The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	106760	116109	2000194	tRNA	Vibrio_phage(16.67%)	9	NA	NA
WP_006995691.1|106760_108884_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.1	2.0e-258
WP_006995688.1|110023_111403_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.7	3.9e-53
WP_005652519.1|111505_112015_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	32.9	7.2e-13
WP_006995687.1|112069_112858_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
WP_006995686.1|112919_113177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032826269.1|113187_113454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005689970.1|113512_113836_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.4	9.8e-16
WP_006995684.1|113955_114951_-	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	39.6	1.1e-65
WP_081457578.1|114963_116109_-	methionine biosynthesis PLP-dependent protein	NA	A0A141ZJM2	Faustovirus	26.5	3.6e-12
>prophage 2
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	446635	523056	2000194	protease,portal,head,tRNA,integrase,capsid,plate,terminase,tail	Mannheimia_phage(51.43%)	74	487707:487766	523057:523118
WP_006995391.1|446635_448354_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_006995390.1|448438_450298_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.1	1.9e-87
WP_005655473.1|450299_450605_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_006995389.1|450865_452113_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_005652269.1|452318_452945_+	response regulator	NA	NA	NA	NA	NA
WP_005648547.1|453006_453447_-	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_006995388.1|453450_454011_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_006995387.1|454124_454403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006996628.1|460569_461124_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_013527340.1|461299_462337_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.5	1.2e-33
WP_006995384.1|462326_463016_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005654466.1|463054_463876_+	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
WP_005672324.1|464177_464945_-	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006995381.1|464974_465553_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_013527342.1|466242_469014_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	40.0	3.0e-20
WP_005661551.1|469208_469958_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_151230664.1|470187_471957_+	L-fucose isomerase	NA	NA	NA	NA	NA
WP_013527343.1|472029_473442_+	L-fuculokinase	NA	NA	NA	NA	NA
WP_005648572.1|473455_473890_+	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_006995376.1|473909_474560_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005668621.1|474598_475885_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_005654480.1|476412_477261_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	6.1e-33
WP_006995374.1|477398_478784_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_006995373.1|478922_479738_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_005694542.1|479747_480551_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006995372.1|480567_481575_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_151230665.1|481648_484180_-	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_006995370.1|484484_485696_+	uroporphyrin-III C-methyltransferase	NA	NA	NA	NA	NA
WP_006995369.1|485706_486993_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
487707:487766	attL	AAATGAAAGGTTTTTTATGGCAGGGGCGGAGAGGCTCGAACTCCCAACACCCGGTTTTGG	NA	NA	NA	NA
WP_005641196.1|488267_489278_-|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	62.1	3.5e-120
WP_041175147.1|489287_491063_-|terminase	terminase	terminase	A0A0M3LRV4	Mannheimia_phage	65.4	1.9e-217
WP_086935158.1|491314_491497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995363.1|491490_492135_+	phage repressor protein	NA	D0UIM5	Aggregatibacter_phage	35.0	5.3e-29
WP_006995362.1|492312_493128_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	60.7	1.2e-62
WP_006995361.1|493149_494199_+|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	51.6	4.4e-89
WP_013527346.1|494210_494861_+|terminase	terminase	terminase	Q19US0	Mannheimia_phage	45.5	9.1e-45
WP_006995358.1|495153_495660_+|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	51.0	1.3e-33
WP_005668467.1|495659_495869_+|tail	tail protein	tail	NA	NA	NA	NA
WP_006995357.1|495870_496092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151230666.1|496583_496934_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_005672206.1|496848_497112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006995354.1|497108_497324_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	46.6	5.3e-10
