The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044098	Citrobacter portucalensis strain FDAARGOS_617 chromosome, complete genome	4926736	241975	251983	4926736	tRNA	Brazilian_cedratvirus(28.57%)	10	NA	NA
WP_032943167.1|241975_242755_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.0e-10
WP_150388299.1|242751_244194_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	4.5e-52
WP_032943165.1|244255_244969_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003832591.1|245287_245752_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_032943164.1|245829_246579_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_032943163.1|246578_247130_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|247190_248171_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|248292_248592_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_032943162.1|248596_250984_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|250999_251983_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
>prophage 2
NZ_CP044098	Citrobacter portucalensis strain FDAARGOS_617 chromosome, complete genome	4926736	943640	951769	4926736		Escherichia_phage(50.0%)	8	NA	NA
WP_032942674.1|943640_944471_-	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	31.2	6.0e-17
WP_003831264.1|944746_945157_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_003022101.1|945340_945769_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
WP_032942673.1|945838_946606_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_008784074.1|946605_947163_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.7	6.2e-26
WP_032942672.1|947159_949430_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.0	1.5e-46
WP_032942671.1|949426_949981_-	dehydrogenase	NA	A0A077SLS7	Escherichia_phage	29.0	5.8e-08
WP_020996553.1|950203_951769_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.1e-43
>prophage 3
NZ_CP044098	Citrobacter portucalensis strain FDAARGOS_617 chromosome, complete genome	4926736	3042722	3102132	4926736	capsid,head,integrase,tRNA,plate,terminase,portal,holin,lysis,tail	Escherichia_phage(23.4%)	68	3063858:3063906	3095916:3095964
WP_016157522.1|3042722_3043055_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_122973809.1|3043132_3044623_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	3.7e-33
WP_032945066.1|3044942_3046463_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	49.3	1.1e-32
WP_032945064.1|3046516_3047194_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032945063.1|3047432_3048206_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_032945513.1|3048206_3049055_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_008785859.1|3049122_3050277_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.5	6.1e-84
WP_032945061.1|3050419_3052078_-	glycerone kinase	NA	NA	NA	NA	NA
WP_032945060.1|3052639_3053737_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_003828512.1|3053828_3055754_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_032945059.1|3055731_3056262_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_032945057.1|3056262_3056616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003024734.1|3056632_3057796_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003828504.1|3057818_3058247_-	heme-binding protein	NA	NA	NA	NA	NA
WP_032945056.1|3058639_3060307_+	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_008785852.1|3060318_3060903_+	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_032945054.1|3060905_3061334_+	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_032945052.1|3061344_3063159_+	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_001573898.1|3063268_3063592_+	DUF1889 family protein	NA	NA	NA	NA	NA
3063858:3063906	attL	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_107238584.1|3063997_3065020_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	88.8	1.1e-177
WP_150388562.1|3065019_3065601_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	92.6	2.9e-98
WP_058655896.1|3065722_3065986_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	92.0	6.5e-42
WP_052935637.1|3066016_3066526_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	1.2e-89
WP_150388408.1|3066533_3066761_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	89.3	4.7e-33
WP_001550179.1|3066747_3066948_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	92.4	3.7e-29
WP_150388409.1|3067014_3067248_+	DUF2732 family protein	NA	Q6K1F6	Salmonella_virus	79.2	3.7e-25
WP_057517728.1|3067247_3067469_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	90.4	4.3e-31
WP_150388410.1|3067469_3067748_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	73.9	2.2e-32
WP_150388411.1|3067740_3068745_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	41.0	1.8e-63
WP_150388412.1|3068741_3070961_+	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	93.1	0.0e+00
WP_150388413.1|3071078_3071519_+	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	94.9	5.2e-68
WP_150388414.1|3071602_3072334_+	hypothetical protein	NA	Q37850	Escherichia_phage	91.4	3.4e-125
WP_150388415.1|3072541_3072751_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	86.8	9.4e-28
WP_021532435.1|3072969_3073680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388416.1|3074020_3075058_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.7	1.4e-164
WP_150388417.1|3075057_3076827_-|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	8.5e-287
