The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	228654	266055	2207094	transposase,integrase	Lactobacillus_phage(57.14%)	32	227598:227612	237778:237792
227598:227612	attL	GGCAGCAAAAACGTC	NA	NA	NA	NA
WP_027821988.1|228654_229242_+|integrase	site-specific integrase	integrase	A0A141E0P1	Streptococcus_phage	34.0	8.6e-18
WP_150203275.1|229602_230778_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_150203277.1|231871_232051_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150203279.1|232067_232430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150203281.1|233404_233827_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_150203283.1|233950_235345_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_150203284.1|235358_235799_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150203286.1|235851_237174_-	purine permease	NA	Q9KX94	Enterobacteria_phage	28.7	7.3e-33
WP_150203287.1|237591_238452_-	pyridoxal kinase	NA	NA	NA	NA	NA
237778:237792	attR	GGCAGCAAAAACGTC	NA	NA	NA	NA
WP_137602637.1|238474_238966_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_150203289.1|239182_240805_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_137602639.1|240833_242297_-	MFS transporter	NA	NA	NA	NA	NA
WP_150203291.1|242466_243369_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_150203293.1|243613_244795_+	MFS transporter	NA	NA	NA	NA	NA
WP_150203295.1|244974_246363_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.4	1.7e-48
WP_137602305.1|246548_246812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137602304.1|246923_247844_-	ribokinase	NA	NA	NA	NA	NA
WP_150203297.1|247853_248870_-	DUF4432 family protein	NA	NA	NA	NA	NA
WP_137602302.1|248856_250248_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_150203299.1|250552_251503_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_137602300.1|252147_252357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150203301.1|252489_256566_+	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_150203304.1|256767_257673_+	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_137602307.1|257659_257956_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_150203306.1|257952_258624_+	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
WP_150203307.1|261232_262075_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	1.4e-157
WP_003590074.1|262260_262380_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.3	1.3e-13
WP_150203309.1|262696_263542_+	manganese catalase	NA	NA	NA	NA	NA
WP_150203312.1|263697_264138_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050884803.1|264176_264434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011679759.1|264963_265206_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	36.1	3.1e-06
WP_150203314.1|265212_266055_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	7.4e-31
>prophage 2
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	317113	365814	2207094	transposase	Pseudomonas_phage(12.5%)	45	NA	NA
WP_150203377.1|317113_317416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150203379.1|318692_319064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582802.1|319177_319576_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_150203381.1|321198_321753_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_137602571.1|322074_322302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150203383.1|322314_323109_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_150203385.1|323134_324094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150203387.1|324196_325213_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_137602575.1|325441_326611_+	galactokinase	NA	NA	NA	NA	NA
WP_150203390.1|326710_328156_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_150203392.1|328174_329173_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_137602578.1|329360_330014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137602579.1|330426_331593_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_137602580.1|331878_333153_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_150203394.1|333167_334973_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_150204609.1|335520_336906_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.5	2.0e-28
WP_137601873.1|336991_337879_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_150203396.1|338000_338453_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_150203398.1|338506_339235_-	C26 family cysteine hydrolase domain-containing family	NA	NA	NA	NA	NA
WP_150203400.1|339476_339983_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150203401.1|340035_340677_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_137601878.1|340761_341226_+	universal stress protein	NA	NA	NA	NA	NA
WP_137601879.1|341295_341907_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_150203404.1|342142_343327_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.6	1.1e-08
WP_010011610.1|343312_344191_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_003688751.1|344214_344502_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150204610.1|344451_344781_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150203406.1|344885_345677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137601882.1|345792_347223_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	28.4	5.3e-37
WP_150203408.1|347358_348045_-	DUF554 family protein	NA	NA	NA	NA	NA
WP_150203410.1|348206_348821_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_137601888.1|350714_352193_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.3	1.1e-74
WP_150204611.1|352410_353523_-	MFS transporter	NA	NA	NA	NA	NA
WP_150203412.1|353608_355132_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_137601890.1|355275_355707_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_150203416.1|355808_356969_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	35.8	1.5e-58
WP_150203418.1|357201_358593_+	amino acid permease	NA	NA	NA	NA	NA
WP_150203420.1|358899_360297_+	amino acid permease	NA	NA	NA	NA	NA
WP_150203422.1|360376_360556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070210484.1|360875_361088_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_150203424.1|361125_362151_+	hypothetical protein	NA	A0A2K5B2B4	Erysipelothrix_phage	69.3	3.6e-88
WP_071131220.1|362293_362518_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138190518.1|362532_362877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150203426.1|362961_364284_+	cellulose synthase	NA	NA	NA	NA	NA
WP_150203428.1|364608_365814_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.8	4.1e-91
>prophage 3
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	441646	450209	2207094		Synechococcus_phage(33.33%)	9	NA	NA
WP_150204614.1|441646_442132_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	37.6	1.1e-18
WP_150203524.1|442112_443249_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_137601483.1|443251_443980_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	41.7	2.4e-41
WP_137601482.1|443972_444233_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_150203526.1|444237_444912_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_150203527.1|444946_447142_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	2.9e-143
WP_150203529.1|447126_448605_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	6.9e-56
