The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044047	Klebsiella pneumoniae strain FDAARGOS_629 chromosome, complete genome	5387964	1201359	1210822	5387964	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1201359_1202475_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1202471_1204412_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1204488_1204710_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1205035_1205353_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1205383_1207663_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1207782_1208001_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1208354_1209056_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_062920823.1|1209100_1210822_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	9.0e-15
>prophage 2
NZ_CP044047	Klebsiella pneumoniae strain FDAARGOS_629 chromosome, complete genome	5387964	1467037	1546467	5387964	holin,tail,terminase,portal,protease,tRNA,integrase	Enterobacterial_phage(24.0%)	99	1463571:1463588	1546065:1546082
1463571:1463588	attL	GCAGGATGCGAACGGCGA	NA	NA	NA	NA
WP_004150803.1|1467037_1468144_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|1468200_1468659_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|1468675_1469326_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|1469566_1470817_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_014228877.1|1470934_1472062_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	3.3e-119
WP_012542206.1|1472042_1472288_-	excisionase	NA	NA	NA	NA	NA
WP_064184756.1|1472340_1474479_-	exonuclease	NA	S4TNL0	Salmonella_phage	43.0	5.0e-100
WP_014228879.1|1474620_1474965_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_016160636.1|1475007_1475202_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_114140416.1|1475211_1475430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040234937.1|1475592_1475907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032428184.1|1476248_1476629_-	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	37.7	1.9e-10
WP_023342905.1|1476734_1476947_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	57.6	1.9e-15
WP_063666440.1|1476949_1477504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040240595.1|1477555_1478539_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.8	2.4e-44
WP_040240646.1|1478531_1478996_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	68.9	1.7e-61
WP_074182017.1|1479009_1479450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063666443.1|1479679_1480711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071034541.1|1480940_1481270_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.9	3.4e-24
WP_048289195.1|1481422_1481656_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	73.7	1.2e-26
WP_150340975.1|1481667_1481958_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	60.9	4.0e-16
WP_052453822.1|1481998_1482391_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	35.6	1.4e-11
WP_040147621.1|1482387_1482591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048270331.1|1482590_1483622_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	2.8e-96
WP_048270332.1|1483638_1484241_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	1.9e-76
WP_017880269.1|1485663_1485879_+|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_048270333.1|1485878_1486376_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.2	5.6e-79
WP_017898986.1|1486372_1486723_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_017898988.1|1487802_1487991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017898989.1|1488097_1488319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023342894.1|1488771_1489089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077256680.1|1489085_1489508_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.2e-40
WP_023342892.1|1489739_1490228_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	87.7	1.3e-72
WP_040234925.1|1490227_1492330_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	84.0	0.0e+00
WP_023342890.1|1492326_1492539_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	80.0	2.9e-24
WP_023342889.1|1492538_1494041_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.0	2.8e-246
WP_032428174.1|1493985_1496013_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	82.1	0.0e+00
WP_016530353.1|1496096_1496423_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.7	8.1e-34
WP_023342887.1|1496415_1496691_+	hypothetical protein	NA	K7PH43	Enterobacteria_phage	57.1	1.1e-23
WP_016530351.1|1496694_1497273_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	81.2	1.7e-79
WP_016530350.1|1497269_1497671_+|tail	minor tail family protein	tail	K7PHM6	Enterobacterial_phage	75.6	2.7e-55
WP_016530349.1|1497679_1498423_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	83.0	1.7e-111
WP_072216832.1|1498433_1498862_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	60.0	2.7e-37
WP_071609142.1|1498882_1499197_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	75.0	5.0e-41
WP_023342886.1|1499180_1502324_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	73.1	0.0e+00
WP_023342885.1|1502328_1502676_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	67.8	4.7e-40
WP_016530342.1|1502672_1503428_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.1	1.3e-130
WP_023342884.1|1503429_1504140_+	hypothetical protein	NA	Q6UAW4	Klebsiella_phage	90.7	1.1e-136
WP_016530340.1|1504171_1504762_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.0	2.5e-81
WP_023342883.1|1504824_1513641_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	43.2	0.0e+00
WP_023342882.1|1513702_1515199_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	65.4	5.6e-130
WP_004892953.1|1515353_1515506_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_064162249.1|1515617_1516760_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	81.9	5.9e-172
WP_064162275.1|1516749_1516986_-	excisionase	NA	NA	NA	NA	NA
WP_071562415.1|1517014_1517287_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	4.4e-09
WP_064162248.1|1517286_1517505_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.7e-09
WP_064162247.1|1517497_1517866_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	55.2	1.1e-18
WP_064162245.1|1518517_1518724_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	1.1e-31
WP_023158884.1|1518720_1518981_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.0	7.4e-30
WP_048983165.1|1519668_1520454_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.2e-61
WP_024623196.1|1520453_1520753_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.1e-13
WP_049264668.1|1520842_1521760_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.5	8.9e-46