WP_006995353.1|497320_497791_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	46.0	5.6e-28
WP_013527347.1|497790_498249_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	50.4	2.3e-26
WP_006995351.1|498226_498499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527348.1|498568_501304_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	36.1	1.8e-86
WP_006995348.1|501525_501978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668437.1|502078_502678_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	66.0	7.1e-44
WP_005633786.1|502679_503018_+	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	56.6	3.4e-19
WP_006995347.1|503014_503929_+|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	59.2	1.5e-93
WP_006995346.1|503918_504455_+|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	53.5	4.5e-50
WP_013527351.1|506738_507341_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.5	1.2e-94
WP_013525646.1|507337_507838_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	60.4	8.5e-51
WP_041175148.1|508013_508133_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013527352.1|508189_509035_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	73.2	5.0e-120
WP_006995341.1|509479_510664_+|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	48.7	6.0e-103
WP_006995340.1|510667_511174_+|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	59.5	7.1e-53
WP_005655095.1|511242_511542_+|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	42.9	1.2e-12
WP_006995339.1|511541_511688_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	65.0	2.2e-07
WP_006995336.1|512016_512454_+|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	56.7	1.0e-39
WP_013527353.1|512453_513647_+	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	51.0	1.5e-101
WP_005668419.1|513672_513912_-	nuclease	NA	Q19UP2	Mannheimia_phage	40.5	6.6e-09
WP_006995333.1|513922_515092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995332.1|515101_515791_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	34.9	1.0e-30
WP_013527354.1|515910_516159_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	44.4	1.5e-08
WP_005655063.1|516923_517166_+	hypothetical protein	NA	Q19UN6	Mannheimia_phage	68.1	1.2e-21
WP_006995328.1|517539_517920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668404.1|517923_518166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005655052.1|518291_518600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151230667.1|518609_520796_+	replication endonuclease	NA	Q94N00	Haemophilus_virus	42.7	6.4e-167
WP_005668397.1|520814_521006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668395.1|521016_521226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668393.1|521239_521761_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	42.4	7.3e-29
WP_013527358.1|522000_523056_+|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	36.2	2.2e-56
523057:523118	attR	AAATGAAAGGTTTTTTATGGCAGGGGCGGAGAGGCTCGAACTCCCAACACCCGGTTTTGGAG	NA	NA	NA	NA
>prophage 3
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	864257	873137	2000194		Mannheimia_phage(28.57%)	12	NA	NA
WP_005651292.1|864257_864674_-	hypothetical protein	NA	E5EYK4	Acinetobacter_phage	35.9	1.1e-08
WP_013525621.1|866002_866362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525620.1|866358_866595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525619.1|866591_867161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527462.1|867439_868543_-	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	61.9	7.5e-07
WP_005668705.1|868604_869039_-	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	7.5e-19
WP_013525616.1|869038_869689_-	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	71.6	1.2e-84
WP_013525615.1|869663_870614_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	68.3	1.0e-108
WP_041174891.1|870626_870920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525614.1|870916_871264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527463.1|871277_872015_-	site-specific DNA-methyltransferase	NA	A0A0E3U2R2	Fusobacterium_phage	77.5	3.1e-113
WP_013525612.1|872105_873137_-	endonuclease	NA	D0UIK6	Aggregatibacter_phage	82.8	5.2e-42
>prophage 4
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	876469	914498	2000194	tRNA,tail,terminase	Pseudomonas_phage(15.62%)	50	NA	NA
WP_013525608.1|876469_877057_-	recombinase NinG	NA	A0A2I7RAC0	Vibrio_phage	48.5	1.7e-37
WP_005651114.1|877149_877566_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	84.7	1.1e-62
