The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043771	Haemophilus influenzae biotype aegyptius strain HE15/F3028 chromosome, complete genome	1984979	174287	207041	1984979	terminase,transposase,plate,tail	Haemophilus_phage(26.67%)	47	NA	NA
WP_041174894.1|174287_174551_+	hypothetical protein	NA	F6MIM3	Haemophilus_phage	76.7	7.2e-33
WP_013525645.1|174590_175436_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	71.7	4.0e-117
WP_041174895.1|175492_175612_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013525646.1|175787_176288_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	60.4	8.5e-51
WP_013525647.1|176284_176887_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.0	2.6e-94
WP_013525648.1|176898_178608_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	65.9	2.2e-154
WP_005658855.1|178639_179209_-|tail	tail fiber protein	tail	A4JWL7	Burkholderia_virus	45.3	4.5e-40
WP_013525649.1|179201_180308_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	36.2	2.3e-56
WP_013525650.1|180307_180673_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_005658861.1|180727_181336_-|plate	phage baseplate assembly protein V	plate	A0A291LA20	Bordetella_phage	42.1	2.2e-08
WP_013525651.1|181322_182387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533315.1|182379_182610_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	47.8	7.2e-13
WP_013525652.1|182590_183523_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_013525653.1|183522_186114_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.6	1.7e-41
WP_041174896.1|186159_186474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086935107.1|186458_186611_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_005640664.1|186588_186873_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_013525654.1|186966_187485_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	45.6	1.1e-37
WP_005661612.1|187495_188881_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	44.3	5.2e-98
WP_005658884.1|188890_189388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005658887.1|189399_189834_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	36.4	4.4e-19
WP_013525655.1|189833_190151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525656.1|190216_191143_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.9	1.0e-73
WP_013525657.1|191161_192265_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	39.2	1.2e-65
WP_005661604.1|192507_193008_-	phage virion morphogenesis protein	NA	G8GWE3	Rhodobacter_phage	31.5	3.8e-14
WP_041174897.1|193210_193399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525658.1|193585_194863_-	mu gp30-like protein	NA	J9STS2	Pseudomonas_phage	47.6	2.8e-53
WP_013525659.1|194863_196279_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	45.0	1.3e-112
WP_005658905.1|196280_197603_-|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	64.2	1.8e-148
WP_005658907.1|197586_198135_-	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	40.3	5.9e-29
WP_005658909.1|198144_198447_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	52.0	3.1e-24
WP_005658911.1|198443_198752_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	39.4	6.3e-12
WP_149998795.1|198748_198952_-	hypothetical protein	NA	F6MIK2	Haemophilus_phage	54.2	1.2e-06
WP_149998754.1|198875_199133_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_041174898.1|199129_199360_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	69.3	4.4e-18
WP_013525661.1|199599_200136_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	68.0	7.2e-72
WP_005658925.1|200222_200642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005658927.1|200715_201090_-	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	46.2	1.9e-23
WP_005658929.1|201093_201582_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	31.7	4.8e-14
WP_041174899.1|201691_201979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041174900.1|201982_202213_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_013525663.1|202213_202588_-	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	51.2	5.3e-29
WP_041174901.1|202660_202879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041174902.1|203043_203241_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013525664.1|203345_203864_-	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	58.1	5.4e-48
WP_041174903.1|203885_204089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525667.1|205031_207041_-|transposase	transposase	transposase	M4M9R2	Vibrio_phage	35.7	1.8e-99
