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 34
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	498261	502164	5444610		Klosneuvirus(100.0%)	1	NA	NA
WP_000139561.1|498261_502164_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 35
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	507781	508730	5444610		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|507781_508312_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731827.1|508556_508730_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	5.8e-07
>prophage 36
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	521914	528964	5444610		Phage_TP(25.0%)	7	NA	NA
WP_001303492.1|521914_523876_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|523967_524198_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|524419_524596_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|524641_525058_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760654.1|525136_526543_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047432.1|526787_527933_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220402.1|527950_528964_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	1.3e-26
>prophage 37
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	536096	538199	5444610		Salmonella_phage(100.0%)	1	NA	NA
WP_000706257.1|536096_538199_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	6.2e-135
>prophage 38
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	543108	549486	5444610		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103276.1|543108_545217_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	1.4e-25
WP_000014822.1|545283_549486_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	2.2e-22
>prophage 39
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	555932	557477	5444610		Escherichia_phage(100.0%)	1	NA	NA
WP_000702550.1|555932_557477_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 40
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	565738	566839	5444610		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768382.1|565738_566839_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.4	5.3e-138
>prophage 41
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	572850	574291	5444610		Escherichia_phage(50.0%)	2	NA	NA
WP_001302113.1|572850_573135_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	50.0	7.5e-20
WP_000642407.1|573280_574291_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 42
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	577564	579470	5444610		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285523.1|577564_578491_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	9.1e-14
WP_000193529.1|578483_579470_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-19
>prophage 43
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	586200	587583	5444610		Bacillus_virus(100.0%)	1	NA	NA
WP_000426292.1|586200_587583_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 44
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	592861	599797	5444610		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_072608463.1|592861_595657_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.3e-18
WP_000832417.1|595701_598074_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_072608462.1|598111_599797_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.0	4.5e-11
>prophage 45
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	615790	617191	5444610		Escherichia_phage(100.0%)	1	NA	NA
WP_001083593.1|615790_617191_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.5	1.8e-106
>prophage 46
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	624622	626158	5444610		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194917.1|624622_626158_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
>prophage 47
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	634029	635448	5444610		Bacillus_phage(100.0%)	1	NA	NA
WP_000558061.1|634029_635448_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 48
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	643195	643579	5444610		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|643195_643579_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 49
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	648064	648955	5444610		Bacillus_phage(100.0%)	1	NA	NA
WP_000592852.1|648064_648955_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.4e-19
>prophage 50
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	654320	752144	5444610	integrase,terminase,portal,head,holin,tail,transposase,capsid	Escherichia_phage(33.66%)	123	697491:697504	753023:753036
WP_000214712.1|654320_654524_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|654559_656020_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|656108_657392_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|657451_657766_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001480712.1|657762_657897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143804.1|657927_658569_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|658650_659280_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|659352_659928_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|660041_660311_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_072608461.1|661597_662197_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	2.0e-110
WP_149888716.1|662264_665744_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_143189876.1|665989_666622_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	1.3e-109
WP_072608477.1|666567_667311_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	1.3e-148
WP_072608478.1|667321_668020_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	2.0e-130
WP_000847306.1|668019_668349_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_000533440.1|670927_671341_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|671367_671790_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_044781954.1|671803_672556_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	6.4e-135
WP_000683063.1|672563_672959_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|672955_673489_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|673503_673857_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|673868_674267_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|674308_675334_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|675389_675722_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|675731_677051_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|677031_678633_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|678629_678836_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|678832_680758_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|680732_681278_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_032161313.1|681391_681649_+	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_001303940.1|681664_681889_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|681970_682285_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|682810_682996_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|683218_683365_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|683364_683934_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|684204_684738_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|684788_685133_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|685137_685344_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|685791_687642_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|688119_688551_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|689001_689715_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|689850_690048_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|690272_690827_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|690889_691195_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|691207_692257_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|692258_692531_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|692652_692997_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|693116_693329_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|693556_694114_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|694115_694334_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|694461_694773_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|694765_694993_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|694989_695271_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|695303_696020_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|696053_696476_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001262402.1|696507_697551_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
697491:697504	attL	TCGTTCGCCACTTG	NA	NA	NA	NA
WP_000693878.1|697619_698045_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|698028_698271_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|698662_699001_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|699293_699446_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|699457_700096_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|700096_700306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|700870_701059_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|701055_701244_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_009642003.1|701336_702581_+	exodeoxyribonuclease 8	NA	H6WRX1	Salmonella_phage	50.4	3.7e-87
WP_001171540.1|703853_704234_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|704230_704578_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|704627_706166_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|706748_707399_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_010917823.1|707383_707731_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001131642.1|708109_708685_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|708798_709068_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|709069_710293_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_072608461.1|710357_710957_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	2.0e-110
WP_001152128.1|714696_715134_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|715133_715475_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072612737.1|715467_718548_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.1	0.0e+00
WP_001453698.1|718600_718810_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|718905_719280_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|719285_720002_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|720060_720405_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|720401_720848_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|720844_721195_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|721204_721531_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|724055_724277_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000958416.1|727978_728542_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|728831_729197_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|729238_729424_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|729553_729694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|730050_730275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|730339_730546_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|730773_730920_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|730919_731489_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|731759_732293_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|732343_732688_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|732692_732908_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_064761991.1|735029_735215_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000935548.1|735706_736765_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|736915_737113_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|737354_737885_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|737893_738253_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|738265_739312_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|739313_739592_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|739661_739919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|740139_740352_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|740630_741389_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|742087_742252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|742248_742830_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|743016_743439_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|743470_744511_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|744482_745034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|745017_745245_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|745321_745729_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|745992_746292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|746364_746583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|746605_747013_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|746990_747224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|747217_747385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|747782_747971_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|747967_748159_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_072608456.1|748251_750723_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|750787_751036_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|751013_752144_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
753023:753036	attR	TCGTTCGCCACTTG	NA	NA	NA	NA
>prophage 51
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	760080	762095	5444610		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|760080_761085_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110954.1|761081_762095_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 52
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	770505	780867	5444610		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|770505_771123_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|771726_772140_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|772283_773192_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|773393_774407_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|774498_775404_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001362540.1|775516_775975_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555853.1|776024_776867_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	3.7e-14
WP_001160110.1|777944_778622_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571681.1|778621_779332_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|779328_780867_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 53
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	792002	969187	5444610	lysis,integrase,terminase,tRNA,portal,head,protease,holin,tail,transposase,capsid	Enterobacteria_phage(31.9%)	207	951853:951873	972943:972963
WP_001146444.1|792002_792233_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_001301956.1|792502_793603_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170963.1|794001_794109_+	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_000170954.1|794537_794645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000811067.1|794792_795647_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.3	1.1e-45
WP_001257044.1|795682_796492_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200379.1|796495_796888_-	SirB family protein	NA	NA	NA	NA	NA
WP_072608454.1|796884_797718_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|797717_798800_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_001299679.1|798841_800098_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|800311_800935_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|800934_801786_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|801936_802884_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|803008_804688_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|804742_805021_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|805298_805883_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|805999_807091_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|809912_810983_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|810993_811626_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|811636_813055_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001366914.1|813367_813496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021500184.1|813601_815059_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_001459046.1|815086_815287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|815394_816417_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|816416_817397_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|817393_818152_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000903990.1|818161_818806_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010917800.1|818750_819032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576838.1|818970_819825_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|819850_821821_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|821870_822125_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020151.1|822325_823057_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|823058_823670_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|823769_824684_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|824779_826516_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_064717263.1|826618_826708_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_087661054.1|826673_827887_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000197859.1|828224_829295_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|829304_830603_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|830932_832465_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|832516_833236_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|833457_834999_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|835144_835675_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|835720_836989_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|836988_837408_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|837780_838692_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|838898_839360_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|839436_840096_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|840167_840461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|840701_841103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|841205_841574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|842093_842789_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|842812_843625_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|843628_843895_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_085948178.1|845060_846274_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000361110.1|846447_847032_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|847530_848484_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|848670_850155_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|850457_851996_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|852045_852393_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000937476.1|852845_853094_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000134810.1|854315_854498_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|854576_855077_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|855113_855620_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|855638_856529_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|856648_857230_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000268883.1|857229_860145_-	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|860209_860809_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|860875_864274_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|864334_864967_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|864903_865647_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|865652_866351_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|866350_866680_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|866676_869226_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|869218_869653_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|869634_870057_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|870072_870813_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|870820_871216_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|871212_871791_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|871802_872156_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|872167_872566_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|872607_873633_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|873688_874021_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|874030_875350_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|875330_876932_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|876928_877135_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|877131_879057_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|879031_879577_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|879965_880160_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|880324_880531_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|880816_881227_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|881518_881812_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|881902_882085_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000544528.1|882763_883069_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|883390_884080_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|884076_884217_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|884213_884576_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|884572_884863_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|884855_885026_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|885025_885481_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|885671_885863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|885982_887509_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|887566_887689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|887753_888086_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|888153_888456_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|888452_889154_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_072608453.1|889150_889975_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.0	1.9e-95
WP_000088655.1|890078_890315_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|890304_891447_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|891560_892811_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|892982_893636_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|893645_894107_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|894160_895267_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|895302_895944_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|895947_897318_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|897486_898158_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|898157_899618_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|900218_900500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|900755_901298_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|901503_901917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|901929_902265_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|902277_903333_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000796968.1|903332_903539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|903790_904015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301569.1|904056_904185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233304.1|904141_904414_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000192401.1|904831_905083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149888717.1|905283_906684_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	7.3e-116
WP_000770178.1|906680_906980_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204985.1|906985_907219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|907211_907676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609225.1|907665_907878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|907870_908068_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_125090562.1|908496_908823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|908872_909061_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085256.1|909425_910655_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|910903_912025_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|912073_913300_-	peptidase T	NA	NA	NA	NA	NA
