The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044101	Citrobacter werkmanii strain FDAARGOS_616 chromosome, complete genome	4932938	500572	507520	4932938		uncultured_Caudovirales_phage(83.33%)	10	NA	NA
WP_085049570.1|500572_500851_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	50.0	3.3e-12
WP_085049571.1|501397_502018_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_085049572.1|502168_502867_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_038636209.1|502952_503273_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.7	2.9e-20
WP_038636211.1|503317_504607_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	1.2e-168
WP_069325169.1|504619_505045_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	4.7e-50
WP_121529819.1|505148_505808_+	LysE family translocator	NA	NA	NA	NA	NA
WP_150344498.1|505871_506462_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_150344499.1|506710_507187_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_085951602.1|507346_507520_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	50.0	6.8e-08
>prophage 2
NZ_CP044101	Citrobacter werkmanii strain FDAARGOS_616 chromosome, complete genome	4932938	1909670	2002667	4932938	plate,tail,integrase,capsid,transposase,lysis,portal,terminase,tRNA,head	Salmonella_phage(59.32%)	100	1938210:1938233	1972883:1972906
WP_150344829.1|1909670_1910612_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.2	5.2e-65
WP_150344830.1|1910660_1911410_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_137347390.1|1911409_1912645_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_121528812.1|1912820_1913609_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_069323360.1|1913798_1914764_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_069323224.1|1914750_1916622_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	27.2	2.8e-14
WP_150344831.1|1916650_1918189_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_069323225.1|1918235_1919156_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_150344832.1|1919158_1920070_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_003831616.1|1920124_1921432_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_137347396.1|1921652_1921850_+	glycine cleavage system protein T	NA	NA	NA	NA	NA
WP_150344833.1|1921902_1924353_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	74.6	1.3e-22
WP_121528816.1|1924384_1925311_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038639191.1|1925531_1925915_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_150344834.1|1926017_1927115_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_121528818.1|1927120_1927747_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_032940149.1|1928076_1929279_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	1.7e-97
WP_085049174.1|1929327_1930086_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	29.8	7.4e-14
WP_038639201.1|1930149_1930758_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_150344835.1|1931054_1932287_+	MdfA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_085049175.1|1932314_1932596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087857578.1|1932704_1933520_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_150344836.1|1933519_1934728_-	MFS transporter	NA	NA	NA	NA	NA
WP_069323233.1|1934813_1935362_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150344837.1|1935367_1936282_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150344838.1|1936384_1937299_+	EamA family transporter	NA	NA	NA	NA	NA
WP_150344839.1|1937312_1938110_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
1938210:1938233	attL	AATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_048233327.1|1938307_1939360_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.9	2.3e-106
WP_048233329.1|1939442_1941140_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	68.0	1.9e-81
WP_150344840.1|1941160_1941757_-	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.0e-38
WP_004201303.1|1941852_1942074_+	regulator for prophage	NA	NA	NA	NA	NA
WP_048233334.1|1942106_1942616_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	87.6	1.7e-78
WP_000956168.1|1942623_1942824_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	100.0	3.2e-33
WP_000963480.1|1942787_1943129_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_150344841.1|1943196_1943430_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	97.4	6.4e-33
WP_048233339.1|1943429_1943657_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	89.3	2.8e-33
WP_048233341.1|1943653_1944508_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	87.7	1.2e-140
WP_048233343.1|1944504_1945503_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	55.7	6.4e-98
WP_150345571.1|1945520_1947899_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.1	0.0e+00
WP_001154444.1|1948057_1948246_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_019077494.1|1948257_1948491_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	90.9	1.1e-32
WP_150344842.1|1948564_1948825_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	60.3	1.5e-19
WP_087052927.1|1949073_1950465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150344843.1|1950492_1951524_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	91.2	1.9e-182
WP_150344844.1|1951523_1953290_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	95.1	0.0e+00
WP_001528599.1|1953432_1954266_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	94.2	2.7e-126
WP_079893545.1|1954282_1955347_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	1.9e-193
WP_079893544.1|1955350_1956001_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	1.1e-114
WP_063886531.1|1956094_1956559_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	97.4	7.1e-84
WP_000868184.1|1956558_1956762_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1956765_1956981_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_019077486.1|1956961_1957471_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.2e-93
WP_001528673.1|1957475_1957853_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	96.0	2.4e-58
WP_001528739.1|1957852_1958278_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.2	2.7e-66
WP_079894835.1|1958373_1958805_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	96.5	8.1e-74
WP_046669932.1|1958797_1959244_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	88.4	4.2e-65