WP_064162520.1|1521969_1522329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064162521.1|1522630_1523326_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.7	3.2e-88
WP_001191665.1|1523423_1523666_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_004213338.1|1523700_1524162_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|1524399_1524579_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_024176409.1|1524568_1525522_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	75.5	3.7e-103
WP_065801420.1|1525518_1526328_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	5.9e-110
WP_000779146.1|1526337_1526715_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_032437712.1|1526727_1527708_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.9e-134
WP_004899672.1|1527721_1528300_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_071579616.1|1528612_1528870_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
WP_031280381.1|1528775_1529222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031280382.1|1529834_1530134_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_004184488.1|1530130_1530670_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_004190674.1|1530666_1531011_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_064162540.1|1531007_1531283_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	60.7	7.3e-20
WP_071579617.1|1531233_1531428_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	90.6	1.1e-25
WP_124245667.1|1531594_1531807_+	hypothetical protein	NA	A0A286N2Q9	Klebsiella_phage	70.0	3.9e-21
WP_064162539.1|1532241_1532487_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	95.1	3.9e-33
WP_107334310.1|1532712_1532973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023320792.1|1533038_1533224_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	1.9e-11
WP_014228567.1|1533545_1534037_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_064162538.1|1534036_1536145_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.2	0.0e+00
WP_020317294.1|1536141_1536357_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_049186538.1|1536353_1537853_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.2	1.9e-247
WP_150340978.1|1537866_1538397_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	76.0	1.8e-46
WP_057729203.1|1538344_1539580_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	43.0	2.2e-100
WP_057729204.1|1539581_1539806_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_057729205.1|1539865_1540726_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_114261011.1|1540742_1540913_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.9	2.1e-09
WP_077264224.1|1541043_1541319_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	63.2	3.3e-20
WP_057729206.1|1541315_1541570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032743295.1|1541566_1541935_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	91.0	3.8e-56
WP_096923804.1|1542213_1543302_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	79.3	2.3e-157
WP_047050593.1|1543497_1544211_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_047050594.1|1544362_1544557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047050595.1|1544553_1546467_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	57.6	2.3e-213
1546065:1546082	attR	GCAGGATGCGAACGGCGA	NA	NA	NA	NA
>prophage 3
NZ_CP044047	Klebsiella pneumoniae strain FDAARGOS_629 chromosome, complete genome	5387964	1550322	1597648	5387964	tail,tRNA	Enterobacteria_phage(36.84%)	56	NA	NA
WP_049186541.1|1550322_1550649_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	4.0e-33
WP_020317349.1|1550641_1550935_+	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_064162536.1|1550924_1551476_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
WP_020804325.1|1551472_1551871_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_071579619.1|1551878_1552181_+	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	70.2	2.0e-34
WP_020804338.1|1552177_1552360_+|tail	major tail protein V domain protein	tail	K7PGX1	Enterobacteria_phage	72.7	2.1e-15
WP_025714420.1|1552402_1552798_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
WP_032420719.1|1552818_1553136_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_064162535.1|1553116_1555813_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.6	2.2e-201
WP_032420722.1|1555812_1556286_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
WP_038433285.1|1556272_1556755_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
WP_029497207.1|1556762_1557149_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
WP_064162534.1|1557145_1560214_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	66.3	0.0e+00
WP_071579620.1|1562257_1563058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162136.1|1563068_1563251_+	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	87.0	1.8e-19
WP_071579621.1|1563328_1563751_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	43.8	1.2e-24
WP_077265864.1|1564593_1564887_+	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	80.0	3.9e-27
WP_064162135.1|1565083_1566790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162134.1|1567825_1568626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004892953.1|1568834_1568987_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_032419088.1|1569259_1569973_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023159861.1|1569969_1570362_-	ACT domain protein	NA	NA	NA	NA	NA
WP_004150797.1|1570354_1570678_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_023159860.1|1570921_1571107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|1571127_1571355_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|1571467_1572661_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004150795.1|1573283_1573469_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|1573559_1574054_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|1574080_1574587_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140512.1|1574603_1575491_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_021313534.1|1575546_1576953_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004183659.1|1576949_1577960_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_023328665.1|1578075_1578273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004183660.1|1578839_1579472_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140501.1|1579511_1579691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|1580089_1580776_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140497.1|1581086_1582595_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_032439862.1|1582715_1583606_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019705575.1|1583612_1585397_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|1585470_1586679_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004179363.1|1586981_1588025_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|1588686_1589601_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|1589690_1590329_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|1590459_1590723_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|1590782_1590908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|1591025_1591100_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|1591099_1591201_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_064162133.1|1591258_1592272_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.8	1.1e-12