WP_021500167.1|913549_914686_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|914669_915533_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001303923.1|915563_915776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|915896_917258_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|917318_917594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|917673_917799_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301984.1|919902_923304_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|923894_926243_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|926262_926352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|926364_926601_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|926546_927284_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|927337_928216_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|928518_928629_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|928738_928993_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|929009_929708_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807954.1|929707_930049_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212922.1|930041_933284_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.7	0.0e+00
WP_001453698.1|933336_933546_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|933641_934016_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|934021_934738_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|934796_935141_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|935137_935584_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|935580_935931_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|935940_936267_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|938790_939012_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|939056_940994_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|941057_942719_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|942715_943279_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000095736.1|943974_944202_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|944626_944812_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|945039_945186_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|945185_945755_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|946025_946559_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|946609_946954_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|946958_947174_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|947249_947519_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|947556_947739_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|947886_949824_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|950138_950306_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|950902_951724_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_149888718.1|951789_952095_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.1e-29
951853:951873	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|952107_953157_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|953158_953437_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|953604_953817_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|954005_954110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|954225_954813_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|954815_955007_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|955008_955446_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|955432_955750_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|955703_956021_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|956010_956313_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|956309_956627_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|956623_957340_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|957373_957796_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001262323.1|957827_958865_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|958933_959359_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|959342_959666_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|959790_960267_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|960582_960735_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|960849_961365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|961497_961887_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|961948_962218_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|962186_963305_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|963471_964266_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|964262_965309_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|965464_966286_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291263.1|966301_967213_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251367.1|967241_968486_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033699.1|968485_969187_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
972943:972963	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 54
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	976476	976734	5444610		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|976476_976734_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 55
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	989063	990706	5444610		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267941.1|989063_990068_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001256997.1|990064_990706_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.6	3.4e-28
>prophage 56
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	993978	995160	5444610		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|993978_994215_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008537.1|994425_995160_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.7e-15
>prophage 57
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1007505	1008447	5444610		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001301817.1|1007505_1008447_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 58
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1024293	1024539	5444610		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1024293_1024539_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 59
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1029201	1030122	5444610		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1029201_1030122_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 60
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1039429	1039963	5444610		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1039429_1039963_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 61
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1044100	1044934	5444610		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1044100_1044934_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 62
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1054483	1055191	5444610		Planktothrix_phage(100.0%)	1	NA	NA
WP_001192027.1|1054483_1055191_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.9e-35
>prophage 63
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1064929	1068742	5444610		Moraxella_phage(100.0%)	1	NA	NA
WP_001240839.1|1064929_1068742_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.7	8.1e-24
>prophage 64
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1076902	1077685	5444610		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000010422.1|1076902_1077685_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.4	8.5e-13
>prophage 65
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1081490	1082849	5444610		Bacillus_phage(100.0%)	1	NA	NA
WP_000409847.1|1081490_1082849_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	5.6e-20
>prophage 66
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1089668	1090733	5444610		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|1089668_1090733_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 67
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1107501	1109535	5444610		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028088.1|1107501_1107996_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_021500151.1|1108016_1109345_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.8	6.7e-236
WP_001273654.1|1109427_1109535_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
>prophage 68
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1113837	1114758	5444610		Klosneuvirus(100.0%)	1	NA	NA
WP_000420639.1|1113837_1114758_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
>prophage 69
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1119668	1126161	5444610		Bacillus_phage(33.33%)	8	NA	NA
WP_001120119.1|1119668_1120361_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|1120333_1121362_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001054754.1|1121444_1124189_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
WP_000818441.1|1124260_1125334_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|1125382_1125517_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|1125544_1125775_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|1125749_1125938_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1125948_1126161_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 70
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1140498	1195738	5444610	integrase,portal,head,protease,holin,tail,transposase	Stx2-converting_phage(24.39%)	67	1142433:1142448	1197503:1197518
WP_000003653.1|1140498_1141086_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|1141082_1141790_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|1141808_1143602_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
1142433:1142448	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|1143598_1144717_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|1145334_1145517_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023352.1|1146849_1147119_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|1147120_1148434_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230444.1|1148498_1149098_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_149888721.1|1149165_1152639_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	95.9	0.0e+00
WP_000649829.1|1152772_1153300_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001303882.1|1153330_1153537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050546863.1|1153490_1154123_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|1154068_1154812_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_000847304.1|1155519_1155849_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_010904726.1|1155845_1156610_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.9	2.4e-129
WP_000533402.1|1158403_1158817_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|1158843_1159275_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_001301534.1|1160009_1160276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000831796.1|1162210_1163803_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|1163799_1164006_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001301919.1|1165887_1166130_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|1166179_1167718_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1167767_1168115_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1168111_1168492_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_070081091.1|1168567_1168843_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|1169593_1169800_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|1169762_1170107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|1170055_1170328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|1170260_1170455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1170487_1171021_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1171241_1171355_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1171576_1171762_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1172289_1172604_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|1173960_1175811_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|1175928_1176132_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|1176578_1177292_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|1177386_1177626_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|1177912_1178731_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|1178882_1179254_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|1179243_1179615_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|1179627_1180677_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|1180678_1180957_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|1181124_1181337_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|1181381_1181519_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_097561939.1|1181681_1181873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000160654.1|1181884_1182658_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|1183009_1183423_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|1183438_1184209_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|1184230_1184977_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|1184983_1186075_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|1186153_1186609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|1186815_1187241_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|1187224_1187497_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|1187605_1188007_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|1188034_1188226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|1188225_1188513_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525099.1|1188514_1188733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1188790_1188946_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|1189087_1189477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|1189663_1189849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|1189850_1190156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|1190422_1190611_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|1190607_1190799_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|1190892_1193364_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|1193431_1193674_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|1193651_1194671_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|1195078_1195738_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
1197503:1197518	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 71
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1199971	1202026	5444610		Bacillus_phage(100.0%)	1	NA	NA
WP_001301436.1|1199971_1202026_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 72
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1214624	1216532	5444610		Tupanvirus(100.0%)	1	NA	NA
WP_000053083.1|1214624_1216532_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 73
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1232451	1243250	5444610	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090506.1|1232451_1233219_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193803.1|1233261_1235874_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001301736.1|1236139_1237342_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117895.1|1237510_1238911_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.7	4.5e-81
WP_000977914.1|1239513_1240602_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.1e-98
WP_000462673.1|1240786_1241977_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109453.1|1242027_1242675_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1242701_1243250_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 74
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1257955	1262496	5444610		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|1257955_1259704_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705685.1|1259740_1262005_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1262211_1262496_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 75
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1267582	1268671	5444610		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057165.1|1267582_1268671_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
>prophage 76
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1272769	1275984	5444610		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292812.1|1272769_1275052_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000111043.1|1275243_1275984_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 77
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1280823	1297416	5444610	tRNA	Escherichia_phage(25.0%)	10	NA	NA
WP_000213047.1|1280823_1281441_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	6.6e-77
WP_000850325.1|1281451_1283896_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
WP_000886683.1|1284134_1285427_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|1285517_1286861_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|1286871_1287483_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000076999.1|1287637_1291666_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1291800_1292295_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|1292839_1293805_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043606.1|1293927_1295694_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202230.1|1295694_1297416_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	1.1e-20
>prophage 78
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1301737	1303908	5444610		Klebsiella_phage(33.33%)	4	NA	NA
WP_001220314.1|1301737_1301959_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001186738.1|1302021_1302498_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214398.1|1302513_1302999_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001234682.1|1303089_1303908_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.0e-45
>prophage 79
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1313615	1314041	5444610		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000422760.1|1313615_1314041_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
>prophage 80
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1318625	1374169	5444610	protease,transposase,integrase	Stx2-converting_phage(25.0%)	56	1334001:1334016	1379432:1379447
WP_001223350.1|1318625_1320716_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|1321229_1321616_-	protein TerF	NA	NA	NA	NA	NA
WP_000301248.1|1322038_1322614_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|1322682_1323261_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|1323309_1324350_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|1324372_1324828_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|1324850_1326008_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|1326007_1326589_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|1326911_1327970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|1327979_1329122_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|1329114_1329888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|1329889_1330969_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|1330968_1331925_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|1331935_1333144_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|1333161_1333629_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|1333889_1334219_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
1334001:1334016	attL	TCCCTGCGCCAGTGGC	NA	NA	NA	NA
WP_000957248.1|1334205_1334547_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|1335489_1337103_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|1337133_1337484_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|1337480_1337906_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000397129.1|1340243_1340915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302565.1|1341103_1341355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001687190.1|1341332_1341512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012817755.1|1341573_1341855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|1341786_1341927_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_001310151.1|1341918_1342275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803992.1|1342228_1342492_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|1343703_1344321_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|1344332_1345007_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|1345007_1345472_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|1345481_1347185_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|1347177_1347498_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|1347506_1347809_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|1347899_1348598_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|1348978_1349254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591997.1|1349478_1351098_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|1351190_1351550_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_071525024.1|1351685_1351934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303893.1|1351959_1352160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|1352235_1352526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|1352549_1352801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028913479.1|1352848_1353454_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001171554.1|1354845_1355226_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1355222_1355570_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1355619_1357158_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000233452.1|1357914_1360275_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|1360429_1360993_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335698.1|1361813_1363199_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|1363417_1363615_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|1363841_1364138_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282209.1|1365249_1367067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|1367253_1368456_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000934041.1|1368975_1371252_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1371282_1371603_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1371925_1372150_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188174.1|1372222_1374169_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
1379432:1379447	attR	TCCCTGCGCCAGTGGC	NA	NA	NA	NA
>prophage 81
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1383429	1385148	5444610		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815358.1|1383429_1385148_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 82
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1388735	1389566	5444610		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255150.1|1388735_1389566_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 83
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1393252	1393981	5444610		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|1393252_1393981_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 84
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1400651	1409801	5444610		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149719.1|1400651_1401779_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.9	2.7e-28
WP_000389260.1|1401819_1402308_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061662.1|1402367_1403213_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105427.1|1403209_1404163_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|1404172_1405306_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126068.1|1405400_1406513_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1406863_1407340_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1407427_1408330_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189187.1|1408390_1409113_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201576.1|1409096_1409384_-	YbjC family protein	NA	NA	NA	NA	NA
WP_001195231.1|1409543_1409801_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 85