WP_005633909.1|877602_877827_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_013527465.1|877823_878465_-	replication P	NA	A0A1P8DTF3	Proteus_phage	32.7	8.8e-16
WP_013525606.1|878449_879232_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	45.1	4.3e-41
WP_013525605.1|879233_879467_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	60.3	2.3e-14
WP_005651123.1|879512_879965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995067.1|880008_880215_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_013527466.1|880348_881317_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	30.5	9.2e-17
WP_013525603.1|881739_882066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525602.1|882052_882457_+	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	68.7	3.9e-46
WP_013527467.1|882453_882843_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_013525600.1|882817_883048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012054986.1|883059_884415_+	hypothetical protein	NA	A0A0E3U266	Fusobacterium_phage	44.8	1.8e-98
WP_005692583.1|884411_884633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651145.1|884690_885059_+	LuxR family transcriptional regulator	NA	A0A0R6PHW5	Moraxella_phage	39.3	3.4e-12
WP_013525599.1|885039_886389_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	58.2	5.5e-145
WP_013525598.1|886390_887707_+	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	32.0	1.8e-47
WP_041174890.1|887687_888905_+	hypothetical protein	NA	I3PGT9	Xanthomonas_phage	36.4	2.7e-34
WP_005692574.1|889030_890104_+	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.2	1.2e-54
WP_013525596.1|890116_890536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525595.1|890543_891545_+	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	36.2	2.9e-50
WP_005692571.1|891547_891736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525594.1|891739_892090_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_013525593.1|892082_892541_+	hypothetical protein	NA	A0A2I7R754	Vibrio_phage	34.5	4.1e-15
WP_013525592.1|892540_892900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013527469.1|892901_893411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525590.1|893397_894471_+	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	35.7	8.5e-64
WP_005643344.1|894516_894942_+	DUF3277 family protein	NA	A0A2K9V3K6	Faecalibacterium_phage	45.9	4.0e-25
WP_013525589.1|894941_895424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525588.1|895608_898026_+	tape measure protein	NA	H9EB42	Vibrio_phage	28.0	1.6e-33
WP_013527470.1|898100_898823_-	hypothetical protein	NA	A6XMM0	Bacillus_virus	46.4	5.8e-24
WP_005688900.1|898984_899566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005643334.1|899562_899877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005692555.1|899873_900836_+	hypothetical protein	NA	A0A0N9RT60	Pseudomonas_phage	33.8	1.1e-33
WP_005692552.1|900832_901504_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	33.5	9.8e-18
WP_005651178.1|901500_901866_+	hypothetical protein	NA	K4RI30	Pseudomonas_phage	31.8	5.3e-10
WP_005651180.1|901858_903295_+	hypothetical protein	NA	E5AGC3	Erwinia_phage	29.0	1.2e-44
WP_012054979.1|903303_903918_+	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	37.4	1.0e-21
WP_013527471.1|903927_906297_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	59.8	6.4e-213
WP_013525580.1|906308_906911_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	94.5	5.0e-98
WP_013525579.1|906907_907366_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	55.8	4.9e-45
WP_005691741.1|908013_908739_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_005662648.1|908791_909244_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005656383.1|909311_910526_+	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.5	1.5e-32
WP_080334623.1|910549_910969_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	80.6	2.6e-53
WP_013527473.1|911022_911346_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	3.4e-24
WP_013527474.1|911358_911883_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005649159.1|911933_912620_+	DUF2625 domain-containing protein	NA	NA	NA	NA	NA
WP_013527475.1|912638_914498_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.3	4.0e-109
>prophage 5
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	987164	991102	2000194		uncultured_virus(100.0%)	8	NA	NA
WP_013525530.1|987164_987371_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.7	1.5e-09
WP_013525530.1|987445_987652_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.7	1.5e-09
WP_005666693.1|987726_987933_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.7	1.1e-09