WP_137601478.1|448597_449638_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	38.6	4.8e-56
WP_150203531.1|449630_450209_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	36.8	1.6e-21
>prophage 4
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	795909	839403	2207094	transposase	Streptococcus_phage(20.0%)	36	NA	NA
WP_105310504.1|795909_796788_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	4.4e-42
WP_003688751.1|796811_797099_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150203788.1|797661_798555_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_137601923.1|798572_798809_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_150203789.1|798843_799050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150203790.1|799158_799953_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_150203791.1|800110_802705_+	YfhO family protein	NA	NA	NA	NA	NA
WP_150203792.1|802749_804486_+	YfhO family protein	NA	NA	NA	NA	NA
WP_150203793.1|804634_804892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150203794.1|804946_806122_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_150204628.1|807248_807746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150204629.1|808583_809558_+	muramidase	NA	A0A249Y0X5	Enterococcus_phage	38.6	2.1e-21
WP_150203795.1|809777_810710_+	glycosyltransferase	NA	V9QJB1	Oenococcus_phage	48.7	1.1e-75
WP_150203796.1|810812_811736_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	40.3	1.5e-48
WP_150203797.1|811899_813510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150204630.1|813810_814371_+	sugar transferase	NA	NA	NA	NA	NA
WP_150203798.1|814357_815569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150203799.1|815561_816176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150203800.1|816208_816973_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_150203801.1|816974_818030_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_150203802.1|818026_819040_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_150203803.1|819036_820017_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_150204631.1|820036_820933_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_150203804.1|821002_822121_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	75.5	1.2e-164
WP_150203805.1|822124_823561_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_150203806.1|823707_824802_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_150203807.1|825445_826573_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_150203808.1|826754_827144_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	29.7	9.7e-10
WP_150203809.1|827266_828844_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.3	5.0e-28
WP_150204632.1|828896_829970_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_150203810.1|830171_831887_+	YfhO family protein	NA	NA	NA	NA	NA
WP_087843058.1|833452_833584_+	helix-turn-helix domain-containing protein	NA	Q6J1X3	Lactobacillus_phage	93.0	7.9e-17
WP_029327644.1|833757_834600_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.0e-157
WP_150203811.1|836045_836225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150204633.1|836318_837962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150203812.1|838086_839403_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	21.7	1.9e-09
>prophage 5
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	849312	907571	2207094	transposase,tRNA	Enterococcus_phage(20.0%)	49	NA	NA
WP_150203821.1|849312_850617_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	55.7	9.8e-131
WP_150203822.1|851107_852028_+	ribokinase	NA	NA	NA	NA	NA
WP_150203823.1|852044_852749_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_150203824.1|853141_854344_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_150203825.1|854346_855369_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_150203826.1|855371_856388_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_150203827.1|856419_857592_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_137602853.1|857670_857919_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_150203828.1|864570_865821_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	21.6	7.0e-09
WP_137601561.1|865980_866352_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_150203829.1|866772_868995_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.6	2.3e-249
WP_150203830.1|868930_869512_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.9	4.5e-51
WP_150203831.1|870089_870731_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	53.5	1.4e-26
WP_150203832.1|871191_872313_+	vitamin B12 independent methionine synthase	NA	A0A218MNE0	uncultured_virus	44.3	3.8e-83
WP_150203833.1|872334_873489_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	43.5	2.6e-82
WP_150203834.1|873762_874686_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.6	5.1e-09
WP_003688751.1|874758_875046_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150203835.1|875069_875948_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	9.8e-42
WP_150203836.1|875970_876402_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150203837.1|876507_877221_-	winged-helix domain-containing protein	NA	NA	NA	NA	NA
WP_137601554.1|877437_878295_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_150203838.1|878440_879301_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_150203839.1|879312_880215_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_137601551.1|880214_881102_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_137601550.1|881114_881891_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.2e-13
WP_150203840.1|881902_882658_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	3.8e-18
WP_137601548.1|882670_883372_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_150204634.1|884002_884764_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_137601547.1|884763_885765_+	biotin-dependent carboxyltransferase	NA	NA	NA	NA	NA
WP_150203841.1|885697_886189_+	acetyl-CoA carboxylase, biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_150203842.1|886206_887535_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_150203843.1|887527_888316_+	putative hydro-lyase	NA	NA	NA	NA	NA
WP_150203844.1|888334_889084_+	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_150203845.1|889107_890310_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_150203846.1|890748_892743_+	transketolase	NA	NA	NA	NA	NA
WP_137601540.1|893024_893537_+	hypothetical protein	NA	A0A218KDM1	Bacillus_phage	56.2	2.5e-13
WP_150203847.1|893563_894520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150203848.1|894735_895692_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_150203849.1|896092_896377_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_150204635.1|897425_897863_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150203850.1|897951_898485_-	VanZ family protein	NA	NA	NA	NA	NA
WP_150204636.1|898635_899994_+	amino acid permease	NA	NA	NA	NA	NA
WP_150203851.1|900108_900645_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_150203852.1|900780_901314_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_150203853.1|901362_902088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150203854.1|902323_903511_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.9	1.6e-143