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1418367	1419570	5444610		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1418367_1419570_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 86
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1431858	1433730	5444610		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301498.1|1431858_1433730_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.1	1.0e-16
>prophage 87
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1437048	1437711	5444610		Synechococcus_phage(100.0%)	1	NA	NA
WP_000424894.1|1437048_1437711_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
>prophage 88
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1443723	1445316	5444610		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|1443723_1445316_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 89
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1450312	1455536	5444610		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1450312_1450828_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1450880_1450946_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|1451180_1452068_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1452366_1452870_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1453273_1454020_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1454157_1454817_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1454813_1455536_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 90
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1459076	1475972	5444610		Erwinia_phage(16.67%)	13	NA	NA
WP_000710619.1|1459076_1459337_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430049.1|1459601_1461884_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990173.1|1461925_1462612_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	7.7e-18
WP_000146359.1|1462687_1462954_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849297.1|1463218_1463479_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443495.1|1463707_1464793_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386538.1|1464933_1465896_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218659.1|1465923_1468074_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	4.8e-42
WP_000340624.1|1468357_1470370_-	type III secretion system effector EspX2	NA	NA	NA	NA	NA
WP_000007095.1|1470977_1472345_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_149888724.1|1472573_1473245_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|1473247_1474243_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996092.1|1474235_1475972_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 91
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1486571	1487480	5444610		Streptococcus_phage(100.0%)	1	NA	NA
WP_001301716.1|1486571_1487480_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 92
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1493960	1534388	5444610	integrase,terminase,portal,protease,holin,tail,lysis	Enterobacteria_phage(50.0%)	55	1495876:1495890	1534462:1534476
WP_072608447.1|1493960_1495250_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.3e-18
WP_000767391.1|1495308_1495785_+	kinase inhibitor	NA	NA	NA	NA	NA
1495876:1495890	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|1496291_1496990_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_096976694.1|1497042_1497246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951026.1|1497220_1498102_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|1498271_1498433_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|1498929_1499949_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|1499982_1500963_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|1501139_1501409_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|1501410_1502727_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|1502786_1503386_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|1503456_1506870_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|1506930_1507539_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|1507475_1508219_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|1508224_1508923_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|1508932_1509262_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|1509261_1512327_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|1512298_1512628_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|1512636_1513023_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|1513083_1513827_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|1513837_1514239_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|1514235_1514814_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|1514825_1515101_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|1515093_1515417_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|1515503_1517531_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|1517475_1517811_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|1517932_1519057_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|1518984_1519197_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|1519193_1521296_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|1521295_1521787_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|1521776_1522055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|1522461_1522614_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|1522601_1523069_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|1523065_1523563_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|1523562_1523778_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|1523920_1524319_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|1524399_1524558_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1524643_1525387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|1525570_1526260_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|1526274_1526397_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|1526734_1527694_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|1527905_1528571_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|1528567_1529188_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|1529180_1529351_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|1529347_1529530_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|1530227_1530908_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|1530904_1531087_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|1531059_1531251_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|1531261_1531543_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|1531641_1531863_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|1532073_1532676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|1532800_1532986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|1532918_1533086_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|1533125_1533344_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|1533506_1534388_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
1534462:1534476	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 93
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1544098	1550673	5444610		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891683.1|1544098_1545157_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|1545159_1545849_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101994.1|1545848_1546622_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1546788_1546938_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1547066_1547855_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096891.1|1547922_1549395_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265443.1|1549656_1550673_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 94
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1555034	1558554	5444610		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|1555034_1556087_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784348.1|1556402_1556783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951276.1|1556896_1557838_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_000345402.1|1557834_1558554_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
>prophage 95
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1602241	1603033	5444610		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114031.1|1602241_1603033_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.8	4.9e-08
>prophage 96
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1606411	1610774	5444610	transposase	Acinetobacter_phage(33.33%)	3	NA	NA
WP_021500121.1|1606411_1607788_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	1.3e-45
WP_149888726.1|1607827_1609041_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	8.4e-169
WP_000207116.1|1609355_1610774_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.8	1.3e-59
>prophage 97
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1614718	1627444	5444610		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_001511033.1|1614718_1618918_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.6	4.3e-26
WP_000424924.1|1619159_1619366_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001322326.1|1619678_1619768_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741164.1|1619767_1621441_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087992.1|1621463_1623512_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_001301506.1|1623520_1624093_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001301738.1|1624085_1626770_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186104.1|1626766_1627444_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.5	1.8e-27
>prophage 98
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1639146	1642960	5444610	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287136.1|1639146_1640811_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.6	0.0e+00
WP_001023104.1|1641013_1642960_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 99
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1647586	1649251	5444610		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337047.1|1647586_1649251_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	1.6e-85
>prophage 100
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1653348	1654428	5444610		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1653348_1654428_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 101
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1660311	1663844	5444610		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|1660311_1661037_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207527.1|1661154_1662090_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367870.1|1662173_1663844_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	3.0e-76
>prophage 102
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1670785	1673368	5444610	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001301620.1|1670785_1673368_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 103
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1680378	1682818	5444610		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231402.1|1680378_1681467_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1681606_1682818_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 104
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1687633	1688280	5444610		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1687633_1688017_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1688070_1688280_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 105
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1703705	1705820	5444610		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|1703705_1704134_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|1704254_1705820_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 106
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1708888	1710711	5444610		Streptococcus_phage(50.0%)	2	NA	NA
WP_072608445.1|1708888_1710109_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	7.9e-58
WP_000502952.1|1710081_1710711_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 107
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1725071	1731114	5444610		Klosneuvirus(50.0%)	3	NA	NA
WP_000140631.1|1725071_1725887_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	3.3e-07
WP_000096698.1|1725883_1727017_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077784.1|1727232_1731114_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	2.9e-61
>prophage 108
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1742540	1745678	5444610		Leptospira_phage(100.0%)	1	NA	NA
WP_000573920.1|1742540_1745678_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.3	2.6e-60
>prophage 109
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1748823	1760727	5444610		uncultured_Caudovirales_phage(40.0%)	7	NA	NA
WP_000770953.1|1748823_1749507_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253799.1|1749496_1750945_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	1.7e-11
WP_000103382.1|1751538_1753440_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	1.2e-28
WP_001160813.1|1753467_1753929_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_072608444.1|1753948_1758799_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.8	4.5e-19
WP_000658316.1|1758816_1759224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127242.1|1759392_1760727_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.0	1.9e-20
>prophage 110
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1776742	1779873	5444610	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729155.1|1776742_1777609_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1777610_1777823_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_095885749.1|1777930_1778398_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912351.1|1778487_1779873_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 111
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1791394	1792540	5444610		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706350.1|1791394_1792540_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.7	6.3e-49
>prophage 112
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1798645	1800427	5444610		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|1798645_1800427_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 113
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1805682	1813406	5444610		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000014801.1|1805682_1809879_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.8	7.5e-23
WP_000561902.1|1810308_1812723_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|1812719_1813406_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 114
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1816542	1817220	5444610		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|1816542_1817220_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 115
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1822948	1825111	5444610		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000739054.1|1822948_1825111_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.9	1.9e-17
>prophage 116
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1849557	1852618	5444610		uncultured_virus(50.0%)	2	NA	NA
WP_000083954.1|1849557_1852062_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.3e-115
WP_000806442.1|1852276_1852618_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
>prophage 117
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1860861	1869319	5444610		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801803.1|1860861_1861821_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	5.0e-15
WP_001250105.1|1861817_1862780_-	ferrochelatase	NA	NA	NA	NA	NA
WP_000261613.1|1862911_1863616_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|1863736_1865611_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_021500106.1|1865720_1866326_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1866325_1866655_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122006.1|1866707_1868639_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_001301904.1|1868767_1869319_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	1.7e-31
>prophage 118
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1876157	1879307	5444610		Leptospira_phage(100.0%)	1	NA	NA
WP_001132452.1|1876157_1879307_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	3.6e-54
>prophage 119
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1888145	1891692	5444610		Bacillus_phage(100.0%)	2	NA	NA
WP_001256201.1|1888145_1889927_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
WP_001235611.1|1889919_1891692_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 120
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1895014	1895710	5444610		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817243.1|1895014_1895710_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	4.2e-88
>prophage 121
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1898850	1903897	5444610	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1898850_1899123_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001302567.1|1899331_1901686_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.3	6.1e-224
WP_000130305.1|1901873_1903148_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1903273_1903897_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 122
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1922312	1923287	5444610		Klosneuvirus(100.0%)	1	NA	NA
WP_021500102.1|1922312_1923287_+	1-deoxyxylulose-5-phosphate synthase YajO	NA	A0A1V0SKP9	Klosneuvirus	31.4	3.9e-07
>prophage 123
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1927253	1928916	5444610		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001021161.1|1927253_1927724_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150441.1|1927812_1928916_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
>prophage 124
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1932521	1936861	5444610	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_000046637.1|1932521_1933493_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1933503_1935351_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1935378_1935711_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1935733_1936861_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 125
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1945461	1955433	5444610		Bacillus_phage(60.0%)	7	NA	NA
WP_000893613.1|1945461_1946757_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.2	7.7e-27
WP_115720857.1|1946814_1947504_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	7.4e-37
WP_001221319.1|1947693_1948896_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_072608443.1|1948892_1952036_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001306939.1|1952161_1953346_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219315.1|1953488_1954397_-	fructokinase	NA	NA	NA	NA	NA
WP_001301975.1|1954521_1955433_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.3	2.3e-102
>prophage 126
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1962029	1963145	5444610		Bacillus_phage(100.0%)	1	NA	NA
WP_000484042.1|1962029_1963145_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	8.7e-19
>prophage 127
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1970560	1971718	5444610		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|1970560_1971718_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 128
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1987441	1990067	5444610		Bacillus_virus(50.0%)	3	NA	NA
WP_000078833.1|1987441_1988488_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	3.6e-35
WP_001141271.1|1988647_1988923_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842102.1|1988957_1990067_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 129
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	1993145	1995106	5444610		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_001013510.1|1993145_1994159_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
WP_000044300.1|1994155_1995106_-	acetaldehyde dehydrogenase	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.7	3.0e-36
>prophage 130
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2002340	2006620	5444610		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805884.1|2002340_2003423_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.4	2.4e-191
WP_000177948.1|2003545_2006620_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.3	0.0e+00
>prophage 131
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2011156	2012056	5444610		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952470.1|2011156_2012056_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.0	1.2e-15
>prophage 132
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2015614	2017501	5444610		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010271.1|2015614_2017501_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 133
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2025992	2027042	5444610		Tupanvirus(100.0%)	1	NA	NA
WP_000692767.1|2025992_2027042_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.7	1.8e-71
>prophage 134
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2042904	2082507	5444610	holin,transposase	Stx2-converting_phage(40.0%)	29	NA	NA
WP_072178661.1|2042904_2046888_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.4	5.0e-125
WP_000131044.1|2047461_2049495_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301903.1|2049623_2050211_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089099.1|2050224_2051697_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159114.1|2051710_2053399_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	9.6e-62
WP_001303994.1|2055560_2056145_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001213041.1|2056298_2057060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798051.1|2057101_2058196_+	adhesin	NA	NA	NA	NA	NA
WP_001356435.1|2058149_2058362_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000003123.1|2058543_2058960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301982.1|2059454_2060150_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023931.1|2060142_2061570_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|2061580_2062300_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339591.1|2062826_2063681_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046339.1|2063906_2065232_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.6e-112
WP_000474077.1|2065340_2065577_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000417405.1|2065588_2066182_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001301722.1|2066341_2067211_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.5e-53
WP_000621002.1|2067459_2068317_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092592.1|2068437_2072691_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001038968.1|2074024_2074381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302814.1|2074668_2075595_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860023.1|2075751_2076672_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000182335.1|2076906_2078049_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000998048.1|2078860_2080399_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2080448_2080796_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_072608520.1|2080792_2080984_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	93.9	8.1e-18
WP_085948178.1|2080982_2082195_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_149025613.1|2082198_2082507_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	1.0e-46
>prophage 135
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2094592	2096791	5444610		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000667043.1|2094592_2096791_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
>prophage 136
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2106043	2109746	5444610		Enterobacteria_phage(100.0%)	5	NA	NA
WP_000016225.1|2106043_2108377_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|2108390_2108714_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|2108713_2108935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|2108931_2109489_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|2109485_2109746_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