WP_150388418.1|3076991_3077855_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.6	8.3e-102
WP_150388419.1|3077886_3079047_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.8	9.6e-130
WP_150388420.1|3079050_3079809_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	1.6e-80
WP_000177982.1|3079906_3080407_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_001100637.1|3080406_3080610_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_150388421.1|3080600_3080822_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	69.9	1.1e-23
WP_150388422.1|3080805_3081315_+	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	82.6	2.7e-76
WP_052935785.1|3081311_3081725_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	67.2	5.4e-43
WP_121572248.1|3081606_3081870_+|holin	holin	holin	S4TNY4	Salmonella_phage	70.2	1.2e-27
WP_044701608.1|3081832_3082300_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	70.3	9.7e-57
WP_150388423.1|3082292_3082748_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.8	7.8e-51
WP_150388424.1|3082761_3083505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388425.1|3083579_3084221_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	82.6	1.9e-95
WP_150388426.1|3084217_3084565_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	70.4	1.6e-40
WP_047674762.1|3084569_3085478_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.8	3.0e-134
WP_150388427.1|3085470_3086082_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	84.1	2.8e-96
WP_150388428.1|3087211_3087565_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	67.2	2.6e-38
WP_150388429.1|3087536_3087881_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_150388430.1|3088551_3089130_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	80.8	3.5e-80
WP_150388431.1|3089194_3090382_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	83.0	2.9e-190
WP_023223221.1|3090394_3090913_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
WP_137366731.1|3090975_3091257_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
WP_000763326.1|3091289_3091409_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_150388432.1|3091401_3093831_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	71.4	2.4e-287
WP_150388433.1|3093842_3094307_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	74.2	1.3e-61
WP_103014990.1|3094309_3095503_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.1	2.3e-166
WP_023223216.1|3095542_3095761_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
WP_008785849.1|3096119_3096626_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3095916:3095964	attR	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_003024699.1|3096671_3098519_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_003828467.1|3098683_3100429_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
WP_001144069.1|3100666_3100882_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003024694.1|3101118_3102132_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
>prophage 4
NZ_CP044098	Citrobacter portucalensis strain FDAARGOS_617 chromosome, complete genome	4926736	3196528	3242543	4926736	plate,tRNA,protease,transposase	Ralstonia_phage(33.33%)	39	NA	NA
WP_032944969.1|3196528_3197860_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032944963.1|3197862_3198396_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032944962.1|3198392_3199682_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_032944960.1|3199706_3200795_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032944958.1|3200758_3202612_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032944956.1|3202616_3203033_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032944954.1|3203029_3204502_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032944951.1|3204784_3205288_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_032944948.1|3205915_3206434_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032944946.1|3206658_3208773_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.6	1.8e-25
WP_150388436.1|3213498_3214545_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_080685936.1|3214552_3214729_-	hypothetical protein	NA	U5P0U6	Shigella_phage	57.7	4.8e-09
WP_050592547.1|3215398_3215938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032944940.1|3215921_3216941_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032944935.1|3217689_3218826_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_050592546.1|3219568_3220933_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032944931.1|3221742_3222525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008785781.1|3223336_3224044_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_032945500.1|3224512_3226648_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_008785778.1|3226700_3227957_-	nucleoside permease	NA	NA	NA	NA	NA
WP_008785777.1|3228167_3229253_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
WP_003027126.1|3229339_3229609_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032945498.1|3229636_3230689_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003825406.1|3230849_3231569_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003027115.1|3231568_3231895_+	YggL family protein	NA	NA	NA	NA	NA