>prophage 2
NZ_CP043771	Haemophilus influenzae biotype aegyptius strain HE15/F3028 chromosome, complete genome	1984979	611983	654382	1984979	terminase,plate,bacteriocin,tail,holin	Haemophilus_phage(47.92%)	56	NA	NA
WP_013525909.1|611983_612781_+|holin	LPS cholinephosphotransferase	holin	A0A1V0SD50	Indivirus	37.4	1.1e-07
WP_074039950.1|612818_612995_-	peptidase	NA	NA	NA	NA	NA
WP_013525910.1|613154_613571_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	68.6	4.8e-47
WP_013525911.1|613694_614402_-	hypothetical protein	NA	A0A0M3LSH7	Mannheimia_phage	55.2	9.9e-61
WP_011961987.1|614413_614647_-	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	68.9	2.1e-20
WP_006996123.1|614646_615117_+	hypothetical protein	NA	Q94N00	Haemophilus_virus	39.0	6.6e-21
WP_013525915.1|616838_617330_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	60.4	3.8e-51
WP_013525647.1|617326_617929_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.0	2.6e-94
WP_013525916.1|617940_620184_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	65.8	7.9e-221
WP_005684190.1|620193_620769_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	79.1	3.5e-88
WP_013525917.1|620768_621911_-|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	87.1	1.6e-185
WP_013525918.1|621953_622472_-	hypothetical protein	NA	A0A0M4REH5	Salmonella_phage	52.0	9.8e-34
WP_013525919.1|622656_623010_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	87.8	4.8e-56
WP_013525920.1|623006_623651_-	hypothetical protein	NA	D0UIH7	Aggregatibacter_phage	79.9	1.2e-94
WP_013525921.1|623647_624520_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	86.6	2.7e-140
WP_041174930.1|624534_624714_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	94.9	1.9e-21
WP_013525922.1|624796_625105_-	hypothetical protein	NA	D0UII0	Aggregatibacter_phage	80.4	1.9e-45
WP_013525923.1|625110_625887_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	66.1	2.0e-83
WP_013525924.1|625892_627983_-	hypothetical protein	NA	Q7Y5T2	Haemophilus_phage	69.2	6.2e-212
WP_006996369.1|628133_628544_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	70.8	5.9e-50
WP_006996370.1|628543_628975_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	93.0	2.9e-71
WP_013525926.1|629219_630728_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	86.9	3.5e-249
WP_013525927.1|630732_631095_-	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	73.9	6.6e-45
WP_013525928.1|631159_631531_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	71.5	1.8e-45
WP_006996375.1|631527_631974_-	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	72.3	6.7e-55
WP_013525929.1|631974_632337_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	66.4	4.4e-33
WP_006996377.1|632346_633261_-	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	89.5	1.7e-150
WP_006996378.1|633270_633711_-	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	71.1	2.3e-47
WP_041174931.1|633723_634824_-	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	87.0	4.4e-140
WP_006996380.1|634885_635242_-	DUF2513 domain-containing protein	NA	A0A1W6JNL0	Staphylococcus_phage	31.7	7.8e-06
WP_013525931.1|635520_636954_-	hypothetical protein	NA	Q7Y5U5	Haemophilus_phage	77.2	1.7e-88
WP_013525932.1|636982_638314_-	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	84.2	1.5e-211
WP_006996384.1|638315_639659_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	53.7	3.1e-124
WP_005693952.1|639645_640161_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	40.9	5.6e-21
WP_006996386.1|640458_640806_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	56.1	4.4e-22
WP_013525933.1|640807_641089_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	72.2	1.4e-29
WP_041174932.1|641000_641324_-	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	54.2	7.8e-21
WP_013525934.1|641316_641919_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	53.4	3.7e-56
WP_013525935.1|641887_642244_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_013525936.1|643230_644130_-	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	53.7	1.5e-77
WP_041174933.1|644767_644950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041174934.1|644994_645444_-	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.3	1.8e-23
WP_041174935.1|645475_645658_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_005650528.1|645757_646129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525938.1|646125_646668_-	hypothetical protein	NA	D0UIK8	Aggregatibacter_phage	67.2	2.6e-61