>prophage 137
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2115948	2169719	5444610	plate,integrase,transposase,tail	Enterobacteria_phage(26.09%)	55	2115519:2115533	2151728:2151742
2115519:2115533	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|2115948_2117130_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|2118092_2118836_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|2119659_2120433_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|2120490_2121045_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|2121074_2121569_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|2121568_2122162_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|2122133_2122577_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001096948.1|2122597_2123308_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	86.6	1.3e-65
WP_000788819.1|2123307_2123619_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000185505.1|2123615_2124515_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000251069.1|2124547_2124841_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|2124959_2125160_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|2125260_2125974_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_072608441.1|2126101_2126488_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.4	1.7e-06
WP_001303805.1|2126727_2126973_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|2128042_2129296_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|2129307_2130411_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|2130698_2131754_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|2131792_2132194_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|2132251_2133496_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|2133587_2134046_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|2134306_2135764_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|2135820_2136357_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|2136289_2136556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|2136862_2137315_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|2137324_2137723_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|2137725_2138019_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|2138070_2139126_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001301640.1|2139196_2139967_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|2139926_2141666_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|2142483_2143257_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|2143442_2143703_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|2143721_2143982_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|2144137_2144878_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|2144848_2145616_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|2145720_2146299_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|2146538_2148983_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|2149025_2149499_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|2149652_2150423_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|2150540_2151713_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|2151793_2151979_+	protein YncO	NA	NA	NA	NA	NA
2151728:2151742	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|2151893_2152157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072608440.1|2152358_2154119_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|2154121_2155258_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001303801.1|2155365_2155656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001475373.1|2156003_2156525_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_085949308.1|2156593_2158126_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.2e-24
WP_149888765.1|2158283_2159000_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000509129.1|2159139_2163372_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103125.1|2163447_2165589_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|2165798_2166317_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|2167013_2167514_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|2167548_2167773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|2167823_2169215_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|2169305_2169719_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 138
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2176553	2179331	5444610		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000614375.1|2176553_2179331_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.7	4.7e-82
>prophage 139
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2190108	2197961	5444610		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001301976.1|2190108_2190840_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|2190904_2191372_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301721.1|2191368_2192091_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|2192124_2192880_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|2192951_2194310_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211693.1|2194357_2195128_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2195205_2196006_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|2196246_2197161_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|2197157_2197961_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
>prophage 140
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2204477	2205509	5444610		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|2204477_2205509_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 141
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2218501	2222617	5444610		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294772.1|2218501_2221984_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000569419.1|2222020_2222617_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
>prophage 142
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2231444	2232203	5444610		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|2231444_2232203_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 143
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2243945	2245370	5444610	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|2243945_2245370_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 144
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2249299	2249644	5444610		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2249299_2249644_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 145
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2255555	2256353	5444610		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|2255555_2256353_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 146
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2261596	2268402	5444610	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001301969.1|2261596_2264026_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.8	5.1e-40
WP_001283251.1|2264099_2264630_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|2264644_2265349_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2265526_2265982_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937419.1|2266018_2266945_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|2266983_2268402_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 147
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2278216	2279113	5444610		Sodalis_phage(100.0%)	1	NA	NA
WP_000339951.1|2278216_2279113_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	50.2	2.1e-60
>prophage 148
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2282375	2288998	5444610		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150612.1|2282375_2283302_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	2.0e-21
WP_000651595.1|2283410_2284073_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|2284113_2284650_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001297052.1|2284855_2287246_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_001189611.1|2287447_2288998_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 149
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2296744	2298169	5444610		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2296744_2298169_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 150
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2306679	2307231	5444610		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923722.1|2306679_2307231_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.1e-11
>prophage 151
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2311476	2312520	5444610		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217330.1|2311476_2312520_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.6	3.7e-104
>prophage 152
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2352706	2353405	5444610		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916267.1|2352706_2353405_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	4.7e-23
>prophage 153
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2359741	2365163	5444610		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035699.1|2359741_2362093_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	8.7e-37
WP_001117011.1|2362256_2365163_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 154
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2374255	2376216	5444610		Microcystis_phage(50.0%)	4	NA	NA
WP_000257187.1|2374255_2375104_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_001160975.1|2375100_2375415_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000125566.1|2375417_2375651_-	antitoxin	NA	NA	NA	NA	NA
WP_000624372.1|2375736_2376216_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	5.2e-29
>prophage 155
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2384110	2389771	5444610		Vibrio_phage(50.0%)	4	NA	NA
WP_000787124.1|2384110_2385625_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	20.7	8.7e-06
WP_000347117.1|2385655_2386798_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349922.1|2386926_2388144_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001301863.1|2388217_2389771_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.3	1.2e-34
>prophage 156
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2395274	2396423	5444610		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|2395274_2396423_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 157
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2400829	2403646	5444610	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286832.1|2400829_2403646_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	1.6e-77
>prophage 158
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2413125	2422194	5444610		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681368.1|2413125_2414292_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_000935263.1|2414820_2415030_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	3.0e-18
WP_001118464.1|2415133_2416264_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2416352_2418269_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843566.1|2418645_2419050_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102370.1|2419075_2419789_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|2419937_2420504_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001295414.1|2420538_2421126_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|2421240_2422194_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 159
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2433980	2436094	5444610		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219596.1|2433980_2435405_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	2.1e-09
WP_001188676.1|2435404_2436094_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
>prophage 160
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2439430	2444786	5444610		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|2439430_2441368_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2441578_2443246_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093817.1|2443553_2444786_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	4.7e-82
>prophage 161
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2451506	2452829	5444610		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2451506_2452829_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 162
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2458564	2461440	5444610		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2458564_2458726_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001301888.1|2458852_2459458_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|2459850_2461440_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 163
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2469024	2470304	5444610		Salmonella_phage(50.0%)	2	NA	NA
WP_000098821.1|2469024_2469564_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|2469566_2470304_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 164
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2473528	2478893	5444610		Tupanvirus(50.0%)	4	NA	NA
WP_000106036.1|2473528_2474551_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091572.1|2474689_2475604_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410140.1|2475818_2477180_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919571.1|2477228_2478893_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 165
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2485324	2489293	5444610		Synechococcus_phage(50.0%)	2	NA	NA
WP_000819018.1|2485324_2487757_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
WP_001302468.1|2487823_2489293_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	1.3e-33
>prophage 166
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2519709	2521170	5444610		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|2519709_2521170_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 167
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2531351	2533028	5444610		Escherichia_phage(100.0%)	2	NA	NA
WP_000044700.1|2531351_2531948_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	5.1e-50
WP_000790583.1|2532425_2533028_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 168
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2536390	2561650	5444610		uncultured_Mediterranean_phage(66.67%)	6	NA	NA
WP_000991449.1|2536390_2537371_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.9	1.9e-102
WP_000218177.1|2538864_2540979_-	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	24.1	5.9e-08
WP_149888731.1|2540975_2547317_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.5	1.9e-57
WP_001229642.1|2547316_2552251_-	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	21.0	2.4e-28
WP_001041505.1|2552253_2555112_-	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	24.9	2.9e-42
WP_000383109.1|2555335_2561650_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.7	1.2e-35
>prophage 169
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2570545	2582278	5444610	tRNA,integrase	Enterobacteria_phage(20.0%)	8	2569579:2569594	2576362:2576377
2569579:2569594	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|2570545_2571373_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_001301967.1|2571853_2572873_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	2.4e-44
WP_001294533.1|2573002_2574505_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	3.9e-83
WP_021500077.1|2574665_2575748_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2575747_2576848_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
2576362:2576377	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_000397144.1|2577114_2578626_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2578979_2579423_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|2579422_2582278_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 170
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2590687	2596784	5444610		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|2590687_2591623_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2591635_2592097_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2592169_2592556_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471889.1|2592761_2595458_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2595598_2595652_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181323.1|2595836_2596784_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
>prophage 171
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2600422	2603215	5444610		Vibrio_phage(50.0%)	2	NA	NA
WP_000187775.1|2600422_2602561_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	2.0e-266
WP_001106233.1|2602750_2603215_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
>prophage 172
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2607531	2614019	5444610		Klosneuvirus(33.33%)	6	NA	NA
WP_000853749.1|2607531_2608530_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|2608562_2609558_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|2609544_2610567_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205806.1|2610580_2612083_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|2612222_2613179_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|2613488_2614019_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 173
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2635202	2636850	5444610	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000826430.1|2635202_2636411_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	2.7e-207
WP_000604943.1|2636418_2636850_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
>prophage 174
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2650702	2651866	5444610		Ralstonia_phage(100.0%)	1	NA	NA
WP_021500342.1|2650702_2651866_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.6e-79
>prophage 175
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2655799	2668831	5444610	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076303.1|2655799_2658241_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|2658279_2658705_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2658909_2660208_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2660311_2660509_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2660590_2661595_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2661597_2662857_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2662942_2664223_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2664299_2664608_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280341.1|2664693_2665644_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122476.1|2665636_2667484_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
WP_000990297.1|2667493_2668831_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 176
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2672746	2673292	5444610		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001302216.1|2672746_2673292_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 177
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2680720	2681698	5444610		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2680720_2681698_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 178
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2686617	2687151	5444610		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|2686617_2687151_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 179
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2691498	2693482	5444610		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2691498_2693145_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2693188_2693482_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 180
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2707759	2710971	5444610	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856824.1|2707759_2709217_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.2e-47
WP_001295074.1|2709453_2710971_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 181
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2732167	2733670	5444610		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|2732167_2733670_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 182
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2738608	2739397	5444610		Cedratvirus(100.0%)	1	NA	NA
WP_001193352.1|2738608_2739397_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.5	3.2e-12
>prophage 183
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2745001	2746551	5444610		Bacillus_virus(50.0%)	2	NA	NA
WP_021500337.1|2745001_2745760_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.0	1.6e-16
WP_000611407.1|2745870_2746551_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	4.6e-07
>prophage 184
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2752281	2753802	5444610		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001089388.1|2752281_2753802_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	7.7e-18
>prophage 185
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2759338	2761324	5444610		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001066022.1|2759338_2761324_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	9.3e-149
>prophage 186
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2766569	2768717	5444610		Escherichia_phage(100.0%)	1	NA	NA
WP_010904990.1|2766569_2768717_+	formate dehydrogenase N subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 187
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2778100	2780059	5444610		Staphylococcus_phage(100.0%)	1	NA	NA
WP_072608517.1|2778100_2780059_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.0	8.2e-89
>prophage 188
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2785646	2786996	5444610		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2785646_2786996_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 189
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2790812	2794426	5444610		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2790812_2791349_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357763.1|2791603_2794426_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 190
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2798605	2814402	5444610	tRNA,integrase,tail	Enterobacteria_phage(35.29%)	20	2795578:2795593	2813107:2813122
2795578:2795593	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_001147332.1|2798605_2799685_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	4.0e-29
WP_000918366.1|2799737_2801153_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|2801235_2802219_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|2802384_2802627_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|2802760_2803798_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|2803886_2804984_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|2805045_2805294_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|2805454_2806096_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|2806177_2806807_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|2806879_2807452_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|2807563_2807833_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|2807834_2809148_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|2809212_2809812_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|2811133_2811670_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|2811660_2812011_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|2812007_2812292_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001449563.1|2812301_2812481_+	hypothetical protein	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
WP_000829415.1|2812627_2812825_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|2813169_2813451_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
2813107:2813122	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000956557.1|2813868_2814402_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 191
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2818569	2819178	5444610		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2818569_2819178_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 192
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2828301	2829417	5444610		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2828301_2829417_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 193