WP_004140479.1|1592572_1592812_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|1592801_1593158_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176547.1|1593144_1593654_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_032439865.1|1593799_1594492_+	CTP synthase	NA	NA	NA	NA	NA
WP_004148041.1|1594523_1595708_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002901073.1|1595809_1596601_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|1596584_1597031_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|1597147_1597648_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP044047	Klebsiella pneumoniae strain FDAARGOS_629 chromosome, complete genome	5387964	1991515	2002402	5387964		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1991515_1992136_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004224682.1|1992128_1993394_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002903955.1|1993405_1994308_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|1994568_1995330_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|1995350_1996211_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|1996508_1996769_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|1996855_1997944_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_032419002.1|1997974_1999240_-	MFS transporter	NA	NA	NA	NA	NA
WP_064162078.1|1999294_2002402_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 5
NZ_CP044047	Klebsiella pneumoniae strain FDAARGOS_629 chromosome, complete genome	5387964	2778816	2869178	5387964	head,plate,tail,terminase,portal,protease,capsid,tRNA,integrase	Enterobacteria_phage(19.3%)	113	2822875:2822890	2877156:2877171
WP_002911381.1|2778816_2779701_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_004145536.1|2779935_2781984_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.0e-86
WP_014907336.1|2782003_2782681_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002911386.1|2782778_2783276_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_064162198.1|2783408_2784692_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002911388.1|2784660_2787294_+	PqiB family protein	NA	NA	NA	NA	NA
WP_004148845.1|2787418_2788852_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_002911393.1|2788967_2789207_+	YebV family protein	NA	NA	NA	NA	NA
WP_002911395.1|2789304_2789496_+	YebW family protein	NA	NA	NA	NA	NA
WP_004180432.1|2789492_2790146_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	8.0e-57
WP_002911397.1|2790266_2791271_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_002911398.1|2791375_2791519_+	Ecr family regulatory small membrane protein	NA	NA	NA	NA	NA
WP_015874944.1|2792155_2792497_-	YebY family protein	NA	NA	NA	NA	NA
WP_004175431.1|2792510_2793380_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_004151448.1|2793383_2793758_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_002911406.1|2793870_2794101_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
WP_002911407.1|2794179_2794839_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
WP_004151449.1|2794842_2796903_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_004145550.1|2797023_2797683_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_004175424.1|2797822_2798170_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_023313384.1|2798314_2799493_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_002911423.1|2799550_2800192_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_064162199.1|2800230_2802042_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_002911427.1|2802264_2803740_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
WP_004145554.1|2803750_2803900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189259.1|2803871_2804060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040236900.1|2804095_2804965_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002911440.1|2805090_2806533_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_004175421.1|2806573_2807548_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_002911444.1|2807665_2808985_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
WP_071579711.1|2809000_2809945_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002911449.1|2810023_2810776_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
WP_002911451.1|2810775_2811561_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004148860.1|2811624_2812635_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
WP_002911454.1|2812643_2813255_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002911456.1|2813334_2813856_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911459.1|2813890_2814631_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911477.1|2814658_2815102_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_049000419.1|2815103_2816891_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_004145564.1|2817158_2817725_+	hydrolase	NA	NA	NA	NA	NA
WP_076997021.1|2817989_2818307_-	hypothetical protein	NA	I6PCW5	Cronobacter_phage	52.6	1.4e-22
WP_065801522.1|2818306_2818546_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	53.2	1.3e-17
WP_076997020.1|2818650_2819451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076997019.1|2819460_2821452_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	29.1	3.1e-27
WP_076997017.1|2822536_2823220_-	YmfQ family protein	NA	NA	NA	NA	NA
2822875:2822890	attL	CCAGCGCTTTGGCAAT	NA	NA	NA	NA
WP_048294794.1|2823216_2824365_-|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	27.5	7.1e-16
WP_048294792.1|2824354_2824804_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	40.7	3.8e-18
WP_077259445.1|2824796_2825345_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	33.3	5.4e-06
WP_076997016.1|2825380_2826460_-|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	31.3	1.2e-38
WP_076997015.1|2826456_2827857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076997014.1|2827902_2829777_-	hypothetical protein	NA	Q858G0	Salmonella_phage	40.5	4.5e-20