WP_013525939.1|646760_647177_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	84.7	4.7e-63
WP_041174936.1|647213_647438_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_013525940.1|647434_648076_-	replication P	NA	NA	NA	NA	NA
WP_138571565.1|648060_648819_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	68.3	1.3e-61
WP_013525941.1|648815_649484_-	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	53.0	2.4e-56
WP_005656655.1|649531_649828_-	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	70.4	2.0e-31
WP_041175006.1|649848_650061_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	51.5	8.1e-11
WP_013525942.1|650202_650895_+	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	31.2	9.2e-19
WP_013525943.1|651026_651971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041174937.1|653341_653434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525944.1|653743_654382_+|bacteriocin	bacteriocin	bacteriocin	D0UIK6	Aggregatibacter_phage	73.7	1.1e-42
>prophage 3
NZ_CP043771	Haemophilus influenzae biotype aegyptius strain HE15/F3028 chromosome, complete genome	1984979	659358	666261	1984979	bacteriocin,integrase	Aggregatibacter_phage(42.86%)	11	660330:660345	677308:677323
WP_013525950.1|659358_660042_+|bacteriocin	bacteriocin	bacteriocin	D0UIK6	Aggregatibacter_phage	81.9	2.5e-45
WP_013525951.1|660250_660895_+	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	71.4	1.5e-84
660330:660345	attL	CAGCCAAAAGTGCGGT	NA	NA	NA	NA
WP_013525952.1|660894_661329_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	35.1	1.3e-18
WP_005652248.1|661388_661568_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	62.1	1.8e-11
WP_041174939.1|661888_662125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525953.1|662121_662472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005684834.1|662615_663056_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	65.8	1.9e-49
WP_013525954.1|663042_663396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525955.1|663726_664578_+	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	42.1	1.1e-53
WP_032826372.1|664816_665017_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_013525956.1|665013_666261_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	36.9	1.1e-73
677308:677323	attR	ACCGCACTTTTGGCTG	NA	NA	NA	NA
>prophage 4
NZ_CP043771	Haemophilus influenzae biotype aegyptius strain HE15/F3028 chromosome, complete genome	1984979	775878	784392	1984979		Bacillus_virus(33.33%)	9	NA	NA
WP_013526026.1|775878_776562_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.2	3.9e-54
WP_013526027.1|776554_776980_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.0	1.5e-19
WP_005686506.1|776980_777616_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	35.2	2.9e-11
WP_005653684.1|778010_778244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013526028.1|778227_780411_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	8.7e-116
WP_013526029.1|780530_781502_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013526030.1|781516_782404_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013526031.1|782413_783406_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
WP_005663823.1|783408_784392_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	3.2e-17
>prophage 5
NZ_CP043771	Haemophilus influenzae biotype aegyptius strain HE15/F3028 chromosome, complete genome	1984979	1004205	1019924	1984979	head,terminase,tail	Haemophilus_phage(58.82%)	25	NA	NA
WP_013526153.1|1004205_1004637_-	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	61.6	1.2e-37
WP_013526154.1|1004646_1004982_-	hypothetical protein	NA	B7SDP3	Haemophilus_phage	55.4	4.4e-19
WP_013526155.1|1005017_1005938_-|tail	tail sheath protein	tail	A0A0M3LQ11	Mannheimia_phage	62.9	1.0e-110
WP_086935082.1|1005937_1006927_-	I protein	NA	A0A0M3LPA7	Mannheimia_phage	45.6	5.8e-67
WP_013526157.1|1006814_1007168_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	67.9	3.1e-23
WP_013526158.1|1007310_1008627_-|head	head morphogenesis protein	head	A0A0M3LSH7	Mannheimia_phage	67.7	2.0e-168
WP_013526159.1|1010311_1011961_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	79.7	1.1e-248
WP_013526160.1|1012110_1012611_-	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	51.8	4.1e-45