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2854803	2858487	5444610		Dickeya_phage(100.0%)	1	NA	NA
WP_000096047.1|2854803_2858487_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 194
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2874377	2875967	5444610		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187564.1|2874377_2875967_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 195
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2881335	2883099	5444610		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2881335_2881608_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940104.1|2881794_2882385_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|2882427_2883099_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 196
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2892244	2900573	5444610		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2892244_2896468_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2896544_2900573_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 197
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2904568	2907621	5444610		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2904568_2905753_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2906670_2907621_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 198
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2915962	2921745	5444610	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
WP_000591342.1|2915962_2917807_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	3.2e-10
WP_000187008.1|2918175_2919276_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|2919315_2919675_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|2919674_2920325_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000125471.1|2920428_2921745_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.7	1.2e-59
>prophage 199
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2937536	2944783	5444610		Serratia_phage(33.33%)	5	NA	NA
WP_000184851.1|2937536_2939834_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2939884_2940205_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|2940219_2941299_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174066.1|2941607_2944109_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424823.1|2944120_2944783_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 200
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2967470	2968802	5444610		Erwinia_phage(100.0%)	1	NA	NA
WP_001293341.1|2967470_2968802_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 201
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2972565	2973411	5444610		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000084268.1|2972565_2973411_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 202
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	2985079	2989940	5444610		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|2985079_2985778_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2985774_2987148_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270249.1|2987253_2987928_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166037.1|2988076_2989060_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2989319_2989940_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 203
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3006251	3009302	5444610		Escherichia_phage(100.0%)	1	NA	NA
WP_010917870.1|3006251_3009302_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 204
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3018684	3021464	5444610		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|3018684_3019470_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621641.1|3019503_3020400_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718899.1|3020567_3021464_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 205
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3038459	3040930	5444610		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_069357361.1|3038459_3039509_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.8	8.4e-08
WP_001188777.1|3039520_3040930_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 206
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3045005	3047792	5444610		uncultured_virus(100.0%)	1	NA	NA
WP_000250007.1|3045005_3047792_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	2.2e-71
>prophage 207
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3061480	3062095	5444610		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|3061480_3062095_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 208
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3070885	3074172	5444610		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|3070885_3071662_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|3071664_3072180_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|3072183_3072453_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|3072531_3074172_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 209
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3086703	3088533	5444610		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3086703_3088533_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 210
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3096903	3100762	5444610		Bacillus_phage(100.0%)	3	NA	NA
WP_000383407.1|3096903_3099066_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213567.1|3099149_3099866_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130682.1|3099865_3100762_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	30.0	2.2e-25
>prophage 211
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3111071	3112727	5444610		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395849.1|3111071_3112727_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 212
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3121037	3127181	5444610		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612040.1|3121037_3122168_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145177.1|3122172_3122847_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676061.1|3122824_3123706_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	9.6e-106
WP_001226597.1|3123724_3124792_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	6.6e-101
WP_000006621.1|3124791_3126054_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866672.1|3126050_3127181_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 213
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3131223	3136637	5444610		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|3131223_3131553_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047491.1|3131683_3132949_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	4.1e-41
WP_001295254.1|3133084_3134569_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|3134615_3136637_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 214
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3145069	3146716	5444610		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012623.1|3145069_3146716_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.0	2.5e-67
>prophage 215
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3160107	3165960	5444610		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|3160107_3160998_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|3161022_3161988_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387782.1|3161992_3163498_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_001301979.1|3163505_3163925_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102329.1|3164091_3165960_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.4	1.9e-63
>prophage 216
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3169128	3170121	5444610		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|3169128_3170121_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 217
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3182074	3185436	5444610		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|3182074_3183445_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334100.1|3183606_3185436_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
>prophage 218
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3192486	3196419	5444610		Cyanophage(50.0%)	4	NA	NA
WP_000867143.1|3192486_3193527_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|3193613_3194573_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|3194572_3195463_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|3195645_3196419_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 219
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3205401	3206739	5444610		Moraxella_phage(100.0%)	1	NA	NA
WP_001301685.1|3205401_3206739_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	3.4e-62
>prophage 220
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3219413	3226782	5444610		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001303730.1|3219413_3219671_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239733.1|3219634_3219994_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3220010_3220151_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|3220380_3220461_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059116.1|3220757_3222161_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3222165_3223266_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|3223265_3224339_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|3224367_3226782_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 221
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3232313	3233267	5444610		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|3232313_3232727_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3232838_3233267_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 222
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3240127	3249149	5444610		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087120.1|3240127_3241843_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.4	5.6e-41
WP_000828465.1|3241839_3243333_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	6.6e-30
WP_000511301.1|3243379_3243829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|3243937_3244285_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3244274_3244637_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148051.1|3244633_3245131_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001302348.1|3245138_3246323_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000060506.1|3246602_3246692_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_010904951.1|3247256_3247355_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168421.1|3247460_3249149_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	1.8e-55
>prophage 223
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3277805	3279344	5444610		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723942.1|3277805_3279344_-	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	29.3	1.0e-09
>prophage 224
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3302327	3304640	5444610	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000998051.1|3302327_3303866_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|3303915_3304263_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3304259_3304640_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 225
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3308479	3309661	5444610	integrase	Enterobacteria_phage(100.0%)	1	3307654:3307667	3321266:3321279
3307654:3307667	attL	ATCTCCGCACCATA	NA	NA	NA	NA
WP_001219063.1|3308479_3309661_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
WP_001219063.1|3308479_3309661_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
3321266:3321279	attR	ATCTCCGCACCATA	NA	NA	NA	NA
>prophage 226
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3315836	3317228	5444610		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3315836_3317228_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 227
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3322349	3329100	5444610		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|3322349_3324458_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3324476_3324752_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001301691.1|3324806_3325430_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	33.9	3.5e-17
WP_001303719.1|3325687_3327370_+	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.8	3.3e-22
WP_000924289.1|3327366_3327984_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001002036.1|3328275_3329100_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.1	4.5e-89
>prophage 228
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3332473	3337036	5444610		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|3332473_3332929_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050139.1|3332909_3334130_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001297375.1|3334301_3334970_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|3335186_3335423_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3335443_3335611_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|3335708_3336518_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|3336556_3337036_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 229
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3348967	3359697	5444610		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|3348967_3349900_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001307464.1|3350188_3351061_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|3351335_3352532_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646013.1|3352541_3353567_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.8e-18
WP_001303717.1|3353805_3354822_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.7e-09
WP_000483856.1|3354827_3355787_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|3355790_3357074_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116565.1|3357083_3358628_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|3358872_3359304_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|3359445_3359697_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 230
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3381582	3392744	5444610	tRNA	uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_149888739.1|3381582_3385812_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	1.1e-24
WP_000779800.1|3386040_3386649_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_072608508.1|3386746_3388138_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582452.1|3388134_3389979_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
WP_000168711.1|3390167_3391319_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000985752.1|3391448_3392744_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
>prophage 231
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3410783	3412325	5444610		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146509.1|3410783_3412325_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 232
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3417643	3418639	5444610		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182646.1|3417643_3418639_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	3.1e-12
>prophage 233
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3422860	3423073	5444610		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3422860_3423073_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 234
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3426727	3429061	5444610		Escherichia_phage(100.0%)	1	NA	NA
WP_000185340.1|3426727_3429061_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	8.3e-72
>prophage 235
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3444701	3446686	5444610		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|3444701_3445685_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107027.1|3445681_3446686_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 236
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3492668	3494138	5444610		Bacillus_virus(50.0%)	2	NA	NA
WP_001296814.1|3492668_3493316_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
WP_000622314.1|3493367_3494138_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	1.3e-18
>prophage 237
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3505726	3507861	5444610		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065773.1|3505726_3506152_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.6e-50
WP_000922639.1|3506164_3507454_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008967.1|3507507_3507861_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	3.7e-24
>prophage 238
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3511210	3513253	5444610		Indivirus(100.0%)	1	NA	NA
WP_001301787.1|3511210_3513253_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	8.9e-46
>prophage 239
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3526689	3530897	5444610		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000149107.1|3526689_3529425_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001301659.1|3529424_3530549_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001259386.1|3530621_3530897_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	1.9e-15
>prophage 240
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3537517	3538324	5444610		Bacillus_virus(100.0%)	1	NA	NA
WP_000173697.1|3537517_3538324_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.7	1.3e-16
>prophage 241
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3561567	3565699	5444610		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|3561567_3562233_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|3562453_3562699_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106562.1|3562800_3564999_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	1.5e-118
WP_000964718.1|3565072_3565699_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 242
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3568705	3571524	5444610		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|3568705_3569374_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|3569366_3570425_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3570669_3571524_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 243
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3578005	3579488	5444610		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3578005_3578773_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|3578774_3579488_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 244
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3583857	3585668	5444610		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907770.1|3583857_3584928_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.3e-19
WP_000073575.1|3584924_3585668_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.5	6.4e-10
>prophage 245
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3595861	3596856	5444610		Catovirus(50.0%)	2	NA	NA
WP_000410808.1|3595861_3596470_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	34.0	2.2e-16
WP_000502498.1|3596454_3596856_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	42.9	8.2e-12
>prophage 246
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3608315	3610763	5444610		Dickeya_phage(100.0%)	1	NA	NA
WP_000993447.1|3608315_3610763_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 247
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3619669	3620896	5444610		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105473.1|3619669_3620896_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.8	3.4e-133
>prophage 248
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3626115	3628509	5444610		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081903.1|3626115_3628509_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 249
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3634476	3635355	5444610		Sodalis_phage(100.0%)	1	NA	NA
WP_000039084.1|3634476_3635355_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	4.2e-69
>prophage 250
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3641918	3645685	5444610		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3641918_3642638_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253697.1|3642634_3643987_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001301499.1|3644062_3645685_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	2.6e-141
>prophage 251
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3662587	3663424	5444610		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3662587_3663424_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 252
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3679961	3689502	5444610		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601867.1|3679961_3680525_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	9.3e-62
WP_000963819.1|3680610_3681831_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|3681897_3683988_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|3684038_3684671_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3684972_3685377_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274677.1|3685431_3686301_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3686354_3686573_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057377.1|3686566_3687589_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|3687588_3689502_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 253
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3695072	3700646	5444610		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_001209704.1|3695072_3695459_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	2.1e-17
WP_000820735.1|3695458_3695818_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	3.1e-10
WP_000903376.1|3695825_3696113_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3696238_3696613_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3696709_3697180_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3697276_3699391_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3699461_3700646_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 254
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3720523	3721995	5444610	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004459.1|3720523_3721471_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|3721485_3721995_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 255
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3732495	3736649	5444610		Bacillus_virus(50.0%)	4	NA	NA
WP_000078338.1|3732495_3733254_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001303200.1|3733261_3734365_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019652.1|3734374_3735556_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|3735623_3736649_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 256
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3743198	3744083	5444610		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258927.1|3743198_3744083_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	1.1e-24
>prophage 257
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3754647	3755691	5444610		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3754647_3755691_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 258
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3772191	3774716	5444610	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|3772191_3773259_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001301636.1|3773348_3774716_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	5.1e-21
>prophage 259
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3778682	3779180	5444610	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3778682_3779180_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 260
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3782873	3787543	5444610		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108469.1|3782873_3784364_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	3.7e-09
WP_001301938.1|3784411_3785101_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209030.1|3785097_3785973_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979870.1|3785969_3786434_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445155.1|3786493_3787543_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	9.8e-73