WP_003825409.1|3231944_3232664_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_003027108.1|3232852_3233899_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_003825412.1|3234013_3235150_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_003825414.1|3235142_3235736_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_003027101.1|3235743_3236034_-	YggU family protein	NA	NA	NA	NA	NA
WP_150388437.1|3236030_3236597_-	YggT family protein	NA	NA	NA	NA	NA
WP_032944928.1|3236615_3237320_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032944926.1|3237337_3238318_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_008785771.1|3238314_3238731_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_008785770.1|3238730_3239366_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_003027083.1|3239470_3240418_-	glutathione synthase	NA	NA	NA	NA	NA
WP_008785768.1|3240437_3241169_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_008785767.1|3241243_3241951_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_032944923.1|3242045_3242543_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP044098	Citrobacter portucalensis strain FDAARGOS_617 chromosome, complete genome	4926736	4135066	4224067	4926736	capsid,head,integrase,tRNA,protease,plate,terminase,portal,lysis,tail	Escherichia_phage(21.05%)	98	4188335:4188361	4219780:4219806
WP_032943978.1|4135066_4136014_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.3	1.7e-07
WP_003834464.1|4135997_4136729_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|4136709_4136817_-	protein YohO	NA	NA	NA	NA	NA
WP_032943977.1|4137076_4137808_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	3.6e-106
WP_003834458.1|4138033_4139719_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003840155.1|4139715_4140435_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003834454.1|4140481_4140952_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	77.4	1.8e-63
WP_032943976.1|4140995_4141454_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.9	3.2e-52
WP_032943974.1|4141659_4143693_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	8.9e-54
WP_003027343.1|4143857_4144967_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032943973.1|4145232_4145514_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_032943972.1|4145798_4146371_+	fimbrial protein	NA	NA	NA	NA	NA
WP_032943971.1|4146422_4147106_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_150388460.1|4147118_4149599_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_150388461.1|4149608_4150598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003834436.1|4150638_4150971_-	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
WP_032943967.1|4151332_4152121_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_032943966.1|4152117_4152918_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_032943965.1|4152960_4153707_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032943963.1|4153680_4154646_-	sugar kinase	NA	NA	NA	NA	NA
WP_032943962.1|4154642_4155647_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	27.7	5.4e-12
WP_008785233.1|4155643_4156921_-	MFS transporter	NA	NA	NA	NA	NA
WP_003834421.1|4157173_4158226_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_032943960.1|4158245_4159145_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	27.8	7.0e-11
WP_003027308.1|4159276_4160008_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003840185.1|4160269_4160938_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_003027301.1|4160937_4161654_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_003027298.1|4161660_4162392_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003027295.1|4162408_4163137_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.1e-27
WP_003834409.1|4163362_4163878_-	lipoprotein	NA	NA	NA	NA	NA
WP_020996661.1|4164398_4164611_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	75.7	5.4e-23
WP_071692589.1|4164621_4164810_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001160725.1|4165014_4165338_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032943958.1|4165334_4166165_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_003834312.1|4166265_4167279_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032944483.1|4167376_4168807_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032943957.1|4168817_4169819_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_032943955.1|4169974_4171693_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	1.2e-30
WP_003834302.1|4171845_4172280_+	DoxX family protein	NA	NA	NA	NA	NA
WP_032943954.1|4172354_4173968_-	FAD-NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_003027256.1|4174146_4175115_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_003834297.1|4175125_4176778_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_032943953.1|4176933_4177833_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_003840208.1|4178101_4178797_-	aquaporin Z	NA	NA	NA	NA	NA
WP_003834292.1|4179168_4180827_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_032943951.1|4180823_4181774_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_032943950.1|4181933_4183049_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_032943949.1|4183045_4184992_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	1.4e-40
WP_003036813.1|4185066_4185291_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|4185614_4185935_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|4185965_4188242_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
4188335:4188361	attL	CAGGCAAAAAATAAGCCTGCGTAAGGG	NA	NA	NA	NA