WP_005631184.1|988007_988214_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	52.2	3.0e-10
WP_151230688.1|988288_988549_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_151230810.1|988472_988679_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.8	9.6e-09
WP_013525530.1|988752_988959_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.7	1.5e-09
WP_013525529.1|988933_991102_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	51.4	2.0e-192
>prophage 6
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	1136864	1219117	2000194	protease,portal,holin,head,tRNA,integrase,capsid,terminase,tail	Haemophilus_virus(58.33%)	83	1168707:1168725	1236361:1236379
WP_111723564.1|1136864_1138016_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_006996302.1|1138132_1138393_-	(Na+)-NQR maturation NqrM	NA	NA	NA	NA	NA
WP_013527529.1|1139580_1140816_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit F	NA	NA	NA	NA	NA
WP_005631374.1|1140828_1141425_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
WP_013527530.1|1141428_1142055_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit D	NA	NA	NA	NA	NA
WP_005653794.1|1142054_1142789_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_005653793.1|1142781_1144017_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit B	NA	NA	NA	NA	NA
WP_041175159.1|1144019_1145363_-	Na(+)-translocating NADH-quinone reductase subunit A	NA	NA	NA	NA	NA
WP_005668108.1|1145653_1145965_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_013526539.1|1146058_1146658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005691516.1|1148356_1149244_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_005544470.1|1149948_1150119_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_105886549.1|1151243_1151471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013526535.1|1151881_1152820_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_013526534.1|1152832_1153561_+	3-oxoacyl-ACP reductase FabG	NA	A0A0K0KVL6	Prochlorococcus_phage	28.1	1.6e-10
WP_005544465.1|1153816_1154047_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	51.5	2.3e-11
WP_005654411.1|1154251_1155583_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_006996315.1|1155642_1156350_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_151230693.1|1156459_1157689_+|protease	FtsH protease activity modulator HflK	protease	K4F6D5	Cronobacter_phage	24.3	1.4e-06
WP_065251160.1|1157688_1158576_+|protease	protease modulator HflC	protease	A0A2I7S9Z3	Vibrio_phage	26.6	1.8e-06
WP_065251161.1|1158618_1159053_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_006996320.1|1162434_1163424_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_006996321.1|1163772_1164459_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_006996322.1|1164503_1165406_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_006996323.1|1165398_1166265_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006996324.1|1166275_1167157_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_151230694.1|1167442_1168255_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_006996326.1|1168391_1169537_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
1168707:1168725	attL	AAAAGTGCGGTAAAAATTA	NA	NA	NA	NA
WP_151230695.1|1169735_1170830_-	porin	NA	NA	NA	NA	NA
WP_013526524.1|1171085_1171550_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	52.2	5.5e-44
WP_013526523.1|1171610_1172381_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.1	4.4e-38
WP_150007586.1|1173060_1174575_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_150007585.1|1174653_1175844_-	sugar transporter	NA	NA	NA	NA	NA
WP_151230696.1|1175843_1177019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151230697.1|1177022_1177610_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	3.6e-24
WP_005627949.1|1178481_1179798_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	82.1	5.3e-185
WP_151230698.1|1180031_1180562_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	37.6	9.8e-21
WP_110437529.1|1181021_1182035_-|integrase	site-specific integrase	integrase	P79671	Haemophilus_phage	99.7	1.7e-194
WP_005667764.1|1182034_1182799_-	hypothetical protein	NA	P79672	Haemophilus_phage	100.0	6.3e-138
WP_151230699.1|1182808_1182991_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	45.8	4.5e-10
WP_151230700.1|1182990_1183566_-	phage repressor protein CI	NA	Q94N02	Haemophilus_virus	98.4	1.3e-106
WP_048950682.1|1183684_1183897_+	hypothetical protein	NA	P79674	Haemophilus_phage	98.6	2.1e-30
WP_112095993.1|1184032_1184536_+	hypothetical protein	NA	P79675	Haemophilus_phage	88.0	3.1e-77
WP_112095991.1|1184554_1184923_+	hypothetical protein	NA	P79676	Haemophilus_phage	97.5	4.5e-65