>prophage 261
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3794291	3809086	5444610		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|3794291_3795221_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809770.1|3795316_3797653_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001302019.1|3797882_3798536_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047079.1|3798532_3799261_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_021500310.1|3799257_3799890_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3800103_3800376_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3800372_3801227_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_001301839.1|3801272_3801764_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3801881_3802169_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3802191_3803625_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3803672_3804398_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3804404_3804962_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3804930_3805506_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|3805502_3806069_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001302021.1|3806089_3807076_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	2.5e-38
WP_000922872.1|3807089_3808067_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3808276_3809086_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 262
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3813154	3814633	5444610		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3813154_3813433_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047341.1|3813661_3814633_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 263
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3821261	3824134	5444610	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107466.1|3821261_3823196_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3823285_3824134_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 264
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3828216	3834879	5444610		Dickeya_phage(50.0%)	4	NA	NA
WP_000207678.1|3828216_3829560_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3830190_3830643_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|3830670_3832158_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133053.1|3832182_3834879_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.6e-24
>prophage 265
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3840361	3842251	5444610		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001301504.1|3840361_3842251_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 266
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3847952	3860158	5444610	transposase	Stx2-converting_phage(37.5%)	15	NA	NA
WP_000189317.1|3847952_3848255_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449463.1|3848305_3848749_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|3848728_3849247_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000084526.1|3849374_3850010_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147622.1|3850082_3851123_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|3851236_3851812_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|3851821_3852412_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246856.1|3852431_3852827_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249209.1|3852784_3854821_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809262.1|3854885_3855746_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000638266.1|3855788_3856262_-	fimbrial protein	NA	NA	NA	NA	NA
WP_085948178.1|3856245_3857459_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000612591.1|3857649_3857997_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3858046_3859585_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000624681.1|3859807_3860158_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
>prophage 267
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3876889	3877774	5444610		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3876889_3877774_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 268
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3883850	3895976	5444610		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013136.1|3883850_3884678_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	9.5e-63
WP_000848536.1|3885848_3886106_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095178.1|3886148_3888368_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|3888478_3889891_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|3889965_3890703_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|3890936_3893195_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_001301989.1|3893332_3894940_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183479.1|3895048_3895531_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|3895583_3895976_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 269
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3902101	3917432	5444610		uncultured_Caudovirales_phage(14.29%)	14	NA	NA
WP_000986441.1|3902101_3903085_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	8.5e-10
WP_000940880.1|3903081_3903891_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
WP_001051708.1|3904264_3906406_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195286.1|3906469_3908362_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	2.6e-92
WP_000105733.1|3908390_3908972_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|3908971_3909799_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3909823_3910246_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3910246_3910876_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735274.1|3911080_3912562_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|3912709_3913381_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|3913386_3914547_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188393.1|3914584_3915400_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3915515_3916289_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_001076997.1|3916778_3917432_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 270
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3921719	3923153	5444610		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869160.1|3921719_3923153_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	1.1e-39
>prophage 271
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3928290	3929529	5444610	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708496.1|3928290_3929529_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	2.2e-92
>prophage 272
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3935932	3952128	5444610	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|3935932_3936946_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|3937183_3937399_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3937509_3939255_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|3939449_3941291_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228926.1|3941369_3941876_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065895.1|3942129_3942894_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018008.1|3943181_3943805_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094674.1|3943958_3945479_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.8e-35
WP_000633381.1|3945785_3947276_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450588.1|3947317_3947650_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212464.1|3947868_3948852_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_021500305.1|3949035_3952128_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	5.5e-156
>prophage 273
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3965083	3966049	5444610		Escherichia_phage(100.0%)	1	NA	NA
WP_001098809.1|3965083_3966049_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	6.7e-36
>prophage 274
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3986630	3988925	5444610		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861740.1|3986630_3988925_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.3e-157
>prophage 275
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	3996624	3997770	5444610		Streptococcus_phage(100.0%)	1	NA	NA
WP_001301934.1|3996624_3997770_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 276
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4020024	4021311	5444610	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_149888726.1|4020024_4021237_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	8.4e-169
WP_001449203.1|4021203_4021311_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.1e-07
>prophage 277
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4026010	4027000	5444610		Salmonella_phage(100.0%)	1	NA	NA
WP_000953022.1|4026010_4027000_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	2.9e-98
>prophage 278
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4032236	4038381	5444610	integrase	Stx2-converting_phage(50.0%)	4	4020279:4020292	4042916:4042929
4020279:4020292	attL	CAGTAACGATATCC	NA	NA	NA	NA
WP_000605048.1|4032236_4032785_+	Ail/Lom family protein	NA	Q9LA63	Enterobacterial_phage	32.4	9.8e-16
WP_000631719.1|4035106_4035454_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001301939.1|4035450_4036125_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	31.6	4.7e-12
WP_001218882.1|4037115_4038381_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.0e-76
4042916:4042929	attR	CAGTAACGATATCC	NA	NA	NA	NA
>prophage 279
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4061267	4062422	5444610		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|4061267_4062422_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 280
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4076025	4076703	5444610		Bacillus_virus(100.0%)	1	NA	NA
WP_000956885.1|4076025_4076703_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	2.9e-09
>prophage 281
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4094708	4095941	5444610		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4094708_4095941_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 282
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4104470	4108943	5444610		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000195009.1|4104470_4107344_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
WP_001310226.1|4107509_4108943_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.8	2.0e-31
>prophage 283
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4112748	4128140	5444610	tRNA	Brevibacillus_phage(14.29%)	13	NA	NA
WP_000806638.1|4112748_4113645_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|4113669_4114380_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813185.1|4114385_4116119_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_001701073.1|4116209_4117307_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003075.1|4117317_4118835_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	7.7e-87
WP_001192814.1|4118877_4119426_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|4119480_4119552_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|4119548_4119674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303646.1|4119675_4121124_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	4.3e-26
WP_001322328.1|4121559_4123479_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000012163.1|4124002_4125370_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000012247.1|4125405_4126722_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|4126739_4128140_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 284
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4152419	4153175	5444610		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|4152419_4153175_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 285
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4184981	4187476	5444610		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603526.1|4184981_4185743_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
WP_000256438.1|4186057_4187476_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 286
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4197107	4203880	5444610		Moraxella_phage(33.33%)	7	NA	NA
WP_000895624.1|4197107_4197821_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|4197889_4198579_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_001453804.1|4198757_4198952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564489.1|4199263_4199794_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|4199806_4202053_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4202203_4203079_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4203085_4203880_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 287
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4209356	4224904	5444610	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001138211.1|4209356_4212245_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	3.4e-67
WP_001301864.1|4212237_4215780_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	4.4e-08
WP_000775988.1|4215779_4217606_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	1.6e-25
WP_000237947.1|4217667_4218999_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|4219230_4220484_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|4221062_4222160_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117733.1|4222398_4223205_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	7.2e-15
WP_000184261.1|4223255_4223699_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001301742.1|4223698_4224904_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.3e-73
>prophage 288
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4236430	4237186	5444610		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|4236430_4237186_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 289
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4242044	4242893	5444610		Vibrio_phage(100.0%)	1	NA	NA
WP_000100435.1|4242044_4242893_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.1e-41
>prophage 290
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4250419	4254534	5444610		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|4250419_4253176_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046824.1|4253232_4254534_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	1.1e-38
>prophage 291
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4258566	4261590	5444610		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_000210878.1|4258566_4260204_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|4260291_4261590_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
>prophage 292
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4265405	4266077	5444610		Vibrio_phage(100.0%)	1	NA	NA
WP_001199973.1|4265405_4266077_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 293
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4270241	4271027	5444610		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021347.1|4270241_4271027_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 294
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4294689	4296722	5444610		Hokovirus(50.0%)	2	NA	NA
WP_001090366.1|4294689_4296117_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|4296116_4296722_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 295
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4299834	4309855	5444610		uncultured_Mediterranean_phage(33.33%)	10	NA	NA
WP_001295182.1|4299834_4300596_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4300589_4301216_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272567.1|4301355_4302495_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4302557_4303550_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000175365.1|4303669_4304077_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000767724.1|4304223_4304817_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000863205.1|4304816_4306244_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000562982.1|4306254_4306491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001141350.1|4306531_4307188_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	7.3e-50
WP_001272898.1|4307293_4309855_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 296
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4327645	4328659	5444610		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001302219.1|4327645_4328659_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	3.0e-26
>prophage 297
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4336134	4337100	5444610		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|4336134_4337100_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 298
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4342567	4347952	5444610	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_001301974.1|4342567_4343065_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	7.5e-31
WP_000963143.1|4343144_4344206_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|4344273_4344774_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047198.1|4344901_4347532_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4347766_4347952_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 299
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4360671	4365968	5444610		Bacillus_virus(20.0%)	5	NA	NA
WP_000985501.1|4360671_4361874_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.9e-27
WP_000777971.1|4362229_4363189_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.9e-132
WP_000246553.1|4363198_4365343_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.9e-196
WP_000080947.1|4365315_4365726_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|4365722_4365968_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 300
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4371867	4375919	5444610		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|4371867_4372317_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|4372317_4372980_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001301367.1|4373000_4374401_-	GABA permease	NA	NA	NA	NA	NA
WP_000097647.1|4374638_4375919_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
>prophage 301
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4385382	4385592	5444610		Salmonella_phage(100.0%)	1	NA	NA
WP_072145424.1|4385382_4385592_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.2	1.7e-08
>prophage 302
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4391898	4414601	5444610	integrase,transposase,holin,tail	Stx2-converting_phage(40.0%)	27	4384069:4384083	4415472:4415486
4384069:4384083	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_001071599.1|4391898_4392105_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000540864.1|4392427_4393633_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|4393634_4394948_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|4394944_4396576_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|4396576_4396975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|4397072_4397486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150575.1|4397881_4399150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|4399225_4399528_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|4399563_4400319_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|4400624_4401191_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|4401165_4401777_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001505172.1|4401773_4402439_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	1.3e-131
WP_001235472.1|4402435_4403059_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|4403311_4404055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|4404140_4404308_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000284517.1|4406717_4406933_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|4406937_4407282_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|4407638_4408019_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4408015_4408363_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001303014.1|4408412_4408979_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_001023396.1|4408980_4409250_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072608503.1|4409410_4409833_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	96.3	6.3e-71
WP_001144077.1|4411099_4411750_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|4411932_4412523_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|4412509_4412629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|4413024_4413273_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|4414118_4414601_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
4415472:4415486	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 303
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4428236	4429307	5444610		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168032.1|4428236_4429307_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
>prophage 304
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4435213	4437787	5444610		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4435213_4437787_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 305
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4443560	4444859	5444610		Burkholderia_virus(100.0%)	1	NA	NA
WP_000852126.1|4443560_4444859_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
>prophage 306
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4450152	4456235	5444610	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4450152_4450572_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|4450778_4451816_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262720.1|4451863_4452553_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000627807.1|4452857_4453241_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189215.1|4453296_4453884_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001383425.1|4453986_4454868_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4454900_4456235_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 307
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4461994	4465737	5444610		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|4461994_4463794_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4463809_4464784_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4465056_4465737_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 308
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4469197	4469458	5444610		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|4469197_4469458_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 309
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4473576	4484884	5444610		Bacillus_phage(50.0%)	7	NA	NA
WP_000970087.1|4473576_4477464_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
WP_001301750.1|4478039_4479467_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.8e-16
WP_001215861.1|4479631_4480345_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001295369.1|4480334_4481669_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4481729_4482068_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883120.1|4482112_4483303_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919165.1|4483630_4484884_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 310
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4490641	4492153	5444610		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493513.1|4490641_4492153_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	8.7e-14
>prophage 311
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4507317	4513774	5444610		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4507317_4508532_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4508559_4508946_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_072608502.1|4508962_4509286_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|4509381_4509897_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|4509913_4511764_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|4511765_4512101_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4512112_4512313_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133587.1|4512490_4513774_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 312