WP_049002085.1|4188445_4189453_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	86.3	1.8e-169
WP_019077188.1|4189549_4189849_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	76.8	4.5e-39
WP_150388462.1|4189973_4190249_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	86.4	4.4e-41
WP_150388463.1|4190430_4190931_+	replication protein B	NA	M1SV55	Escherichia_phage	84.9	3.3e-79
WP_048218201.1|4190994_4191219_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	66.2	1.0e-16
WP_047090182.1|4191218_4191518_+	DUF5405 family protein	NA	M1RZ07	Escherichia_phage	57.7	2.7e-20
WP_048218200.1|4191517_4191793_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	63.7	6.2e-27
WP_150388564.1|4191782_4194068_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	75.7	0.0e+00
WP_150388464.1|4194073_4194538_+	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	54.9	6.1e-43
WP_150388565.1|4194549_4194774_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	55.9	1.8e-13
WP_150388465.1|4194770_4195022_-	hypothetical protein	NA	A0A0M4R4Y4	Salmonella_phage	80.4	9.0e-17
WP_150388466.1|4195138_4196221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388467.1|4196284_4197298_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.0	8.9e-156
WP_150388468.1|4197299_4199069_-|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	84.6	7.9e-301
WP_150388469.1|4199235_4200090_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	72.2	5.5e-114
WP_046276223.1|4200151_4201219_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.6	2.5e-169
WP_150388470.1|4201222_4201978_+|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	72.2	5.4e-81
WP_046276225.1|4202077_4202584_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.6	1.2e-63
WP_048218635.1|4202583_4202787_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	85.1	2.7e-27
WP_016153631.1|4202777_4202999_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	79.2	2.9e-27
WP_127791799.1|4202982_4203495_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	91.2	2.4e-85
WP_150388471.1|4203491_4203923_+	lysA protein	NA	A0A218M4L6	Erwinia_phage	59.4	8.7e-44
WP_150388472.1|4203904_4204333_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	71.1	3.2e-46
WP_150388473.1|4204307_4204466_+|lysis	phage lysis protein	lysis	A0A218M4L1	Erwinia_phage	73.1	9.0e-15
WP_150388474.1|4204428_4204896_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	73.5	1.7e-61
WP_150388475.1|4204888_4205335_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	6.7e-47
WP_150388476.1|4205509_4206685_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_150388477.1|4206677_4207307_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_150388478.1|4207486_4208128_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	81.2	5.2e-93
WP_150388479.1|4208124_4208475_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	69.8	1.2e-38
WP_150388480.1|4208480_4209389_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	85.1	8.0e-140
WP_150388481.1|4209381_4209912_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	89.8	7.3e-93
WP_150388482.1|4209922_4211614_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	52.9	7.7e-120
WP_150388483.1|4211625_4212162_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	41.2	7.3e-32
WP_150388484.1|4212297_4213491_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.1	3.0e-187
WP_041327772.1|4213503_4214022_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	82.6	1.0e-78
WP_150388485.1|4214075_4214390_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	64.9	4.9e-28
WP_019077155.1|4214422_4214545_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	1.3e-13
WP_150388486.1|4214534_4216976_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.0	3.2e-300
WP_150388487.1|4216989_4217454_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	74.7	6.1e-59
WP_150388488.1|4217450_4218620_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	74.6	3.4e-159
WP_150388489.1|4218695_4218917_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	75.3	1.3e-27
WP_150388490.1|4219143_4219404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032943948.1|4219955_4221317_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	93.2	1.1e-204
4219780:4219806	attR	CAGGCAAAAAATAAGCCTGCGTAAGGG	NA	NA	NA	NA
WP_008785215.1|4221476_4221809_-	YegP family protein	NA	NA	NA	NA	NA
WP_032943946.1|4221944_4222667_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_032943945.1|4222663_4224067_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.9	6.6e-32
>prophage 6
NZ_CP044098	Citrobacter portucalensis strain FDAARGOS_617 chromosome, complete genome	4926736	4391268	4425347	4926736	capsid,head,integrase,protease,plate,terminase,portal,holin,tail	Shigella_phage(41.86%)	52	4391087:4391146	4427761:4427884
4391087:4391146	attL	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATGG	NA	NA	NA	NA
WP_150388510.1|4391268_4392279_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	82.4	2.2e-162
WP_103014252.1|4392278_4392506_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	88.0	3.9e-35
WP_150388511.1|4392539_4392755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150388512.1|4392751_4393759_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	44.1	1.1e-68
WP_150388566.1|4393805_4394219_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	64.2	1.9e-43