WP_101976956.1|2829769_2829961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076997013.1|2829918_2830197_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_048294781.1|2830198_2830567_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_076997012.1|2830570_2832082_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.0e-106
WP_070082887.1|2832078_2832264_-	DUF2635 domain-containing protein	NA	A0A2P9JZJ7	Alteromonadaceae_phage	42.6	1.8e-06
WP_076997011.1|2832267_2832813_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_072061027.1|2832809_2833169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076997010.1|2833174_2833573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069197048.1|2833544_2834594_-|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	29.4	1.2e-38
WP_064169643.1|2834691_2835096_-|head	head decoration protein	head	A0A0C5AN05	Bacteriophage	37.6	3.1e-11
WP_096645209.1|2835095_2835410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096833751.1|2835393_2835651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076997008.1|2835678_2836545_-	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	39.5	3.1e-48
WP_048294765.1|2836541_2838179_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.9	6.8e-89
WP_032735077.1|2838178_2838442_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_076997007.1|2838450_2840574_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.9	1.6e-98
WP_058836975.1|2840515_2841079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076997006.1|2841334_2842048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076997005.1|2842116_2842755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076997004.1|2843159_2843588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076997003.1|2843725_2843980_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	66.7	2.5e-22
WP_076997002.1|2843867_2844257_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	48.4	1.2e-23
WP_064144940.1|2844253_2844757_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	79.6	1.9e-74
WP_004146347.1|2844759_2845074_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_048322094.1|2845499_2846024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322093.1|2846368_2847058_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.9e-56
WP_001548467.1|2847054_2847195_-	YlcG family protein	NA	NA	NA	NA	NA
WP_071579703.1|2847191_2847773_-	protein NinG	NA	E7C9S3	Salmonella_phage	43.8	8.7e-39
WP_071579702.1|2847765_2848440_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	74.0	5.1e-99
WP_071579701.1|2848436_2848604_-	NinE family protein	NA	G8C7V4	Escherichia_phage	75.0	6.2e-14
WP_071579700.1|2848603_2849041_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	77.7	7.4e-59
WP_039108779.1|2849392_2849713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039108781.1|2849878_2850127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085921672.1|2850126_2850687_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	30.3	2.7e-05
WP_029602865.1|2850794_2851088_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_040181701.1|2851580_2851841_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_052450983.1|2851837_2852290_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.6	4.4e-14
WP_040182091.1|2852526_2852820_-	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.1e-25
WP_040182092.1|2852816_2853665_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_071579699.1|2853661_2854522_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.6	1.2e-60
WP_001548453.1|2854607_2854829_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004191589.1|2854868_2855087_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_021312733.1|2855195_2855855_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
WP_032717012.1|2856540_2856735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071579698.1|2856822_2857824_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	90.4	4.2e-65
WP_064162447.1|2857831_2858116_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	5.2e-29
WP_008807812.1|2858132_2858879_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	67.7	3.1e-65
WP_008807811.1|2858875_2859499_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.7	9.0e-58
WP_032439799.1|2859527_2860055_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	59.8	1.2e-55
WP_060415520.1|2860051_2860273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077265874.1|2860158_2860776_+	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	47.0	7.8e-38
WP_025269983.1|2860772_2860964_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_064162449.1|2860960_2861179_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
WP_016244760.1|2861182_2861428_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_043906718.1|2861470_2862730_+|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	89.9	2.3e-225
WP_043906717.1|2862726_2863506_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_002911484.1|2863558_2863954_+	membrane protein	NA	NA	NA	NA	NA
WP_002911486.1|2863993_2864737_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_004151451.1|2864733_2865738_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_004180440.1|2865819_2866563_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002911491.1|2866639_2867209_-	VOC family protein	NA	NA	NA	NA	NA
WP_004151452.1|2867444_2869178_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
2877156:2877171	attR	CCAGCGCTTTGGCAAT	NA	NA	NA	NA
>prophage 6
NZ_CP044047	Klebsiella pneumoniae strain FDAARGOS_629 chromosome, complete genome	5387964	3127365	3134270	5387964	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004214740.1|3127365_3128844_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
WP_004175198.1|3128840_3129563_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|3129881_3131243_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_064162400.1|3131488_3132382_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	30.2	2.1e-15
WP_064162372.1|3132622_3133396_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.1e-25
WP_064162399.1|3133406_3134270_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 1
NZ_CP044043	Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed1, complete sequence	72634	17723	65202	72634	transposase,integrase	Salmonella_phage(20.0%)	48	47556:47606	70153:70203