WP_005661915.1|1012612_1012879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005684166.1|1012878_1013136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013526161.1|1013259_1013517_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_041174960.1|1013516_1013807_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	61.4	3.3e-15
WP_013526163.1|1013960_1014464_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	63.1	4.9e-54
WP_013526164.1|1014544_1014973_-	hypothetical protein	NA	F6MIJ8	Haemophilus_phage	42.3	2.5e-27
WP_013526165.1|1015084_1015501_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	75.2	3.8e-52
WP_041174961.1|1015555_1015732_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	87.9	5.9e-23
WP_005641522.1|1015856_1016075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013526166.1|1016085_1016727_-	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	41.8	3.7e-22
WP_006996626.1|1017263_1017467_-	KilA-N domain-containing protein	NA	NA	NA	NA	NA
WP_013526167.1|1017493_1017892_-	regulatory protein GemA	NA	F6MIJ6	Haemophilus_phage	43.7	5.3e-19
WP_006996624.1|1018132_1018381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006996623.1|1018385_1018559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006996621.1|1018730_1018928_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013526168.1|1019114_1019732_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	58.8	6.8e-66
WP_005647090.1|1019732_1019924_-	HTH domain-containing protein	NA	F6MII8	Haemophilus_phage	57.6	9.5e-11
>prophage 6
NZ_CP043771	Haemophilus influenzae biotype aegyptius strain HE15/F3028 chromosome, complete genome	1984979	1829217	1838110	1984979	tRNA	Streptococcus_phage(16.67%)	10	NA	NA
WP_013525538.1|1829217_1830033_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	29.2	2.4e-18
WP_013525539.1|1830032_1831199_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_013525540.1|1831229_1832123_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.1	1.9e-32
WP_005659998.1|1832295_1832583_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_013525541.1|1832634_1833642_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	2.8e-08
WP_013525542.1|1833649_1834264_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005659992.1|1834326_1834899_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	27.2	7.1e-09
WP_005649034.1|1834945_1835686_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014550473.1|1835845_1836310_-	dihydroneopterin triphosphate diphosphatase	NA	A0A248SJK4	Salicola_phage	30.4	6.6e-05
WP_013525543.1|1836343_1838110_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	23.4	5.6e-12
>prophage 7
NZ_CP043771	Haemophilus influenzae biotype aegyptius strain HE15/F3028 chromosome, complete genome	1984979	1888768	1973448	1984979	terminase,tRNA,head,integrase,plate,capsid,tail,holin,portal	Haemophilus_virus(30.67%)	112	1897557:1897576	1968456:1968475
WP_013525575.1|1888768_1890628_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.5	1.4e-109
WP_013525576.1|1890646_1891333_-	DUF2625 domain-containing protein	NA	NA	NA	NA	NA
WP_005662651.1|1891383_1891908_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005688927.1|1891920_1892244_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	45.8	1.3e-23
WP_005691745.1|1892301_1892718_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	80.6	2.0e-53
WP_013525577.1|1892741_1893956_-	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	36.0	5.1e-33
WP_013525578.1|1894023_1894476_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005691741.1|1894528_1895254_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_013525579.1|1895901_1896360_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	55.8	4.9e-45
WP_013525580.1|1896356_1896959_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	94.5	5.0e-98
WP_149998771.1|1896970_1899340_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	60.0	1.9e-212
1897557:1897576	attL	GCTTTGATGCATAATTTGAG	NA	NA	NA	NA
WP_149998770.1|1899349_1899964_-	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	36.9	5.1e-21
WP_126513638.1|1899972_1901409_-	hypothetical protein	NA	A0A0N9SH53	Pseudomonas_phage	28.4	2.2e-46
WP_149998769.1|1901401_1901767_-	hypothetical protein	NA	A0A1J0MEY0	Pectobacterium_phage	34.5	2.4e-10
WP_149998768.1|1901763_1902435_-|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	33.0	2.9e-17
WP_006995042.1|1902431_1903394_-	hypothetical protein	NA	M4SNA5	Psychrobacter_phage	29.2	1.0e-20