WP_103014255.1|4394789_4395017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388513.1|4395352_4395979_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	49.3	5.5e-47
WP_003826141.1|4396081_4396309_+	cell division protein	NA	NA	NA	NA	NA
WP_150388514.1|4396319_4396874_+	hypothetical protein	NA	U5P4K1	Shigella_phage	51.9	3.4e-48
WP_072052166.1|4397037_4397250_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.9	9.3e-15
WP_150388515.1|4397206_4398190_+	hypothetical protein	NA	S5FM81	Shigella_phage	69.3	6.8e-60
WP_150388516.1|4398192_4398636_+	hypothetical protein	NA	U5P0U0	Shigella_phage	31.7	6.3e-13
WP_150388517.1|4398635_4399295_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.7	1.2e-97
WP_150388518.1|4399291_4399510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032938613.1|4399509_4399899_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	88.1	1.6e-60
WP_150388519.1|4399915_4400641_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.5	2.0e-56
WP_150388520.1|4400637_4401627_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	72.3	1.3e-143
WP_150388521.1|4401641_4402220_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	4.3e-46
WP_000220228.1|4402325_4402922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061353905.1|4403012_4403399_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	91.4	1.4e-56
WP_000243809.1|4403385_4403667_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	47.1	9.1e-18
WP_001076630.1|4403821_4404448_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	73.9	1.0e-85
WP_150388522.1|4404455_4404725_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	69.0	2.2e-21
WP_150388523.1|4404681_4404888_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	76.8	2.5e-17
WP_150388524.1|4404865_4405096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388525.1|4405437_4405674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388526.1|4405750_4406101_+	HNH endonuclease	NA	S5FKR6	Shigella_phage	81.0	5.4e-52
WP_150388527.1|4406227_4406725_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.1	3.2e-82
WP_150388528.1|4406721_4408455_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	93.6	0.0e+00
WP_046671242.1|4408602_4409829_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	89.2	1.7e-217
WP_046671241.1|4409821_4410421_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	5.0e-90
WP_150388529.1|4410430_4411648_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	76.3	2.8e-172
WP_150388530.1|4411721_4412045_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	71.0	1.1e-38
WP_150388531.1|4412041_4412455_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	73.7	1.4e-51
WP_150388532.1|4412429_4412933_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	88.0	6.8e-80
WP_000761759.1|4412932_4413493_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	81.7	1.1e-86
WP_000497746.1|4413501_4413678_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	78.9	3.7e-17
WP_000218556.1|4413667_4415167_+|tail	tail sheath protein	tail	S5FKL0	Shigella_phage	85.6	2.3e-240
WP_001137307.1|4415166_4415523_+	hypothetical protein	NA	U5P076	Shigella_phage	89.0	1.5e-57
WP_005120659.1|4415522_4415792_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	79.8	1.9e-36
WP_072053674.1|4415758_4415941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388533.1|4415933_4417724_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	77.4	3.2e-233
WP_150388534.1|4417808_4418303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388535.1|4418357_4419659_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	71.5	1.8e-180
WP_150388536.1|4419655_4420735_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	81.3	1.7e-173
WP_150388537.1|4420734_4421283_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	77.9	3.1e-78
WP_150388538.1|4421282_4421708_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	83.0	4.0e-65
WP_000785285.1|4421694_4422753_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	78.6	3.9e-162
WP_150388539.1|4422743_4423325_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	77.2	2.2e-90
WP_001199197.1|4424235_4424568_+|tail	phage tail protein	tail	E7EKV7	Edwardsiella_phage	37.4	1.3e-07
WP_000497431.1|4424636_4424879_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	80.5	2.4e-30
WP_003826234.1|4424957_4425347_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	1.0e-51
4427761:4427884	attR	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATGGGAAAGAACAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 7
NZ_CP044098	Citrobacter portucalensis strain FDAARGOS_617 chromosome, complete genome	4926736	4744043	4752241	4926736	tRNA	uncultured_Caudovirales_phage(16.67%)	8	NA	NA
WP_032943572.1|4744043_4745153_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.9	1.2e-09
WP_032943570.1|4745307_4746291_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_032943568.1|4746762_4748136_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	9.6e-52
WP_032943567.1|4748214_4749150_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.5	9.8e-141
WP_032943565.1|4749782_4750025_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
WP_003833207.1|4750210_4750645_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	1.2e-29
WP_003833205.1|4750726_4750939_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_032943564.1|4751086_4752241_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.0	2.5e-114