WP_112095989.1|1184922_1185108_+	hypothetical protein	NA	Q775F8	Haemophilus_virus	98.4	2.3e-30
WP_151230701.1|1185119_1185401_+	hypothetical protein	NA	Q775F7	Haemophilus_virus	97.8	3.9e-45
WP_151230702.1|1185451_1185712_+	hypothetical protein	NA	Q775F6	Haemophilus_virus	97.7	3.1e-44
WP_151230703.1|1185714_1188042_+	replication endonuclease	NA	Q94N00	Haemophilus_virus	96.6	0.0e+00
WP_151230704.1|1188053_1188365_+	hypothetical protein	NA	Q94MZ9	Haemophilus_virus	94.2	3.9e-46
WP_151230705.1|1188374_1188893_+	phage N-6-adenine-methyltransferase	NA	Q94MZ8	Haemophilus_virus	95.8	2.9e-94
WP_110442614.1|1188931_1189150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080359101.1|1189444_1189705_-	ogr/Delta-like zinc finger family protein	NA	Q1I103	Pasteurella_virus	59.3	1.4e-25
WP_116972957.1|1189785_1190823_-|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	98.0	2.4e-196
WP_151230706.1|1190812_1192636_-|terminase	terminase ATPase subunit family protein	terminase	Q94MZ6	Haemophilus_virus	99.2	0.0e+00
WP_151230707.1|1192839_1193733_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MZ5	Haemophilus_virus	99.7	2.0e-151
WP_050951613.1|1193735_1194746_+|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	99.4	3.4e-187
WP_151230708.1|1194759_1195605_+|terminase	terminase endonuclease subunit	terminase	Q94MZ3	Haemophilus_virus	95.0	4.8e-147
WP_151230709.1|1195597_1196050_+|head	head completion/stabilization protein	head	Q94MZ2	Haemophilus_virus	90.7	6.7e-71
WP_151230710.1|1196037_1196520_+|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	65.4	5.9e-57
WP_151230711.1|1196516_1197242_+	phage virion morphogenesis protein	NA	Q1I0Z5	Pasteurella_virus	32.8	5.6e-19
WP_151230712.1|1197522_1198653_+	DUF2586 domain-containing protein	NA	Q94MY9	Haemophilus_virus	98.7	1.2e-217
WP_105882056.1|1198656_1199109_+	DUF2597 family protein	NA	Q94MY8	Haemophilus_virus	98.6	1.3e-74
WP_105882057.1|1199195_1199432_+|holin	holin	holin	Q94MY7	Haemophilus_virus	98.7	1.4e-35
WP_151230713.1|1199424_1199985_+	lysozyme	NA	Q94MY6	Haemophilus_virus	90.5	8.0e-90
WP_005667724.1|1199969_1200317_+	hypothetical protein	NA	Q94MY5	Haemophilus_virus	100.0	1.0e-55
WP_075985599.1|1200276_1200501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005667723.1|1200503_1200812_+	hypothetical protein	NA	Q775G2	Haemophilus_virus	100.0	1.2e-47
WP_151230714.1|1201000_1203070_+|tail	phage tail tape measure protein	tail	Q94MY4	Haemophilus_virus	73.6	4.5e-279
WP_015979431.1|1203073_1203409_+	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	99.1	2.3e-52
WP_151230715.1|1203401_1204571_+	hypothetical protein	NA	Q94MY2	Haemophilus_virus	97.9	4.4e-215
WP_015979433.1|1204580_1205105_+	hypothetical protein	NA	Q94MY1	Haemophilus_virus	100.0	4.8e-97
WP_151230716.1|1205134_1207678_+|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	64.4	2.2e-280
WP_151230717.1|1207690_1208308_+	hypothetical protein	NA	Q7Y5S1	Haemophilus_phage	38.5	4.8e-11
WP_151230718.1|1208286_1208562_+	DNA helicase UvrD	NA	Q776W9	Haemophilus_phage	71.3	3.0e-29
WP_151230719.1|1208574_1209342_+	hypothetical protein	NA	Q94MX8	Haemophilus_virus	96.5	3.7e-130
WP_151230720.1|1209328_1209892_+	hypothetical protein	NA	Q94MX7	Haemophilus_virus	92.3	1.5e-75
WP_151230721.1|1209888_1211490_+	hypothetical protein	NA	Q94MX6	Haemophilus_virus	95.9	1.6e-276
WP_005658075.1|1212616_1213174_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_006996334.1|1213448_1214639_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_006996335.1|1215116_1216478_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_005653606.1|1216590_1217097_+	membrane protein	NA	NA	NA	NA	NA
WP_013527541.1|1217146_1218154_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_006996337.1|1218331_1219117_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	A0A291ATS8	Pandoravirus	29.5	1.4e-18
1236361:1236379	attR	TAATTTTTACCGCACTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	1403492	1466111	2000194	protease,tRNA,terminase,integrase,transposase,lysis	Bacillus_phage(11.76%)	53	1398721:1398749	1461929:1461957
1398721:1398749	attL	TTGCCTTCCCCTGCTTGCGGGGGAAGGTG	NA	NA	NA	NA
WP_013527596.1|1403492_1404884_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.8	7.2e-23
WP_013527597.1|1405077_1405968_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_086935171.1|1405960_1407274_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_013527599.1|1407559_1408240_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_065250836.1|1408397_1409474_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_013527602.1|1412617_1413754_-	fimbrial protein	NA	NA	NA	NA	NA