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4523682	4528930	5444610		Escherichia_phage(66.67%)	5	NA	NA
WP_000380694.1|4523682_4526064_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	38.8	1.3e-144
WP_000077290.1|4526060_4526690_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.9	3.3e-60
WP_000544905.1|4526682_4527504_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000948584.1|4527503_4528358_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000963837.1|4528498_4528930_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 313
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4537759	4544054	5444610		Escherichia_phage(60.0%)	6	NA	NA
WP_000937887.1|4537759_4539130_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|4539291_4540758_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|4540826_4542404_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755178.1|4542496_4543036_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000669402.1|4543051_4543567_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_001344399.1|4543880_4544054_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 314
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4550488	4554490	5444610		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028610.1|4550488_4551127_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	5.3e-29
WP_001301832.1|4551126_4552164_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|4552488_4553115_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|4553200_4554490_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 315
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4575790	4576504	5444610		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4575790_4576504_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 316
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4593763	4594714	5444610		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4593763_4594714_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 317
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4613179	4618117	5444610		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|4613179_4614049_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|4614262_4614688_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000842944.1|4614674_4615124_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838957.1|4615184_4615760_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001301804.1|4615855_4616755_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001302015.1|4616812_4618117_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	24.7	5.6e-09
>prophage 318
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4621595	4636964	5444610		Streptococcus_phage(33.33%)	14	NA	NA
WP_000517430.1|4621595_4622387_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	2.0e-17
WP_000290223.1|4622544_4623561_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458420.1|4623560_4624394_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852688.1|4624393_4625269_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021035.1|4625258_4626356_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001301606.1|4626489_4627401_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	5.9e-58
WP_000096648.1|4627875_4628727_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4628769_4629279_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4629319_4631047_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4631091_4631349_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4631732_4632704_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|4632888_4633650_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001299866.1|4633879_4634878_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443697.1|4634948_4636964_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.3	1.5e-149
>prophage 319
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4641718	4643477	5444610	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_000604897.1|4641718_4642261_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	57.7	5.1e-41
WP_000826440.1|4642268_4643477_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	6.0e-207
>prophage 320
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4660253	4660988	5444610		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4660253_4660988_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 321
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4664806	4665727	5444610		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|4664806_4665727_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 322
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4669421	4676994	5444610		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
WP_001283490.1|4669421_4671116_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000955028.1|4671185_4672130_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001301578.1|4673400_4676994_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	7.8e-37
>prophage 323
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4683647	4690003	5444610	transposase	Bacillus_phage(33.33%)	5	NA	NA
WP_000194527.1|4683647_4685081_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	1.2e-28
WP_001274894.1|4685232_4686147_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_149888748.1|4686218_4687403_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_149888726.1|4687428_4688641_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	8.4e-169
WP_001102876.1|4689376_4690003_-	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	28.7	5.9e-09
>prophage 324
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4693467	4698854	5444610	integrase	Enterobacteria_phage(50.0%)	6	4681167:4681183	4701050:4701066
4681167:4681183	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_072608501.1|4693467_4693998_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	4.8e-68
WP_000403517.1|4693997_4694465_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|4694451_4695132_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|4695141_4696278_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|4696452_4697610_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|4697921_4698854_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
4701050:4701066	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 325
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4717323	4718409	5444610		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|4717323_4718409_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 326
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4726955	4728092	5444610		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699109.1|4726955_4728092_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
>prophage 327
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4734841	4736359	5444610		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|4734841_4736359_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 328
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4740570	4742431	5444610		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|4740570_4741344_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156155.1|4741540_4742431_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	52.7	2.6e-66
>prophage 329
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4752990	4756218	5444610		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203399.1|4752990_4753641_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
WP_001012899.1|4753727_4755560_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|4755618_4756218_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 330
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4790715	4795719	5444610		Tupanvirus(50.0%)	4	NA	NA
WP_000860282.1|4790715_4792698_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	2.4e-19
WP_000461646.1|4792697_4793666_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A0A075B8F6	Enterobacteria_phage	32.6	1.2e-35
WP_072608526.1|4793669_4794809_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	1.5e-29
WP_001302794.1|4795116_4795719_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 331
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4799322	4804974	5444610	transposase	Oenococcus_phage(33.33%)	5	NA	NA
WP_000174589.1|4799322_4800528_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	4.2e-27
WP_000100889.1|4800584_4801142_+	MFS transporter	NA	NA	NA	NA	NA
WP_085948178.1|4801144_4802358_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_027868265.1|4803212_4804007_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000140578.1|4804047_4804974_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.0e-69
>prophage 332
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4810866	4811943	5444610		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779084.1|4810866_4811943_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 333
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4816705	4820602	5444610		Pseudomonas_phage(66.67%)	3	NA	NA
WP_000135039.1|4816705_4816960_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
WP_000332037.1|4816959_4818090_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_001075170.1|4818316_4820602_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
>prophage 334
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4826077	4828705	5444610		Bacillus_virus(100.0%)	1	NA	NA
WP_001281251.1|4826077_4828705_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 335
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4838405	4841255	5444610		Hokovirus(100.0%)	1	NA	NA
WP_000876002.1|4838405_4841255_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	4.1e-41
>prophage 336
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4845532	4851310	5444610		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865552.1|4845532_4846636_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.7	9.5e-119
WP_000406064.1|4846747_4847803_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786353.1|4847876_4848941_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000884972.1|4848940_4849591_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422218.1|4849666_4851310_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
>prophage 337
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4860077	4860695	5444610		Bacillus_virus(100.0%)	1	NA	NA
WP_001301955.1|4860077_4860695_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.5e-12
>prophage 338
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4872391	4880039	5444610		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|4872391_4873399_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494181.1|4873537_4873822_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578056.1|4873946_4875707_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	8.4e-101
WP_001234850.1|4875855_4876551_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213385.1|4876578_4877769_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_000202795.1|4878101_4878446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194871.1|4878449_4880039_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	4.2e-19
>prophage 339
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4885793	4890104	5444610		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4885793_4886360_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|4886772_4887486_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198815.1|4887524_4888511_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000188434.1|4888628_4890104_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
>prophage 340
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4904592	4905450	5444610		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|4904592_4905450_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 341
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4909518	4913292	5444610		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489254.1|4909518_4911498_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
WP_000425434.1|4911529_4912366_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|4912623_4913292_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 342
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4916985	4918506	5444610		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255020.1|4916985_4918506_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 343
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	4944989	5050538	5444610	integrase,terminase,tRNA,portal,head,protease,holin,tail,capsid	Enterobacteria_phage(45.0%)	126	5029257:5029316	5045104:5045173
WP_000569336.1|4944989_4945916_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|4945920_4946652_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4946632_4946740_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|4946799_4947501_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|4947521_4948808_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|4948841_4949096_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|4949114_4949249_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|4949252_4949495_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|4949582_4949945_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|4949941_4950298_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|4950374_4950662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356547.1|4950631_4950808_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|4950809_4951757_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|4951753_4951975_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|4952073_4952355_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|4952365_4952557_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|4952529_4952712_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|4952711_4953389_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|4953385_4954171_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|4954176_4954473_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|4954548_4954839_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|4955342_4956950_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_107127654.1|4957056_4957749_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182877.1|4958112_4958652_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001415152.1|4958738_4959668_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_000788902.1|4959664_4960366_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_000152742.1|4960570_4960918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|4961666_4962275_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|4962574_4962991_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|4962969_4963371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|4963494_4963596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|4963592_4964048_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|4964047_4964218_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|4964210_4964501_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|4964497_4964860_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|4964856_4964997_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|4965082_4965517_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_015971135.1|4965505_4965751_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_001356551.1|4965765_4965918_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_149888752.1|4966721_4968668_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_000143458.1|4968804_4968984_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|4969024_4969270_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|4969347_4969563_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|4969567_4970101_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|4970371_4970941_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|4970940_4971087_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|4971314_4971500_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|4971711_4971984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|4972016_4972493_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_149888753.1|4972489_4974613_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_000102414.1|4974609_4974822_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|4974821_4976324_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|4976268_4978293_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|4978380_4978707_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|4978699_4978981_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|4978983_4979607_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_021500195.1|4979619_4980018_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	3.8e-70
WP_000235090.1|4980025_4980778_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_044707580.1|4980791_4981214_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
WP_000533450.1|4981240_4981549_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	98.0	6.6e-54
WP_072608479.1|4981592_4984238_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.7	0.0e+00
WP_000847306.1|4984234_4984564_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_072608478.1|4984563_4985262_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	2.0e-130
WP_143189876.1|4985960_4986593_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	1.3e-109
WP_001228289.1|4990378_4990978_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_149888754.1|4991042_4992356_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
WP_001023455.1|4992357_4992627_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_001261937.1|4992994_4993243_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|4993757_4995443_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|4995439_4996159_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4996205_4996676_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4996717_4997179_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|4997303_4999307_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|4999303_5000440_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|5000432_5001164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149888755.1|5001182_5002712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|5002722_5003811_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|5005051_5005369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|5005430_5009060_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|5009069_5010611_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|5010774_5012055_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|5016017_5018051_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|5018182_5019292_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|5019553_5019835_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|5020126_5020669_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|5020756_5021431_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|5021446_5023927_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|5023937_5024972_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|5025053_5025392_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134630.1|5025609_5026455_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|5026575_5026848_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|5026957_5027272_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|5027281_5027629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|5028679_5028919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101891386.1|5029175_5029379_-	hypothetical protein	NA	NA	NA	NA	NA
5029257:5029316	attL	TTGTTTGTTATTGTTCGTCGTTGTTCGTAGAGCTTCAACGAAATGTGTGGTCAGTTGTGT	NA	NA	NA	NA
WP_021500177.1|5029359_5030580_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.0	1.5e-133
WP_000775337.1|5030576_5031350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075374.1|5031441_5031666_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_107127644.1|5031676_5032723_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|5032715_5032901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748511.1|5032900_5033092_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	3.8e-07
WP_032253774.1|5033081_5033324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024748509.1|5033329_5033629_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_021500345.1|5033625_5035758_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	3.4e-173
WP_024165893.1|5036130_5036382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368652.1|5036495_5036684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126693.1|5036693_5037104_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_024165864.1|5037116_5037389_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021500171.1|5037676_5038834_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	65.1	5.6e-138
WP_000987369.1|5038888_5039446_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	3.5e-61
WP_021521615.1|5039483_5040659_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	1.4e-184
WP_001020665.1|5040655_5040994_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	6.6e-31
WP_000134113.1|5040990_5041287_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|5041286_5041727_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174067.1|5041710_5041893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021500172.1|5042015_5042372_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	3.6e-51
WP_021500173.1|5042355_5044017_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.0	3.2e-275
WP_021500174.1|5044031_5044313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071790609.1|5044430_5044706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071790608.1|5045034_5045301_-	hypothetical protein	NA	NA	NA	NA	NA
5045104:5045173	attR	TTGTTTGTTATTGTTCGTCGTTGTTCGTAGAGCTTCAACGAAATGTGTGGTCAGTTGTGTGGTCAGTTTT	NA	NA	NA	NA
WP_001195634.1|5045331_5046120_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|5046116_5046917_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|5046981_5047800_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|5047851_5048598_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|5048571_5049537_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|5049533_5050538_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
>prophage 344
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5059749	5065856	5444610	tRNA	Bacillus_phage(50.0%)	7	NA	NA
WP_000807362.1|5059749_5060649_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|5061054_5061372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303578.1|5061359_5061539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072608493.1|5061701_5063063_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	4.2e-217
WP_001301848.1|5063210_5063543_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|5063733_5064456_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|5064452_5065856_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 345
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5079298	5080651	5444610		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_072608492.1|5079298_5080651_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	1.3e-05
>prophage 346
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5085369	5096232	5444610		Catovirus(16.67%)	10	NA	NA
WP_001295424.1|5085369_5086011_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|5086102_5086684_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001252349.1|5086705_5088559_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000687872.1|5088611_5088902_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_001227701.1|5088891_5089230_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021500249.1|5089304_5090888_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|5091546_5092686_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482901.1|5092691_5093135_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137171.1|5093137_5095300_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|5095392_5096232_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 347
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5100478	5107272	5444610		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|5100478_5101600_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000089911.1|5101602_5102568_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.2e-87