WP_137602203.1|903596_904154_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	44.7	1.7e-36
WP_150203855.1|904156_904786_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_150203856.1|905153_907571_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.2	0.0e+00
>prophage 6
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	1133598	1185997	2207094	integrase,transposase,tRNA	Staphylococcus_phage(16.67%)	51	1154514:1154531	1171953:1171970
WP_150203988.1|1133598_1134477_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	3.7e-41
WP_003688751.1|1134500_1134788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150204651.1|1134835_1136293_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.3	1.1e-58
WP_057779393.1|1136735_1136918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137601344.1|1137143_1137815_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_137601343.1|1137928_1140184_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_150203989.1|1140226_1141588_-	MFS transporter	NA	NA	NA	NA	NA
WP_137601341.1|1141888_1142863_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_150203990.1|1142889_1143723_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_137601339.1|1143748_1144132_-	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_150203991.1|1144131_1144983_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_137601337.1|1145006_1145525_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_150203992.1|1145677_1146607_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_150203993.1|1146626_1147637_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150203994.1|1147824_1150272_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	30.7	4.6e-97
WP_150203995.1|1150292_1152392_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.2	1.1e-123
WP_150203996.1|1152629_1153244_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_150203997.1|1153306_1154185_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_150203998.1|1154184_1155102_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.6	6.0e-26
1154514:1154531	attL	ATTCATCAAAATATTTCT	NA	NA	NA	NA
WP_150203999.1|1155160_1157278_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.3	5.2e-105
WP_150204000.1|1157359_1158220_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_150204001.1|1158266_1159037_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	36.5	2.1e-19
WP_150204002.1|1159014_1159899_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_137601326.1|1159908_1160130_-	YozE family protein	NA	NA	NA	NA	NA
WP_150204003.1|1160139_1160748_-	DUF2140 family protein	NA	NA	NA	NA	NA
WP_150204652.1|1160759_1161617_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_150204004.1|1161774_1162617_-	DegV family EDD domain-containing protein	NA	A0A0N9SI50	Staphylococcus_phage	38.8	2.9e-19
WP_137601323.1|1162789_1163425_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_137601322.1|1163421_1163904_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	37.0	6.6e-24
WP_137601321.1|1163971_1164934_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.2	7.3e-115
WP_150204005.1|1164954_1166838_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	5.0e-59
WP_150204006.1|1166839_1168054_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	46.3	6.7e-41
WP_150204007.1|1168050_1168821_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_137601317.1|1168978_1169815_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_150204008.1|1169920_1171180_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_137601315.1|1171319_1171595_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	70.8	1.8e-26
WP_137601314.1|1171968_1173279_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
1171953:1171970	attR	ATTCATCAAAATATTTCT	NA	NA	NA	NA
WP_150204009.1|1173359_1174565_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_150204010.1|1174638_1175322_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_150204011.1|1175337_1175874_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_150204012.1|1175935_1177381_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	41.4	4.2e-58
WP_150204013.1|1177373_1178399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137601348.1|1178542_1179121_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_150204014.1|1179420_1180149_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_150204653.1|1180120_1180717_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.0	4.9e-13
WP_150204015.1|1180712_1181507_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_137601305.1|1181496_1181859_-	reductase	NA	NA	NA	NA	NA
WP_150204016.1|1181899_1182787_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.4	3.1e-35
WP_137601303.1|1182790_1183666_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_150204017.1|1184040_1185246_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.0	1.7e-89
WP_150204018.1|1185535_1185997_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.2	2.8e-16
>prophage 7
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	1194509	1250201	2207094	integrase,transposase,tRNA	Staphylococcus_phage(15.0%)	49	1235423:1235444	1237527:1237548
WP_150204023.1|1194509_1195202_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_150204024.1|1195298_1196516_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	28.4	3.7e-31
WP_150204025.1|1196585_1197590_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_150204026.1|1197727_1198867_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.5	1.7e-38
WP_150204027.1|1198870_1200730_-	DNA primase	NA	A0A1S5RFN0	Helicobacter_phage	30.7	1.7e-43
WP_150204028.1|1200886_1202959_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_137602473.1|1202960_1203887_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_137602474.1|1204159_1204957_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_150204029.1|1205115_1206024_-	GTPase Era	NA	NA	NA	NA	NA
WP_150204654.1|1206050_1206434_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_137602476.1|1206417_1206903_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_150204030.1|1206902_1207886_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	48.3	2.7e-48
WP_150204031.1|1208044_1208488_-	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	35.8	1.3e-05
WP_010622233.1|1208595_1208781_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_150204032.1|1208920_1209817_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	28.8	2.7e-23
WP_150204033.1|1210281_1211157_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_150204034.1|1211832_1212294_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.9	2.6e-17
WP_150204035.1|1212513_1214286_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_137602283.1|1214291_1215587_-|tRNA	histidine--tRNA ligase	tRNA	A0A1V0SFH3	Hokovirus	23.4	8.8e-15
WP_150204036.1|1216088_1216943_+	SH3 domain-containing protein	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	37.8	4.3e-18
WP_150204037.1|1217029_1217866_+	phosphotransferase	NA	NA	NA	NA	NA
WP_150204038.1|1217905_1218838_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_137602287.1|1218888_1219326_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_150204655.1|1219445_1221686_-	RelA/SpoT family protein	NA	J9Q7H7	Salmonella_phage	34.3	1.4e-07