WP_000016982.1|17723_18530_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|18530_18836_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|18837_19056_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000151784.1|19622_20135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545987.1|20168_21302_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000905949.1|21468_22242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528931.1|22254_22755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261278.1|23019_23250_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034046.1|23246_23663_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001542068.1|23707_27532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261286.1|27882_28113_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|28109_28526_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|28600_30166_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361402.1|30150_31173_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000973519.1|32503_34705_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|34786_36064_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015721.1|36060_37803_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000011908.1|37802_38750_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000602863.1|38750_40475_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000095526.1|40610_41804_+	MFS transporter	NA	NA	NA	NA	NA
WP_001318207.1|42183_42564_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_001332402.1|42635_42908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000968139.1|43806_44664_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101723.1|44660_45518_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|45514_46342_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000949004.1|46341_47256_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001324213.1|47378_47570_-	hypothetical protein	NA	NA	NA	NA	NA
47556:47606	attL	CGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTG	NA	NA	NA	NA
WP_001138014.1|48375_51342_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|51345_51906_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000454193.1|52081_52432_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|52634_53648_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|53792_54290_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|54401_54692_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|54697_55489_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|55652_56000_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|55993_56833_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|56762_56942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|56960_57233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427620.1|57414_58419_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|58646_59852_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|59862_60168_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|60183_60366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|60394_61159_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|61349_61706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|61651_62236_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|62235_63474_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|63470_64376_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|64497_65202_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
70153:70203	attR	CACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCG	NA	NA	NA	NA
>prophage 1
NZ_CP044045	Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence	138560	6509	35700	138560	transposase,integrase	Escherichia_phage(30.0%)	29	15757:15796	31385:31424
WP_002431311.1|6509_8051_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_071579738.1|8631_9180_-	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_071579737.1|9192_12042_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_029498355.1|12041_13409_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_023158001.1|13398_13842_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_023158002.1|13887_14445_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_023158003.1|14416_14656_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_015065535.1|14666_15419_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_100097831.1|15439_15736_-	hypothetical protein	NA	NA	NA	NA	NA
15757:15796	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATC	NA	NA	NA	NA
WP_001067855.1|15819_16524_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023277723.1|16676_16838_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	72.7	4.7e-11
WP_123196132.1|16759_17044_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000845039.1|17012_18026_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000237816.1|18198_18651_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_022631163.1|18731_19985_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	29.7	3.0e-12
WP_022631510.1|20705_21260_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_015632396.1|21670_22450_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtF1	NA	NA	NA	NA	NA
WP_071567851.1|23799_23994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031281281.1|24098_24731_-	type B chloramphenicol O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.9	2.6e-28
WP_000376623.1|25513_26014_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|26319_26433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|26520_27285_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_074466331.1|27326_27548_+	resolvase	NA	NA	NA	NA	NA
WP_023356273.1|27627_27867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631505.1|27866_28277_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_015632391.1|28280_31274_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	46.6	1.3e-258
WP_001393253.1|33682_34015_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
31385:31424	attR	GATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_150340955.1|34061_34937_-	CTX-M family class A extended-spectrum beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	82.4	8.3e-126
WP_001067855.1|34995_35700_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP044045	Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence	138560	72724	84816	138560		Escherichia_phage(25.0%)	13	NA	NA
WP_004152355.1|72724_73426_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_040245863.1|73862_74093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152354.1|74153_74825_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_032414078.1|74827_75799_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_032663686.1|76030_76462_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	7.9e-29
WP_004152351.1|76461_77733_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152350.1|78133_79030_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152349.1|79351_80557_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152348.1|80553_81528_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004197751.1|81699_81885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|81904_82237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227314.1|82461_82677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152345.1|82788_84816_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 3