WP_000479838.1|5102570_5103050_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699727.1|5103046_5104270_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079259.1|5104272_5105709_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.0	3.7e-46
WP_001302013.1|5105901_5107272_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.9	9.9e-33
>prophage 348
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5112888	5116572	5444610		Klebsiella_phage(33.33%)	3	NA	NA
WP_001116005.1|5112888_5114283_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	3.1e-18
WP_000999466.1|5114440_5115436_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183060.1|5115678_5116572_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
>prophage 349
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5120949	5133655	5444610		Tupanvirus(14.29%)	10	NA	NA
WP_000875215.1|5120949_5122044_+	GDP-perosamine synthase RfbE/PerA	NA	A0A2K9L470	Tupanvirus	34.7	5.3e-53
WP_000684824.1|5122068_5123283_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000169624.1|5123302_5124421_+	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	64.1	5.4e-130
WP_001301811.1|5124423_5125389_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	52.7	2.1e-90
WP_000478513.1|5125391_5125901_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001278239.1|5125882_5127331_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	33.3	5.2e-56
WP_000839208.1|5127334_5128705_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.1	5.8e-33
WP_001055391.1|5129967_5130633_+	GDP-perosamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000043478.1|5130833_5132240_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	6.2e-38
WP_000704871.1|5132488_5133655_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	2.7e-111
>prophage 350
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5141008	5141908	5444610		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131775.1|5141008_5141908_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 351
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5149080	5225022	5444610	integrase,lysis,terminase,portal,head,protease,holin,tail,transposase,capsid	Stx2-converting_phage(45.88%)	101	5140031:5140045	5155449:5155463
5140031:5140045	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_021500246.1|5149080_5150259_+|integrase	site-specific integrase	integrase	B6ET93	Enterobacteria_phage	100.0	1.1e-232
WP_000132739.1|5150239_5150431_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|5150508_5150853_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|5151040_5151391_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|5152252_5153200_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|5153196_5153418_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|5153516_5153798_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548544.1|5153808_5154000_-	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_000682306.1|5153972_5154155_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|5154151_5154832_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|5154828_5155614_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
5155449:5155463	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000372937.1|5155990_5156134_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|5156102_5156267_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|5156339_5156708_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001171540.1|5156940_5157321_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|5157317_5157665_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|5157714_5159253_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000394299.1|5159340_5159592_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|5159650_5159923_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|5159900_5160083_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|5160651_5161173_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|5161674_5162370_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|5162445_5162661_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|5162802_5163099_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000539354.1|5163279_5164101_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|5164097_5165474_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|5165544_5165823_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|5165955_5166171_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|5166181_5166418_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|5166374_5166821_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|5166817_5167345_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|5167341_5167524_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208502.1|5167798_5168557_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001302729.1|5168462_5168657_-	hypothetical protein	NA	A0A0N7KZV5	Escherichia_phage	95.3	1.2e-29
WP_000849633.1|5168812_5169493_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|5169567_5170290_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|5170289_5170895_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|5170891_5171563_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|5171553_5172042_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|5172691_5173651_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|5173662_5173932_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|5174228_5174552_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143458.1|5176869_5177049_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|5177089_5177362_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|5177438_5177654_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|5177653_5178151_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|5178147_5178585_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|5178787_5179285_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|5179281_5179539_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|5180001_5180229_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|5180270_5180636_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_071987522.1|5180604_5180814_+	hypothetical protein	NA	H6WZK7	Escherichia_phage	94.2	1.7e-29
WP_000958416.1|5180929_5181493_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|5181489_5183151_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|5183214_5185152_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|5185196_5185418_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|5185363_5187865_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|5187944_5188271_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|5188280_5188631_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|5188627_5189074_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|5189070_5189415_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|5189473_5190190_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|5190195_5190570_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|5190665_5190875_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_072608490.1|5190927_5194170_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.4	0.0e+00
WP_000807954.1|5194162_5194504_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179516.1|5194503_5195202_+|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|5195218_5195539_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|5195646_5195820_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|5195890_5196814_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_000967271.1|5196867_5197605_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_115445438.1|5197550_5198183_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.5	5.8e-105
WP_149888756.1|5198442_5201937_+	DUF1983 domain-containing protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.3	0.0e+00
WP_001230550.1|5202007_5202607_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_001023452.1|5203770_5204040_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|5204180_5205056_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_021500197.1|5205280_5205931_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	100.0	6.4e-123
WP_012779375.1|5205915_5206200_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	100.0	1.2e-49
WP_001322269.1|5206645_5206840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322268.1|5206779_5206911_+	hypothetical protein	NA	O64339	Escherichia_phage	59.5	1.5e-07
WP_001303036.1|5207254_5208421_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|5208539_5209013_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|5209211_5210270_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|5210441_5210771_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|5210871_5211054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|5211542_5211656_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|5211668_5211863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|5212321_5212690_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|5212763_5212985_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|5213047_5213524_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|5213538_5214018_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|5214099_5214921_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|5215141_5215552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|5215567_5216251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102658.1|5216386_5217457_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|5217453_5218359_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_061069249.1|5218355_5219210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021500238.1|5219491_5221639_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071525094.1|5221745_5221928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|5223086_5224625_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|5224674_5225022_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
>prophage 352
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5249010	5290204	5444610	integrase,terminase,portal,head,holin,tail,transposase	Escherichia_phage(35.9%)	51	5229281:5229295	5253135:5253149
5229281:5229295	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000533600.1|5249010_5250033_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|5250032_5250236_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|5250294_5252766_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|5252861_5253050_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|5253046_5253235_-	cell division inhibitor	NA	NA	NA	NA	NA
5253135:5253149	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|5253715_5253868_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|5254142_5254787_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|5254884_5255112_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|5255108_5255534_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|5255602_5256640_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|5256671_5257094_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|5257128_5257827_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|5257848_5258073_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|5258069_5258426_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|5258458_5258611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|5258607_5258919_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|5259045_5259609_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|5259718_5259823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|5260009_5260222_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|5260263_5260449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072608487.1|5260389_5260668_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_001265075.1|5260669_5261719_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|5261731_5262091_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|5262087_5262777_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|5262807_5262930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303558.1|5263410_5263839_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|5264316_5266167_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|5266248_5267462_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|5267781_5267988_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|5267992_5268337_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|5268387_5268921_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|5269076_5269259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|5269271_5269403_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|5269630_5269816_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|5270342_5270657_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|5270738_5270963_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|5271357_5271867_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|5273749_5273956_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|5273952_5275545_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|5275534_5277040_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|5277076_5277424_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|5277481_5277748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|5277729_5278470_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|5278483_5278915_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_149888758.1|5281147_5281912_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.6	5.9e-136
WP_000847304.1|5281908_5282238_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_149888759.1|5282940_5283684_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	94.7	3.4e-144
WP_143189873.1|5283629_5284259_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	94.3	1.5e-100
WP_072608461.1|5288045_5288645_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	2.0e-110
WP_000268860.1|5288709_5289933_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023407.1|5289934_5290204_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 353
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5293457	5293988	5444610		Escherichia_phage(100.0%)	1	NA	NA
WP_001079078.1|5293457_5293988_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
>prophage 354
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5297531	5299561	5444610		Bacillus_phage(50.0%)	2	NA	NA
WP_001339045.1|5297531_5298203_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826732.1|5298202_5299561_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	8.7e-05
>prophage 355
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5303268	5310025	5444610		Burkholderia_phage(50.0%)	7	NA	NA
WP_000365585.1|5303268_5303964_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
WP_021500233.1|5304030_5305449_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786000.1|5305429_5305900_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001212226.1|5305888_5306809_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_149888760.1|5306981_5307899_+	DUF808 family protein	NA	NA	NA	NA	NA
WP_000009307.1|5307977_5308160_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001302088.1|5308330_5310025_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 356
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5323562	5323814	5444610		Salmonella_phage(100.0%)	1	NA	NA
WP_001303546.1|5323562_5323814_-	hypothetical protein	NA	S4TSP2	Salmonella_phage	52.3	6.5e-07
>prophage 357
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5327816	5328485	5444610		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334610.1|5327816_5328485_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	3.3e-82
>prophage 358
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5340742	5341495	5444610		Bacillus_virus(100.0%)	1	NA	NA
WP_001273005.1|5340742_5341495_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 359
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5347717	5367700	5444610	integrase,transposase,tail	Enterobacteria_phage(79.17%)	28	5360836:5360849	5370842:5370855
WP_032161728.1|5347717_5348851_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|5348801_5349125_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|5349282_5350467_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|5350466_5350979_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|5351033_5351399_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|5351434_5351563_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|5354365_5354854_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|5355010_5355583_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|5355626_5356043_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|5357248_5357563_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|5357567_5358527_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|5358603_5361426_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
5360836:5360849	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|5361432_5361798_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000775057.1|5361870_5362101_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|5362423_5362723_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|5362719_5362986_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|5362982_5363186_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|5363209_5363626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|5363718_5363832_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|5363828_5364071_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|5364082_5364361_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|5364371_5364722_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|5364743_5364947_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|5365018_5365156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|5365245_5365650_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|5365665_5366316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|5366345_5366693_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|5366698_5367700_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
5370842:5370855	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 360
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5374606	5376121	5444610		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|5374606_5376121_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 361
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5386206	5391850	5444610		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001302081.1|5386206_5387868_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000483251.1|5387913_5389515_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_000204340.1|5389533_5390394_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036370.1|5390396_5391446_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|5391460_5391850_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 362
NZ_CP043539	Escherichia coli O157 strain Al Ain chromosome, complete genome	5444610	5397102	5444157	5444610	integrase,lysis,terminase,tRNA,portal,holin,tail,transposase	Escherichia_phage(38.64%)	55	5395884:5395898	5411699:5411713
5395884:5395898	attL	TAACCGACATATCCG	NA	NA	NA	NA
WP_001025318.1|5397102_5398836_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302537.1|5399051_5399618_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185748.1|5399631_5400378_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214277.1|5400765_5401866_+	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
WP_000176813.1|5401890_5404320_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564730.1|5404484_5405456_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|5405452_5406196_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|5406236_5406632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077891155.1|5406684_5407494_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.9e-71
WP_085948178.1|5407482_5408695_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_021501361.1|5408749_5410063_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.4	1.6e-245
WP_072608482.1|5410118_5410355_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.7	1.2e-39
WP_032240805.1|5410363_5410510_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	2.4e-22
WP_024211141.1|5410513_5410756_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	86.2	3.6e-31
WP_021501358.1|5410879_5411449_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	40.0	2.8e-29
WP_021501357.1|5411445_5412195_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	83.1	1.3e-116
5411699:5411713	attR	TAACCGACATATCCG	NA	NA	NA	NA
WP_000734576.1|5412238_5413066_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.8	9.0e-130
WP_001028879.1|5413062_5413251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000566775.1|5413311_5413704_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.1	2.3e-35
WP_021501356.1|5413700_5413919_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	77.8	1.9e-23
WP_021501355.1|5413890_5414106_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	59.2	3.6e-14
WP_021501354.1|5414098_5414464_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	69.8	9.0e-34
WP_021501353.1|5414648_5414840_-	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	93.7	9.5e-27
WP_001692483.1|5414836_5415028_-	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	95.2	1.5e-27
WP_000930864.1|5415029_5415473_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	45.6	1.6e-08
WP_000402986.1|5415585_5416041_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001405833.1|5416106_5416349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183589.1|5416510_5416804_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	93.8	4.1e-45
WP_021501352.1|5417052_5417415_+	hypothetical protein	NA	A0A1B5FPB1	Escherichia_phage	96.7	9.5e-60
WP_021501351.1|5417526_5419185_+	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	95.7	0.0e+00
WP_000844629.1|5419186_5420155_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	99.4	5.5e-187
WP_001258397.1|5420154_5421012_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	92.3	1.6e-150
WP_000762843.1|5421011_5421827_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	84.1	5.9e-118
WP_000576620.1|5421963_5422908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149888762.1|5423810_5425757_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.4	0.0e+00
WP_000143457.1|5425893_5426073_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	98.3	3.7e-25
WP_072608480.1|5426113_5426386_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	98.9	6.3e-24
WP_000284516.1|5426462_5426678_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001015164.1|5426681_5427239_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	84.3	8.6e-52
WP_054432902.1|5427281_5427815_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	93.2	1.5e-98
WP_001255337.1|5427811_5428279_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	85.3	6.3e-64
WP_029786607.1|5428302_5428527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032326312.1|5428487_5428781_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	75.6	1.3e-11
WP_000348565.1|5428986_5429463_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_149888753.1|5429459_5431583_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_000102414.1|5431579_5431792_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|5431791_5433294_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001281350.1|5435663_5435945_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_021500195.1|5436582_5436981_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	3.8e-70
WP_000235090.1|5436988_5437741_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_044707580.1|5437754_5438177_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
WP_000533450.1|5438203_5438512_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	98.0	6.6e-54
WP_001435304.1|5438555_5438930_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.1	4.1e-50
WP_000847306.1|5441185_5441515_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_149888763.1|5443884_5444157_+	hypothetical protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	91.0	5.3e-31