WP_013527603.1|1413765_1416267_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_013527604.1|1416290_1416986_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_013527605.1|1417065_1417677_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_013527607.1|1418979_1419789_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_013527608.1|1419751_1420483_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.4	1.2e-16
WP_013527609.1|1420512_1421319_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005689848.1|1421370_1422072_+	hydroxyacylglutathione hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	29.6	4.3e-08
WP_006995902.1|1422122_1422983_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_006995903.1|1423095_1425144_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9V939	Bandra_megavirus	29.0	4.9e-60
WP_006995904.1|1425294_1426407_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_151230730.1|1427294_1427957_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081457566.1|1428061_1428745_+	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_006995911.1|1429667_1429976_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151230731.1|1430775_1432968_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	40.0	6.5e-127
WP_006995914.1|1432955_1433348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995916.1|1434011_1434215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995917.1|1434204_1434576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527611.1|1435682_1436456_-	phage antirepressor Ant	NA	A0A0P0ZCA2	Stx2-converting_phage	49.1	1.7e-18
WP_006995923.1|1436445_1436748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995924.1|1436747_1437215_-|terminase	terminase	terminase	A0A1X9SFE5	Acinetobacter_phage	48.8	1.1e-23
WP_006995925.1|1437195_1437489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995926.1|1437481_1437967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032826278.1|1437981_1438242_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_005681754.1|1438252_1438501_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_111723554.1|1438767_1440094_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.0	1.1e-63
WP_006995928.1|1440124_1441147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995929.1|1441291_1441732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995930.1|1441733_1442318_-	SocA family protein	NA	NA	NA	NA	NA
WP_151230732.1|1442486_1443743_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	37.9	1.1e-73
WP_005657488.1|1445077_1445533_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_013527653.1|1445549_1447037_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_006995933.1|1447048_1449583_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	26.0	3.6e-28
WP_111723554.1|1449684_1451011_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.0	1.1e-63
WP_032826317.1|1451077_1454260_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.8	1.6e-78
WP_041175184.1|1454261_1455308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151230733.1|1455300_1456680_-	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	30.6	5.7e-12
WP_151230734.1|1456672_1458319_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	30.1	4.1e-49
WP_005628626.1|1458508_1458895_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_151230735.1|1458894_1459815_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_081457567.1|1459894_1461028_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_006995943.1|1461058_1461898_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	39.3	1.6e-41
WP_006995944.1|1462023_1462809_-	hypothetical protein	NA	NA	NA	NA	NA
1461929:1461957	attR	TTGCCTTCCCCTGCTTGCGGGGGAAGGTG	NA	NA	NA	NA
WP_005665228.1|1462799_1463180_-	SufE family protein	NA	NA	NA	NA	NA
WP_006995945.1|1463176_1464376_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	33.1	8.3e-60
WP_011962156.1|1464377_1464839_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	47.0	1.2e-30
WP_005650310.1|1464974_1465397_+	membrane protein	NA	NA	NA	NA	NA
WP_006995947.1|1465415_1466111_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 8
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	1663671	1686325	2000194	holin,tail,plate	Haemophilus_phage(60.87%)	25	NA	NA
WP_013527736.1|1663671_1664469_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	46.7	1.0e-05
WP_074039950.1|1664506_1664683_-	peptidase	NA	NA	NA	NA	NA
WP_013527737.1|1664843_1665260_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	71.0	1.9e-51
WP_013527738.1|1665402_1666119_-	hypothetical protein	NA	A0A0M3LSH7	Mannheimia_phage	57.7	6.9e-70