NZ_CP044045	Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence	138560	89391	126321	138560	transposase,integrase	Escherichia_phage(35.0%)	40	82586:82601	108645:108660
82586:82601	attL	TCATAGCTGCCTGTCA	NA	NA	NA	NA
WP_004152342.1|89391_90660_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|90779_91253_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004164986.1|91417_91612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|92466_93249_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|93248_93581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|93587_93944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|94011_94341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|94368_94677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|94722_94929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162066.1|95574_96144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568023.1|96284_97313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568022.1|97457_100262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839879.1|100846_102439_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.2e-175
WP_004189161.1|102469_102820_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_015632382.1|102816_103257_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_001531258.1|103937_104720_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_032441952.1|104716_105739_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
WP_001568019.1|106768_108496_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001568018.1|108941_109190_+	hypothetical protein	NA	NA	NA	NA	NA
108645:108660	attR	TCATAGCTGCCTGTCA	NA	NA	NA	NA
WP_015632385.1|109186_109759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568016.1|109789_110284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568015.1|110327_110627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568014.1|110516_110825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022631396.1|110950_111187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567366.1|111318_111867_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|111913_112348_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_101313273.1|112576_114108_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	9.0e-51
WP_019725650.1|114420_114744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725651.1|114816_115812_-	hypothetical protein	NA	A0A2H4UVR4	Bodo_saltans_virus	34.9	2.1e-32
WP_015065500.1|116108_116759_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.6	1.8e-77
WP_001695382.1|116805_117147_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	50.0	3.4e-19
WP_001067855.1|117259_117964_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_124044795.1|118083_118497_-	chloramphenicol acetyltransferase	NA	A0A1I9LJQ7	Stx_converting_phage	100.0	5.7e-77
WP_069346845.1|119170_119827_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	1.7e-06
WP_000493286.1|120062_120392_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|120372_120654_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_001067855.1|122946_123651_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040154863.1|123971_125234_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077890461.1|125415_125646_-	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	100.0	3.6e-20
WP_001067855.1|125616_126321_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP044046	Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed4, complete sequence	109938	0	24241	109938	portal,terminase	Salmonella_phage(96.77%)	34	NA	NA
WP_004109830.1|2546_2780_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
WP_004109835.1|2896_3214_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109839.1|3275_4022_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_102007214.1|4089_4482_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	67.5	1.0e-46
WP_021313126.1|4483_4957_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_004109848.1|4947_5292_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_023279432.1|5389_6223_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	2.4e-130
WP_023279433.1|6222_6657_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_014342134.1|6704_7133_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
WP_004109857.1|7211_8090_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_023279435.1|8116_9016_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
WP_112295219.1|9038_10628_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.7	1.4e-275
WP_004109863.1|10645_11902_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|11904_12546_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|12721_12988_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_026005938.1|12997_13897_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	4.2e-165
WP_060528000.1|13893_14148_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	95.2	3.4e-40
WP_019704584.1|14140_14779_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
WP_112295220.1|14775_15444_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.4	1.5e-106
WP_021313132.1|15443_16124_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	2.1e-108
WP_021313133.1|16207_17767_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.2e-279
WP_014342145.1|17769_18045_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
WP_019704582.1|18095_18533_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_014342147.1|18688_19219_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_100098059.1|19222_19531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047066281.1|19852_20503_+	hypothetical protein	NA	J9Q754	Salmonella_phage	92.1	2.9e-107
WP_004109904.1|20553_20757_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_042935000.1|21349_21832_-	hypothetical protein	NA	J9Q805	Salmonella_phage	78.1	2.5e-71
WP_080031187.1|22036_22318_-	ABC transporter	NA	J9Q753	Salmonella_phage	83.9	6.9e-42
WP_021313142.1|22320_22695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004109918.1|22822_23230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080031186.1|23349_23661_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	66.0	2.0e-29
WP_080031185.1|23797_24010_-	hypothetical protein	NA	J9Q804	Salmonella_phage	74.3	1.2e-25
WP_150340956.1|24022_24241_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	80.6	1.9e-26
>prophage 2
NZ_CP044046	Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed4, complete sequence	109938	28189	36176	109938		Salmonella_phage(42.86%)	8	NA	NA