WP_150204039.1|1221827_1222184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137602289.1|1222190_1222940_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_150204040.1|1222960_1223914_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_150204041.1|1225067_1227902_+	YfhO family protein	NA	NA	NA	NA	NA
WP_150204042.1|1227905_1228271_+	DUF1304 family protein	NA	NA	NA	NA	NA
WP_150204656.1|1229756_1231142_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.5	2.6e-28
WP_150204043.1|1231634_1232036_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	52.0	6.7e-30
WP_150204044.1|1232097_1232673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204045.1|1232894_1233197_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_150204046.1|1233252_1233504_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	4.6e-37
WP_150204047.1|1233557_1234400_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.2	4.3e-156
WP_150204048.1|1234837_1235458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204049.1|1235310_1235952_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
1235423:1235444	attL	CTTGGGAACAGCGTAAGTTAGG	NA	NA	NA	NA
WP_150204050.1|1235967_1236885_-|integrase	tyrosine-type recombinase/integrase	integrase	A8ATM2	Listeria_phage	44.7	1.0e-73
WP_150204051.1|1237018_1238200_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	24.6	3.7e-12
1237527:1237548	attR	CCTAACTTACGCTGTTCCCAAG	NA	NA	NA	NA
WP_150204052.1|1238213_1239803_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	52.1	3.6e-127
WP_150204053.1|1239814_1242805_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.6	2.3e-18
WP_003688751.1|1244103_1244391_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150204054.1|1244414_1245314_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.2e-42
WP_150204055.1|1245399_1246575_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_150204056.1|1246863_1247055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204057.1|1247020_1248043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204058.1|1248344_1248707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057889459.1|1249011_1249890_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	4.4e-42
WP_003688751.1|1249913_1250201_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	1258037	1346225	2207094	holin,integrase,capsid,portal,protease,transposase,tail,terminase	Lactobacillus_phage(33.33%)	106	1329214:1329230	1358427:1358443
WP_150204657.1|1258037_1259072_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	6.7e-42
WP_150204065.1|1259382_1259634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204066.1|1259653_1260298_-	DUF1275 family protein	NA	NA	NA	NA	NA
WP_150204067.1|1260336_1260684_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_047675014.1|1261638_1261890_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.7e-37
WP_150204068.1|1261914_1262277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150204069.1|1262388_1263834_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	56.5	5.2e-56
WP_150204070.1|1263830_1264463_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	49.0	5.0e-48
WP_150204071.1|1264546_1265380_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_150204072.1|1265392_1266622_-	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_150204073.1|1266641_1267388_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	43.0	4.4e-19
WP_150204074.1|1267411_1268665_-	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
WP_150204658.1|1268678_1269593_-	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_150204075.1|1269725_1270613_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150204076.1|1270683_1272102_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_150204077.1|1272144_1273536_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.3	8.2e-51
WP_150204078.1|1273692_1275075_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_150204079.1|1275487_1275823_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_150204080.1|1276210_1277464_+|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	21.6	7.0e-09
WP_150204659.1|1278334_1279921_-	glycine/betaine ABC transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	8.8e-09
WP_137601094.1|1280556_1281135_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_150204081.1|1281519_1281954_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_150204082.1|1281993_1282239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204083.1|1282263_1283541_-	sugar-phosphate kinase	NA	NA	NA	NA	NA
WP_137601149.1|1283571_1283874_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_150204084.1|1283893_1284976_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_137601099.1|1284987_1285443_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_150204085.1|1285598_1287671_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_137601101.1|1287757_1288075_+	hypothetical protein	NA	G3MBI9	Bacillus_virus	31.7	8.7e-09
WP_150204086.1|1288227_1288677_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1X9I727	Streptococcus_phage	51.4	5.2e-39
WP_150204087.1|1288846_1289032_+	addiction module toxin, HicA family	NA	A0A1X9I5W4	Streptococcus_phage	63.3	1.1e-16
WP_150204088.1|1289052_1289487_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1X9I727	Streptococcus_phage	52.7	4.4e-35
WP_150204089.1|1289535_1290753_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	33.8	6.1e-34
WP_150204090.1|1290843_1291134_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_137601150.1|1291126_1291393_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_137601107.1|1291528_1291867_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_150204091.1|1291897_1292161_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A9D9X7	Lactobacillus_prophage	45.6	3.7e-05
WP_137601109.1|1292432_1293113_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_150204092.1|1293167_1293839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204660.1|1294015_1294333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150204093.1|1294378_1295113_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_150204094.1|1295254_1298014_-	DEAD/DEAH box helicase family protein	NA	M4QPU0	Micromonas_pusilla_virus	30.7	7.6e-32
WP_150204095.1|1298593_1298902_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002816285.1|1298926_1299178_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_150204096.1|1299231_1300074_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	1.3e-155
WP_150204097.1|1300175_1300511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204098.1|1300485_1300671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204099.1|1301358_1301589_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_150204100.1|1302042_1302825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204101.1|1302850_1303276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150203428.1|1303507_1304713_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.8	4.1e-91
WP_150204102.1|1304941_1306045_-	LysM peptidoglycan-binding domain-containing protein	NA	U3PJ04	Lactobacillus_phage	42.0	1.3e-38
WP_150204103.1|1306034_1306451_-|holin	phage holin	holin	A0A059T684	Listeria_phage	44.3	5.7e-08