WP_005643334.1|1903390_1903705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995043.1|1903701_1904283_-	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	27.7	5.7e-06
WP_006995044.1|1904590_1905163_+	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	52.3	3.3e-14
WP_149998767.1|1905237_1907568_-	tape measure protein	NA	K7RVL7	Vibrio_phage	29.0	2.6e-33
WP_013525589.1|1907752_1908235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005643344.1|1908234_1908660_-	DUF3277 family protein	NA	A0A0A1IUI2	Pseudomonas_phage	36.9	2.6e-16
WP_005692561.1|1908705_1909779_-	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	41.3	2.8e-59
WP_005692563.1|1909765_1910275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005692565.1|1910276_1910636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012054983.1|1910635_1911094_-	hypothetical protein	NA	A0A2I7R754	Vibrio_phage	35.2	3.7e-16
WP_005692569.1|1911086_1911437_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_005692571.1|1911440_1911629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041174811.1|1911631_1912633_-	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	36.2	8.5e-50
WP_005643361.1|1912640_1913060_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_149998766.1|1913072_1914146_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.2	7.2e-55
WP_149998793.1|1914271_1915489_-|head	phage head morphogenesis protein	head	E5AGA5	Erwinia_phage	39.5	8.3e-23
WP_005651149.1|1915469_1916786_-	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	32.2	1.4e-47
WP_149998792.1|1916787_1918137_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	58.7	1.6e-144
WP_005651145.1|1918117_1918486_-	LuxR family transcriptional regulator	NA	A0A0R6PHW5	Moraxella_phage	39.3	3.4e-12
WP_005651141.1|1918543_1918765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012054986.1|1918761_1920117_-	ParB N-terminal domain-containing protein	NA	A0A0E3U266	Fusobacterium_phage	44.8	1.8e-98
WP_005651135.1|1920128_1920359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651133.1|1920333_1920723_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_005692586.1|1920719_1921124_-	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	66.4	2.2e-44
WP_005651127.1|1921110_1921437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995066.1|1921630_1922599_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	30.5	7.0e-17
WP_006995067.1|1922732_1922939_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	48.3	8.7e-10
WP_005651123.1|1922982_1923435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005651121.1|1923480_1923714_+	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	58.9	1.9e-13
WP_149998819.1|1923715_1924543_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	48.7	4.3e-39
WP_065246949.1|1924527_1925169_+	replication P	NA	NA	NA	NA	NA
WP_005633909.1|1925165_1925390_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_005651114.1|1925426_1925843_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	84.7	1.1e-62
WP_013525608.1|1925935_1926523_+	recombinase NinG	NA	A0A2I7RAC0	Vibrio_phage	48.5	1.7e-37
WP_013527464.1|1926524_1926890_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_013525609.1|1926928_1927447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525610.1|1927557_1928457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005651099.1|1928615_1928801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149998763.1|1929183_1929495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688811.1|1929614_1929866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525612.1|1929855_1930887_+	endonuclease	NA	D0UIK6	Aggregatibacter_phage	82.8	5.2e-42
WP_005651093.1|1930977_1931715_+	site-specific DNA-methyltransferase	NA	A0A0E3U2R2	Fusobacterium_phage	77.5	5.2e-113
WP_149998762.1|1931728_1932076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012054992.1|1932072_1932366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011272494.1|1932378_1933299_+	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	71.5	4.8e-116
WP_005668703.1|1933273_1933924_+	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	70.2	1.0e-83
WP_149998761.1|1933923_1934358_+	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	5.7e-19
WP_149998760.1|1934419_1935442_+	hypothetical protein	NA	A0A0U4B0I3	Pseudomonas_phage	56.4	1.6e-32