WP_112295224.1|28189_29746_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_150340958.1|29742_30960_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_112295226.1|31076_34193_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.0e-25
WP_064173661.1|34254_34470_-	hypothetical protein	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
WP_114071303.1|34598_35177_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	1.5e-54
WP_014342167.1|35304_35460_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_019704567.1|35459_35885_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_150340959.1|35987_36176_-	hypothetical protein	NA	J9Q800	Salmonella_phage	54.2	6.7e-09
>prophage 3
NZ_CP044046	Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed4, complete sequence	109938	39736	107895	109938	integrase,tail	Salmonella_phage(89.47%)	67	61096:61115	76965:76984
WP_019704564.1|39736_39970_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
WP_023279507.1|40167_40761_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
WP_065809999.1|40945_41779_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	8.6e-64
WP_032423056.1|41904_42453_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	74.4	3.2e-75
WP_050485941.1|42449_43031_-	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	50.4	4.2e-33
WP_039817735.1|43253_43673_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.8	1.7e-52
WP_023279503.1|43736_44381_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.6	4.7e-94
WP_150340960.1|44380_44857_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.0	2.4e-71
WP_019704560.1|44853_45267_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	2.3e-54
WP_023279500.1|45268_46372_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.1	6.7e-181
WP_023279499.1|46565_47441_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	85.1	1.2e-140
WP_014342181.1|47518_48661_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_065809998.1|48791_51095_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
WP_040247361.1|51170_51740_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
WP_072196422.1|51749_52460_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	3.9e-73
WP_048333494.1|52485_54402_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.3	1.8e-298
WP_072196416.1|54398_54632_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
WP_021313776.1|54631_55717_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.8	1.1e-183
WP_021313777.1|55905_56400_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	1.0e-59
WP_042935022.1|56475_57120_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	4.9e-99
WP_100091244.1|57216_57429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032423053.1|57440_58538_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.2e-73
WP_014342074.1|58968_59181_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_039817757.1|59180_59516_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	3.6e-37
WP_023279494.1|59512_59692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340961.1|60224_61301_-	recombinase	NA	J9Q736	Salmonella_phage	95.8	1.9e-196
61096:61115	attL	GTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
WP_019704549.1|61303_61570_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_021313784.1|61569_62514_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.6	2.8e-172
WP_042935032.1|62574_63582_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	87.6	2.3e-143
WP_064164595.1|63701_64133_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.4e-65
WP_014342082.1|64305_64605_-	lipoprotein	NA	NA	NA	NA	NA
WP_048292514.1|64616_65036_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	62.6	6.3e-47
WP_150340962.1|65236_65680_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	82.3	7.6e-59
WP_150340963.1|65676_69195_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.1	0.0e+00
WP_071994325.1|69169_69373_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	3.3e-25
WP_019704545.1|69375_70608_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.6	1.3e-212
WP_065809995.1|70704_72984_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	62.8	2.1e-245
WP_032423001.1|73100_73313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342091.1|73586_73967_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032422994.1|73961_75062_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.2e-17
WP_150340964.1|75268_75838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340965.1|75821_76049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340966.1|76450_77227_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	66.1	1.7e-90
76965:76984	attR	GTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
WP_064165103.1|77470_78187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340967.1|79983_80262_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	67.4	6.9e-26
WP_087636937.1|80258_80411_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	84.0	7.1e-17
WP_050484095.1|80655_81123_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	3.4e-49
WP_150340968.1|81202_81991_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	5.3e-71
WP_039817658.1|82279_83446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340969.1|83487_84606_-	DNA primase	NA	J9Q720	Salmonella_phage	91.3	5.3e-202
WP_032440528.1|84758_86099_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
WP_023279420.1|86163_86889_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	2.5e-128
WP_150340970.1|87079_87490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340971.1|87482_88217_-	hypothetical protein	NA	J9Q719	Salmonella_phage	41.3	7.0e-17
WP_019704530.1|88253_88616_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_115694729.1|88615_89281_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_150340972.1|89600_90158_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	43.2	4.3e-35
WP_023279423.1|90218_90404_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	68.3	1.3e-17
WP_032422981.1|90354_90606_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	72.3	9.9e-24
WP_014342120.1|90608_91301_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	89.6	7.0e-120
WP_004109805.1|91314_91638_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_032422978.1|91733_93179_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.5	4.4e-39
WP_150340973.1|93231_105369_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	59.1	6.3e-30
WP_019704527.1|105385_105997_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_004109817.1|105984_106782_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_004109820.1|106774_107473_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_032423010.1|107559_107895_-|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