WP_150204104.1|1306431_1306857_-|holin	phage holin family protein	holin	A0A097BY69	Enterococcus_phage	37.2	1.1e-14
WP_150204105.1|1307019_1307148_-	XkdX family protein	NA	NA	NA	NA	NA
WP_150204106.1|1307147_1307477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204107.1|1307496_1307961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204108.1|1307979_1308840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204109.1|1308856_1309342_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_150204110.1|1309347_1310217_-	hypothetical protein	NA	A0A1X9IGH6	Lactococcus_phage	32.5	2.8e-17
WP_150204111.1|1310221_1311640_-	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	34.7	2.0e-36
WP_150204112.1|1311644_1312148_-	hypothetical protein	NA	Q6SEC2	Lactobacillus_prophage	33.1	4.5e-15
WP_150204113.1|1312147_1312894_-|tail	phage tail protein	tail	A0A1B2APY0	Phage_Wrath	39.0	7.8e-40
WP_150204114.1|1312877_1316150_-	tape measure protein	NA	D7RWD8	Brochothrix_phage	53.4	1.6e-65
WP_150204115.1|1316169_1316811_-	hypothetical protein	NA	A5GYM7	Lactococcus_phage	28.9	4.5e-20
WP_150204116.1|1316819_1317263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204117.1|1317316_1317802_-	hypothetical protein	NA	A0A2I7QIP9	Bacillus_phage	33.8	1.6e-14
WP_150204118.1|1317803_1318202_-|capsid	capsid protein	capsid	A0A1S5SA43	Streptococcus_phage	40.2	3.5e-15
WP_150204661.1|1318201_1318528_-|capsid	capsid protein	capsid	B3GW08	Streptococcus_phage	40.4	8.7e-20
WP_150204119.1|1318533_1318884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204120.1|1318880_1319279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204662.1|1319291_1319513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204121.1|1319602_1320520_-	hypothetical protein	NA	A0A1S5SA37	Streptococcus_phage	62.0	5.5e-96
WP_150204122.1|1320535_1321105_-	scaffolding protein	NA	U3PIU5	Lactobacillus_phage	29.4	7.8e-08
WP_150204123.1|1321223_1321463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204124.1|1321465_1323100_-	hypothetical protein	NA	O03929	Lactobacillus_phage	38.8	3.5e-53
WP_150204125.1|1323108_1324632_-|portal	phage portal protein	portal	A0A1S5SAH6	Streptococcus_phage	50.1	2.0e-130
WP_150204126.1|1324640_1325963_-|terminase	PBSX family phage terminase large subunit	terminase	U3PBE8	Lactobacillus_phage	57.0	1.3e-151
WP_150204127.1|1325937_1326723_-|terminase	terminase	terminase	V9QKX0	Oenococcus_phage	50.6	1.2e-54
WP_150204128.1|1326779_1326995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204129.1|1327612_1328104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204130.1|1328435_1328651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204131.1|1328717_1329158_+	hypothetical protein	NA	NA	NA	NA	NA
1329214:1329230	attL	TTTTTATTTATTTTAAT	NA	NA	NA	NA
WP_150204132.1|1329225_1329423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204133.1|1329424_1329895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204134.1|1329905_1330106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204135.1|1330108_1330570_-	hypothetical protein	NA	A0A2D1GQG1	Lysinibacillus_phage	36.0	4.1e-07
WP_150204136.1|1330566_1331283_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	69.0	1.3e-89
WP_150204137.1|1331296_1332211_-	DnaD domain protein	NA	A6M985	Geobacillus_virus	34.4	4.9e-44
WP_150204663.1|1332222_1333053_-	hypothetical protein	NA	E9LUM4	Lactobacillus_phage	51.6	7.5e-76
WP_150204138.1|1332997_1333912_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	56.9	3.8e-73
WP_150204139.1|1333911_1334223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204140.1|1334503_1334761_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_150204141.1|1334774_1335314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204142.1|1336024_1336213_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_150204143.1|1336209_1336467_-	helix-turn-helix domain-containing protein	NA	O03906	Lactobacillus_phage	56.8	9.5e-14
WP_150204144.1|1336626_1336959_+	helix-turn-helix domain-containing protein	NA	O03970	Lactobacillus_phage	46.9	5.2e-20
WP_150204145.1|1336959_1337370_+	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	53.2	1.3e-25
WP_150204146.1|1337423_1339112_+	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	64.5	2.5e-94
WP_150204147.1|1339129_1339591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150204664.1|1339684_1340848_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	44.1	2.5e-85
WP_150204665.1|1340975_1342814_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	6.2e-22
WP_137601117.1|1342915_1343380_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.0	5.3e-39
WP_150204148.1|1343392_1344571_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.9	8.4e-89
WP_150204149.1|1344560_1345166_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	9.4e-36
WP_150204150.1|1345166_1346225_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	4.9e-40
1358427:1358443	attR	TTTTTATTTATTTTAAT	NA	NA	NA	NA
>prophage 9
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	1365531	1422400	2207094	protease,transposase,tRNA	Bacillus_phage(15.38%)	52	NA	NA
WP_137601136.1|1365531_1366437_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_150204161.1|1366602_1366959_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_150204162.1|1367331_1370052_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	42.0	2.9e-20
WP_137601139.1|1370066_1370372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137601140.1|1370364_1370661_-	YlxR family protein	NA	NA	NA	NA	NA
WP_150204163.1|1370689_1371778_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_150204164.1|1371796_1372270_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_150204165.1|1372390_1373326_-	ferrochelatase	NA	NA	NA	NA	NA
WP_150204166.1|1373358_1377669_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	37.2	2.5e-21
WP_150204167.1|1377749_1379462_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	23.1	3.1e-07
WP_150204168.1|1379493_1380765_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_137601146.1|1380801_1381587_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_150204169.1|1381621_1382398_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.2	1.3e-21
WP_137602569.1|1382626_1383190_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_137602568.1|1383176_1383914_-	UMP kinase	NA	NA	NA	NA	NA
WP_137602567.1|1383997_1384876_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_150204170.1|1384986_1385775_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_150204171.1|1385929_1386928_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	33.8	5.3e-44
WP_150204172.1|1387023_1387308_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_150204173.1|1387297_1388053_-	methyltransferase	NA	NA	NA	NA	NA
WP_137602562.1|1388161_1388791_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_150204174.1|1388837_1389242_-	MFS transporter	NA	NA	NA	NA	NA
WP_150204175.1|1389299_1390043_-	MFS transporter	NA	NA	NA	NA	NA
WP_137602560.1|1392510_1392738_-	YneF family protein	NA	NA	NA	NA	NA
WP_137602559.1|1392824_1393076_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_150204176.1|1393236_1393881_+	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	55.9	7.5e-15
WP_150204177.1|1393953_1395123_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_150204178.1|1395184_1395616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204179.1|1395674_1396103_-	DUF3021 family protein	NA	NA	NA	NA	NA