WP_013525619.1|1935720_1936290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525620.1|1936286_1936523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525621.1|1936519_1936879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012054998.1|1936886_1938161_+	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	46.9	7.7e-96
WP_005651292.1|1938208_1938625_+	hypothetical protein	NA	E5E463	Acinetobacter_phage	65.2	1.3e-07
WP_041174991.1|1938741_1939230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668271.1|1939494_1939764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525623.1|1939767_1940205_+	hypothetical protein	NA	A0A2K9V3W6	Faecalibacterium_phage	37.6	2.0e-24
WP_005651299.1|1940334_1940649_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005641600.1|1940546_1941572_+|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	35.4	7.4e-57
WP_013525469.1|1942116_1943130_-|integrase	site-specific integrase	integrase	P79671	Haemophilus_phage	96.1	2.2e-186
WP_041174886.1|1943132_1943426_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_041174885.1|1943425_1943653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041174884.1|1943689_1943893_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_041174883.1|1943892_1944135_-	hypothetical protein	NA	A0A0A7NPW2	Enterobacteria_phage	59.5	6.0e-18
WP_013525467.1|1944479_1944854_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_041174882.1|1944976_1945168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041174881.1|1945164_1945404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525466.1|1945536_1946040_+	hypothetical protein	NA	P79675	Haemophilus_phage	91.6	5.7e-79
WP_013525465.1|1946058_1946394_+	hypothetical protein	NA	P79676	Haemophilus_phage	94.6	1.6e-56
WP_013525464.1|1946454_1948794_+	replication endonuclease	NA	Q94N00	Haemophilus_virus	94.1	0.0e+00
WP_013525463.1|1948805_1949111_+	hypothetical protein	NA	Q94MZ9	Haemophilus_virus	78.8	5.8e-34
WP_013525462.1|1949120_1949639_+	phage N-6-adenine-methyltransferase	NA	Q94MZ8	Haemophilus_virus	97.0	1.0e-94
WP_041174880.1|1949718_1949898_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	72.9	2.2e-17
WP_013525461.1|1949961_1950369_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	66.7	4.7e-47
WP_013525460.1|1950399_1950660_-	ogr/Delta-like zinc finger family protein	NA	Q1I103	Pasteurella_virus	52.4	4.3e-22
WP_013525459.1|1950741_1951776_-|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	98.6	6.9e-196
WP_013525457.1|1953773_1954661_+|capsid	phage capsid scaffolding protein	capsid	Q94MZ5	Haemophilus_virus	68.0	4.0e-91
WP_013525456.1|1954664_1955675_+|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	94.9	1.4e-180
WP_013525454.1|1956526_1956979_+|head	head completion/stabilization protein	head	Q94MZ2	Haemophilus_virus	96.7	3.4e-75
WP_138571532.1|1956984_1957449_+|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	62.7	1.1e-52
WP_013525452.1|1957445_1958171_+	phage virion morphogenesis protein	NA	Q1I0Z5	Pasteurella_virus	32.1	1.8e-17
WP_013525451.1|1958432_1959563_+	DUF2586 domain-containing protein	NA	Q94MY9	Haemophilus_virus	97.3	2.1e-214
WP_013525450.1|1959566_1960019_+	DUF2597 family protein	NA	Q94MY8	Haemophilus_virus	95.8	1.2e-72
WP_041174879.1|1960105_1960342_+|holin	holin	holin	Q94MY7	Haemophilus_virus	97.4	5.3e-35
WP_013525449.1|1960334_1960895_+	lysozyme	NA	Q94MY6	Haemophilus_virus	92.7	2.5e-91
WP_013525448.1|1960879_1961227_+	hypothetical protein	NA	Q94MY5	Haemophilus_virus	89.6	3.0e-47
WP_013525447.1|1961407_1961716_+	hypothetical protein	NA	Q775G2	Haemophilus_virus	98.0	3.5e-47
WP_149998759.1|1964180_1964516_+	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	97.3	4.4e-51
WP_149998758.1|1964508_1965678_+	hypothetical protein	NA	Q94MY2	Haemophilus_virus	97.9	3.4e-215
WP_149998757.1|1965687_1966212_+|tail	phage tail protein	tail	Q94MY1	Haemophilus_virus	98.3	2.7e-95
WP_050780969.1|1968965_1969277_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	37.3	1.2e-05
1968456:1968475	attR	CTCAAATTATGCATCAAAGC	NA	NA	NA	NA
WP_013525440.1|1969293_1969572_-	peptidase	NA	A0A0M3LQB1	Mannheimia_phage	46.7	2.6e-17
WP_013525439.1|1969650_1970265_+	hypothetical protein	NA	Q7Y5S1	Haemophilus_phage	45.6	2.1e-19
WP_013525438.1|1970243_1970513_+	hypothetical protein	NA	Q776W9	Haemophilus_phage	74.4	5.3e-31
WP_041174878.1|1970531_1971299_+	hypothetical protein	NA	Q94MX8	Haemophilus_virus	98.8	7.3e-134
WP_013525436.1|1971285_1971846_+	hypothetical protein	NA	Q94MX7	Haemophilus_virus	97.3	3.6e-82
WP_013525435.1|1971846_1973448_+	hypothetical protein	NA	Q94MX6	Haemophilus_virus	98.7	4.0e-283