WP_011961987.1|1666130_1666364_-	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	68.9	2.1e-20
WP_006996123.1|1666363_1666834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013527740.1|1668554_1669046_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	62.3	9.9e-52
WP_005661624.1|1669042_1669645_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.0	2.6e-94
WP_151230757.1|1669656_1671918_-|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	57.6	7.5e-187
WP_006996360.1|1671927_1672503_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	80.1	2.4e-89
WP_006996361.1|1672502_1673645_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	86.3	6.7e-184
WP_006996362.1|1673740_1674094_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	89.6	2.5e-57
WP_006996363.1|1674090_1674735_-	hypothetical protein	NA	Q7Y5S7	Haemophilus_phage	85.0	1.8e-85
WP_006996364.1|1674731_1675616_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	89.5	1.9e-141
WP_013527742.1|1675870_1676179_-	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	82.4	7.8e-47
WP_006996366.1|1676184_1676967_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	65.5	1.0e-82
WP_006996369.1|1679211_1679622_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	70.8	5.9e-50
WP_006996370.1|1679621_1680053_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	93.0	2.9e-71
WP_151230758.1|1680304_1681807_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	86.8	7.3e-247
WP_013525927.1|1681811_1682174_-	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	73.9	6.6e-45
WP_006996375.1|1682607_1683054_-	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	72.3	6.7e-55
WP_006996376.1|1683054_1683417_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	67.3	1.5e-33
WP_006996377.1|1683426_1684341_-	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	89.5	1.7e-150
WP_006996378.1|1684350_1684791_-	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	71.1	2.3e-47
WP_065250978.1|1685968_1686325_-	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	28.9	5.0e-05
>prophage 9
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	1689399	1701259	2000194	terminase	Haemophilus_phage(22.22%)	18	NA	NA
WP_006996384.1|1689399_1690743_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	53.7	3.1e-124
WP_005693952.1|1690729_1691245_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	40.9	5.6e-21
WP_006996385.1|1691321_1691573_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	50.6	6.4e-15
WP_006996386.1|1691556_1691904_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	56.1	4.4e-22
WP_013527746.1|1691905_1692187_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	74.4	2.5e-31
WP_006996388.1|1692098_1692422_-	DUF2570 domain-containing protein	NA	Q7Y5U9	Haemophilus_phage	56.5	4.5e-21
WP_061722324.1|1693569_1694412_-	antirepressor	NA	A0A0M3LR56	Mannheimia_phage	74.0	4.2e-50
WP_048950164.1|1694721_1695873_-	type I restriction enzyme R protein	NA	A0A1S5SAB0	Streptococcus_phage	29.8	2.0e-34
WP_005643898.1|1696038_1696407_-	hypothetical protein	NA	Q7Y5V5	Haemophilus_phage	63.4	1.8e-37
WP_048950163.1|1696408_1696957_-	NinG recombination protein	NA	D0UIK8	Aggregatibacter_phage	62.0	2.3e-57
WP_005656663.1|1697045_1697465_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	76.1	5.1e-57
WP_005633909.1|1697501_1697726_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_042599559.1|1697722_1698364_-	replication P	NA	A0A1I9KFB0	Aeromonas_phage	24.9	8.2e-06
WP_011272607.1|1698348_1699107_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	69.3	1.6e-61
WP_011272606.1|1699103_1699778_-	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	67.9	6.9e-80
WP_048950185.1|1699826_1700267_-	hypothetical protein	NA	A0A0U4B0E3	Pseudomonas_phage	32.6	8.1e-13
WP_005655320.1|1700321_1700504_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	51.7	1.6e-10
WP_044332609.1|1700605_1701259_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.0	1.2e-31
>prophage 10
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	1704509	1711661	2000194		Mannheimia_phage(42.86%)	12	NA	NA
WP_048950187.1|1704509_1705202_-	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	27.2	5.2e-14
WP_042593370.1|1705202_1705382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005651093.1|1706556_1707294_+	site-specific DNA-methyltransferase	NA	A0A0E3U2R2	Fusobacterium_phage	77.5	5.2e-113
WP_005651091.1|1707307_1707652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012054992.1|1707648_1707942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061720767.1|1707954_1708875_+	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	71.9	2.2e-116