WP_150204180.1|1396253_1397132_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	4.4e-42
WP_003688751.1|1397155_1397443_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150204181.1|1397632_1398763_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	49.6	7.5e-103
WP_150204182.1|1398767_1399580_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	50.2	3.0e-61
WP_150204183.1|1399583_1399988_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150204184.1|1400260_1401436_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_150204185.1|1401467_1402085_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	35.4	2.5e-23
WP_150204186.1|1402237_1403617_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_150204187.1|1403747_1404452_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_150204188.1|1404470_1405106_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_150204189.1|1405277_1405460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204190.1|1405613_1406138_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_150204191.1|1406169_1406835_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_150204192.1|1406872_1407265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204666.1|1407281_1408316_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	1.2e-41
WP_150204193.1|1409154_1410360_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.5	5.9e-90
WP_150204194.1|1410796_1411927_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_137602341.1|1414058_1414733_-	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
WP_150204667.1|1414729_1415026_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_150204195.1|1415012_1415918_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_150204196.1|1416137_1420238_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_096494467.1|1421458_1421677_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	54.5	8.4e-11
WP_150204197.1|1421716_1422400_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	1450452	1503225	2207094	protease,transposase,tRNA	Lactobacillus_phage(18.75%)	54	NA	NA
WP_150204208.1|1450452_1451700_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.2	1.6e-138
WP_150204209.1|1451869_1453195_-	trigger factor	NA	NA	NA	NA	NA
WP_150204210.1|1453353_1454544_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	28.4	3.4e-29
WP_150204211.1|1454728_1455652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204212.1|1455729_1457445_-	RNase J family beta-CASP ribonuclease	NA	NA	NA	NA	NA
WP_150204213.1|1457465_1458338_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_137602235.1|1458498_1458768_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_137602236.1|1459012_1459267_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_150204214.1|1459353_1460379_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_150204215.1|1460348_1462649_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	33.9	4.5e-30
WP_137602239.1|1462649_1463129_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	55.8	2.2e-32
WP_137602240.1|1463205_1463838_-	competence protein	NA	NA	NA	NA	NA
WP_137602244.1|1463888_1464860_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_137602241.1|1464930_1465413_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.0	7.5e-28
WP_137602242.1|1465409_1465976_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_137602243.1|1465975_1466260_-	YlbG family protein	NA	NA	NA	NA	NA
WP_150204216.1|1466395_1469821_-	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_150204217.1|1469873_1471043_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_137602418.1|1471197_1473042_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_137602417.1|1473139_1473910_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_137602416.1|1473915_1474197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137602415.1|1474375_1475797_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	6.2e-46
WP_150204218.1|1475804_1477097_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_137602413.1|1477133_1478111_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_150204219.1|1478113_1479220_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_137602411.1|1479543_1480107_+	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	41.3	5.7e-11
WP_150204220.1|1480156_1480630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137602409.1|1480781_1480994_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_150204221.1|1481086_1482034_+	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.8	7.1e-14
WP_137602811.1|1482090_1482300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150203812.1|1482595_1483912_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	21.7	1.9e-09
WP_150204671.1|1484021_1485125_-	DUF1175 family protein	NA	D2KRB9	Lactobacillus_phage	43.0	1.1e-13
WP_150204222.1|1485458_1485986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137602813.1|1486479_1487274_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_150204223.1|1487389_1487812_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_150204224.1|1487947_1488607_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_150204225.1|1488815_1489277_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.6	2.0e-17
WP_150204226.1|1489432_1489999_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_137602644.1|1490033_1491032_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.2	2.7e-40
WP_150204227.1|1491109_1493581_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	26.6	9.4e-58
WP_137602656.1|1493602_1494277_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150204228.1|1494289_1494949_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_150204229.1|1495003_1495429_-|transposase	transposase	transposase	A0A146ICT8	Staphylococcus_phage	43.9	5.1e-20
WP_137602647.1|1495546_1496680_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_137602648.1|1497009_1497471_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_137602649.1|1497540_1497882_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_150204230.1|1497899_1499048_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_150204231.1|1499057_1499753_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_137602652.1|1499765_1500065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137602653.1|1500067_1500619_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_137602654.1|1500608_1500842_-	cold-shock protein	NA	NA	NA	NA	NA
WP_137602655.1|1500873_1501863_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_150204232.1|1502077_1502920_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	9.7e-156
WP_002816285.1|1502973_1503225_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
>prophage 11
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	1539126	1598671	2207094	transposase,tRNA	Bacillus_phage(15.38%)	60	NA	NA
WP_114698844.1|1539126_1540068_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	8.0e-34
WP_150204252.1|1540010_1540547_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_150204253.1|1540714_1541185_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_150204254.1|1541230_1541839_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150204255.1|1541770_1541950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204256.1|1541955_1543131_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_150204673.1|1543136_1543391_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_137602826.1|1543535_1544246_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_150204257.1|1544373_1544775_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_150204258.1|1545939_1546374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150204259.1|1553485_1553851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137602512.1|1554002_1554644_+	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
WP_150204260.1|1554633_1555275_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_150204261.1|1555255_1556032_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_150204262.1|1556041_1556770_-	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
WP_137602516.1|1556788_1558168_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_137602517.1|1558188_1558797_-	metallophosphatase	NA	L0LAH5	Bacillus_phage	38.9	8.3e-32
WP_150204263.1|1558890_1560075_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_150204264.1|1560092_1561106_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_137602520.1|1561178_1561454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137602521.1|1561450_1561906_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_150204265.1|1561902_1562190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137602523.1|1562176_1562635_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_150204266.1|1562606_1562927_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_150204267.1|1562928_1563984_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_137602526.1|1563919_1564915_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_137602527.1|1565015_1565747_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_150204268.1|1565836_1566838_-	catabolite control protein A	NA	NA	NA	NA	NA
WP_150204269.1|1567000_1568098_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_137602606.1|1568150_1568606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137602607.1|1568617_1569043_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_137602608.1|1569189_1570053_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_150204270.1|1570116_1571274_-	amidohydrolase	NA	NA	NA	NA	NA
WP_137602610.1|1571352_1572063_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_137602611.1|1572075_1572555_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_137602612.1|1572645_1573173_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_150204271.1|1573172_1573769_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	27.6	1.5e-09
WP_150204272.1|1573774_1574578_-	glutamate racemase	NA	NA	NA	NA	NA
WP_150204273.1|1574721_1575189_+	DUF2507 domain-containing protein	NA	NA	NA	NA	NA
WP_150204274.1|1575260_1575572_-	thioredoxin	NA	A0A1V0SD63	Indivirus	42.9	8.6e-09
WP_150204275.1|1575656_1578029_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	44.8	7.0e-18
WP_150204276.1|1578047_1578581_-	CvpA family protein	NA	NA	NA	NA	NA
WP_137602618.1|1578577_1578811_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_150204674.1|1578866_1580084_-	MFS transporter	NA	NA	NA	NA	NA
WP_137602619.1|1580193_1581108_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_137602774.1|1581190_1581508_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_137602773.1|1581518_1581956_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_137602772.1|1581955_1582216_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_150204277.1|1582330_1584982_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	33.4	3.0e-62
WP_150204278.1|1585245_1586598_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.3	1.1e-47
WP_137602769.1|1586599_1587550_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_137602768.1|1587640_1588759_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_150204279.1|1588946_1589408_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.4	1.3e-16
WP_137601597.1|1589618_1590032_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	34.1	2.6e-05
WP_150204280.1|1590103_1591246_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.2	6.2e-81
WP_137601595.1|1591339_1592377_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_137601594.1|1592382_1593399_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.3	1.6e-08
WP_150204281.1|1593418_1594012_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_150204282.1|1594120_1596067_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	6.1e-60
WP_137601600.1|1596100_1598671_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	1.2e-36
>prophage 12
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	1784181	1792367	2207094		Streptococcus_phage(66.67%)	11	NA	NA
WP_137601242.1|1784181_1785174_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	36.5	1.1e-49
WP_150204678.1|1785229_1785958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137601244.1|1785999_1786863_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	59.1	1.6e-81
WP_137601245.1|1787015_1787354_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	29.8	1.1e-09
WP_150204679.1|1787368_1788370_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.3	1.2e-32
WP_137601257.1|1788399_1788729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137601246.1|1788768_1789407_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.5e-55
WP_137601247.1|1789430_1789649_-	YaaL family protein	NA	NA	NA	NA	NA
WP_137601248.1|1789664_1790264_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_137601249.1|1790273_1790585_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_150204382.1|1790606_1792367_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.1	3.2e-52
>prophage 13
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	1966490	2013865	2207094	transposase,tRNA	Bacillus_phage(22.22%)	41	NA	NA
WP_150203428.1|1966490_1967696_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.8	4.1e-91
WP_137602731.1|1968462_1969149_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_150204478.1|1969270_1970311_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_150204479.1|1970554_1971754_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_150204480.1|1972124_1972499_-	hypothetical protein	NA	Q6SE87	Lactobacillus_prophage	51.2	1.5e-28
WP_150204481.1|1972631_1973162_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150204482.1|1973274_1974003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150204483.1|1974369_1975842_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_150204484.1|1975946_1977314_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.8	8.3e-48
WP_150204485.1|1977537_1978263_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_150204486.1|1978154_1979138_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_150204487.1|1979231_1979999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204488.1|1980008_1981382_-	AAA family ATPase	NA	V9QJ85	Oenococcus_phage	31.7	3.4e-09
WP_150204489.1|1981838_1982222_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_150204490.1|1982233_1983046_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_150204491.1|1983532_1984783_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_150204492.1|1984847_1985984_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	31.1	3.9e-35