WP_065246950.1|1708849_1709500_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	71.1	2.6e-84
WP_112081617.1|1709499_1709934_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	35.1	1.3e-18
WP_005652248.1|1709993_1710173_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	62.1	1.8e-11
WP_151230760.1|1710493_1710730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041175199.1|1710726_1711077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005684834.1|1711220_1711661_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	65.8	1.9e-49
>prophage 11
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	1732683	1740869	2000194	tail,plate	Haemophilus_phage(57.14%)	8	NA	NA
WP_151230761.1|1732683_1733520_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	33.6	5.9e-12
WP_006995342.1|1735037_1735883_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	72.8	2.3e-120
WP_005641687.1|1735939_1736059_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_151230762.1|1736234_1736723_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	55.6	2.1e-46
WP_151230763.1|1736715_1737342_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	50.9	1.6e-30
WP_151230764.1|1737354_1739250_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	49.6	9.9e-116
WP_151230814.1|1739253_1739847_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	63.0	3.8e-66
WP_151230765.1|1739846_1740869_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	65.5	2.1e-120
>prophage 12
NZ_CP043811	Haemophilus influenzae biotype aegyptius strain HE40/F3043 chromosome, complete genome	2000194	1954866	1980464	2000194	tail,transposase,terminase	Haemophilus_phage(52.38%)	32	NA	NA
WP_006995433.1|1954866_1955298_-	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	60.9	3.5e-37
WP_006995434.1|1955307_1955613_-	hypothetical protein	NA	B7SDP3	Haemophilus_phage	50.0	2.8e-20
WP_006995435.1|1955676_1956600_-|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	74.6	3.9e-134
WP_151230792.1|1956599_1957637_-	I protein	NA	B7SDN9	Haemophilus_phage	46.4	1.2e-67
WP_005688555.1|1957918_1958335_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	67.4	2.8e-47
WP_151230793.1|1959353_1959776_-	hypothetical protein	NA	A0A0M3LSH7	Mannheimia_phage	71.1	2.6e-40
WP_151230794.1|1961472_1963113_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	78.5	1.2e-250
WP_151230795.1|1963242_1963746_-	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	51.2	1.6e-44
WP_006995441.1|1963747_1964014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995442.1|1964013_1964271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151230796.1|1964394_1964652_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_041174960.1|1964651_1964942_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	61.4	3.3e-15
WP_151230797.1|1965095_1965599_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	64.4	4.4e-55
WP_006995448.1|1965680_1966109_-	hypothetical protein	NA	F6MIJ8	Haemophilus_phage	42.3	3.3e-27
WP_151230798.1|1966214_1966433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111723566.1|1966442_1967084_-	phage antirepressor Ant	NA	A0A0A7RVQ9	Clostridium_phage	38.7	1.4e-10
WP_006996626.1|1967556_1967760_-	KilA-N domain-containing protein	NA	NA	NA	NA	NA
WP_006996625.1|1967786_1968185_-	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	45.1	2.1e-20
WP_006996624.1|1968425_1968674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006996623.1|1968678_1968852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151230799.1|1969023_1969221_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151230800.1|1969395_1970013_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	58.6	8.9e-66
WP_005647090.1|1970013_1970205_-	HTH domain-containing protein	NA	F6MII8	Haemophilus_phage	57.6	9.5e-11
WP_111723541.1|1970213_1970510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151230801.1|1970520_1971402_-	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	75.1	2.9e-118
WP_151230802.1|1971453_1971870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151230803.1|1971862_1973845_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	54.6	2.8e-185
WP_032823844.1|1973888_1974167_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	1.0e-16
WP_032823845.1|1974342_1975059_+	helix-turn-helix domain-containing protein	NA	A0A0M3LP76	Mannheimia_phage	34.9	1.5e-19
WP_151230804.1|1975658_1976999_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.8	2.5e-81
WP_006996427.1|1977060_1977678_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_151230805.1|1977695_1980464_-	DUF87 domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	42.8	8.6e-84