WP_150204493.1|1986223_1986913_-	response regulator	NA	W8CYM9	Bacillus_phage	37.2	1.3e-36
WP_150204494.1|1987041_1987848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204495.1|1987959_1988706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204496.1|1988805_1989648_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.8	1.1e-39
WP_150204497.1|1989787_1990816_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	43.0	5.4e-68
WP_150204498.1|1990904_1991486_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	41.6	3.8e-34
WP_003688751.1|1991739_1992027_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105310504.1|1992050_1992929_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	4.4e-42
WP_137602042.1|1993289_1994432_-	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	31.8	6.9e-56
WP_150204499.1|1994658_1995429_-	DUF1129 family protein	NA	NA	NA	NA	NA
WP_137602044.1|1995801_1996902_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_137602045.1|1996961_1997165_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_150204500.1|1997179_1998058_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.3	2.2e-17
WP_150204501.1|1998044_1998815_-	AAA family ATPase	NA	Q8JL10	Natrialba_phage	31.5	8.3e-29
WP_150204502.1|1998829_1999774_-	nucleoid occlusion protein	NA	A0A2H4P6Z0	Pseudomonas_phage	34.1	1.1e-06
WP_137602049.1|1999783_2000518_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_137602050.1|2000731_2001643_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_150204503.1|2001937_2003182_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_150204504.1|2003625_2004375_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_137602053.1|2005482_2007288_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.7	2.4e-87
WP_150204505.1|2007744_2009103_-	amino acid permease	NA	NA	NA	NA	NA
WP_150204506.1|2009604_2010453_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	44.2	2.6e-07
WP_150204507.1|2010659_2011961_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.4	5.6e-94
WP_150204508.1|2012725_2013865_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	71.9	2.5e-154
>prophage 14
NZ_CP043939	Lactobacillus nenjiangensis strain SH-Y15 chromosome, complete genome	2207094	2055593	2136046	2207094	transposase	Planktothrix_phage(26.67%)	59	NA	NA
WP_003688751.1|2055593_2055881_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_057889459.1|2055904_2056783_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	4.4e-42
WP_150204536.1|2056768_2057536_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_137602147.1|2057947_2058877_-	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	32.2	3.0e-25
WP_137602146.1|2059030_2059570_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_150204537.1|2059802_2062088_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_150204691.1|2062146_2062266_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_150204538.1|2062290_2064990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204539.1|2065017_2065254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204540.1|2070817_2072119_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_150204541.1|2072562_2073522_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_150204542.1|2073625_2074804_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_150204543.1|2074955_2075741_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_150204544.1|2075864_2076527_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_150204545.1|2076526_2077549_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-28
WP_150204546.1|2077860_2078697_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_150204547.1|2079262_2079745_-	VOC family protein	NA	NA	NA	NA	NA
WP_150204548.1|2079865_2080957_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_150204549.1|2081209_2082805_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_150204550.1|2082795_2083047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204551.1|2084309_2085122_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_137601428.1|2085487_2086342_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_137601427.1|2086625_2087363_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	5.3e-33
WP_137601426.1|2087355_2088045_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_150204552.1|2088025_2088685_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_150204553.1|2088794_2090093_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_150204554.1|2090148_2091333_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	25.7	1.8e-14
WP_137601421.1|2091760_2092519_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	8.2e-29
WP_150204555.1|2092926_2093214_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150204556.1|2093237_2094116_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	2.2e-41
WP_150204557.1|2094396_2095167_-	acetoin reductase	NA	NA	NA	NA	NA
WP_150204558.1|2095178_2095652_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_137601410.1|2095671_2096529_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_150204559.1|2096545_2097217_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_137601408.1|2097222_2098290_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.6	9.8e-28
WP_150204560.1|2098293_2098773_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_137601406.1|2099251_2100604_-	amino acid permease	NA	NA	NA	NA	NA
WP_150204561.1|2100810_2101224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204562.1|2101377_2102058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204563.1|2102171_2103470_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.0	2.2e-18
WP_150204564.1|2103469_2104774_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.3	6.9e-68
WP_137601401.1|2105038_2106013_+	GMP reductase	NA	G3MBI2	Bacillus_virus	72.5	2.4e-134
WP_150204565.1|2106268_2109985_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	23.4	5.4e-17
WP_150204566.1|2109984_2113557_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_137601398.1|2113689_2115042_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_150204692.1|2115874_2117260_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.5	4.4e-28
WP_150204693.1|2118355_2119807_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_150204567.1|2120335_2120680_-	chromate transporter	NA	NA	NA	NA	NA
WP_150204568.1|2120676_2121234_-	chromate transporter	NA	NA	NA	NA	NA
WP_150204569.1|2121321_2122194_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150204570.1|2122198_2122579_-	glyoxalase	NA	NA	NA	NA	NA
WP_150204571.1|2122956_2124534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204572.1|2126211_2127750_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_150204573.1|2128109_2129345_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.3	1.3e-87
WP_150204574.1|2129579_2130308_-	DNA-entry nuclease	NA	NA	NA	NA	NA
WP_150204575.1|2131229_2131865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150204694.1|2132345_2132954_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_150204576.1|2133481_2134858_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_150204695.1|2135011_2136046_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.8	1.8e-42