WP_079894836.1|1959312_1959891_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	96.4	2.2e-106
WP_079894837.1|1959887_1960247_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	94.1	2.6e-57
WP_079894838.1|1960233_1961142_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	93.7	9.5e-149
WP_001397640.1|1961134_1961740_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	98.0	4.6e-115
WP_150344845.1|1961736_1963218_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	65.7	1.9e-175
WP_079893914.1|1963227_1963689_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	59.4	2.1e-43
WP_079893915.1|1963742_1964348_-|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	47.7	1.8e-47
WP_150344846.1|1964420_1964942_-|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	52.1	2.1e-31
WP_053264365.1|1965011_1965569_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.2	2.9e-84
WP_045334072.1|1965652_1966825_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.8	3.0e-211
WP_032266119.1|1966834_1967350_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	3.9e-91
WP_032266118.1|1967404_1967707_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	5.7e-42
WP_000763315.1|1967721_1967841_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_150344847.1|1967833_1970578_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	37.5	2.3e-121
WP_000980407.1|1970574_1971060_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	97.7	2.7e-65
WP_150344848.1|1971056_1972157_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	93.7	1.6e-187
WP_058842448.1|1972224_1972440_+	late control protein B	NA	Q53ZE7	Salmonella_virus	70.8	3.6e-22
WP_150344849.1|1972467_1972815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038639225.1|1973050_1974736_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
1972883:1972906	attR	AATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_061388467.1|1975005_1975386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016152408.1|1975420_1975684_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	5.0e-26
WP_085049182.1|1975859_1976150_+	YbjC family protein	NA	NA	NA	NA	NA
WP_150344850.1|1976133_1976856_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_038639233.1|1976913_1977816_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	8.2e-36
WP_038639236.1|1977906_1978383_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_038639239.1|1978816_1979929_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_069323238.1|1980067_1981201_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_069323239.1|1981210_1982164_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_038639247.1|1982160_1983006_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_038639250.1|1983065_1983554_+	YbjO family protein	NA	NA	NA	NA	NA
WP_150344851.1|1983738_1984866_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.7	1.6e-28
WP_032939929.1|1985610_1986288_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_150344852.1|1986304_1987165_-	pirin family protein	NA	NA	NA	NA	NA
WP_069323241.1|1987273_1988185_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211347.1|1988266_1988485_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_038639268.1|1988770_1989475_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_069323242.1|1989519_1991241_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	24.0	9.6e-17
WP_150344853.1|1991241_1993008_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	1.6e-22
WP_003831889.1|1993122_1994091_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_002439523.1|1994638_1995133_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_150344854.1|1995267_1999206_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.8e-88
WP_150344855.1|1999317_1999929_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_150344856.1|1999939_2001283_+	AAA family ATPase	NA	G3MBE0	Bacillus_virus	41.3	1.9e-81
WP_003035737.1|2001374_2002667_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	3.3e-94
>prophage 3
NZ_CP044101	Citrobacter werkmanii strain FDAARGOS_616 chromosome, complete genome	4932938	2372168	2382210	4932938	tRNA	Bodo_saltans_virus(14.29%)	10	NA	NA
WP_150344968.1|2372168_2373152_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	1.4e-33
WP_137347197.1|2373167_2375555_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003030571.1|2375559_2375859_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_042308812.1|2376014_2376995_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.1	6.7e-15
WP_038640185.1|2377055_2377607_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_038640187.1|2377606_2378356_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.6e-08
WP_038640189.1|2378433_2378898_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_038640192.1|2379216_2379930_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_150344969.1|2379991_2381434_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.1	2.4e-53
WP_137350530.1|2381430_2382210_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.6	1.0e-10
>prophage 4
NZ_CP044101	Citrobacter werkmanii strain FDAARGOS_616 chromosome, complete genome	4932938	3254823	3263938	4932938	tRNA,protease	Bacillus_phage(28.57%)	7	NA	NA
WP_085047912.1|3254823_3256227_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.9	2.7e-33
WP_038641831.1|3256223_3256946_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_150345189.1|3257111_3258473_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	93.2	4.8e-205
WP_038641840.1|3258741_3261018_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	4.8e-165
WP_006683877.1|3261048_3261369_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036813.1|3261692_3261917_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_150345190.1|3261991_3263938_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	4.8e-41
>prophage 5
NZ_CP044101	Citrobacter werkmanii strain FDAARGOS_616 chromosome, complete genome	4932938	3304658	3313079	4932938	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_150345203.1|3304658_3306692_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.2e-53
WP_038641935.1|3306898_3307357_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.6	1.3e-50
WP_087856170.1|3307401_3307872_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	78.2	1.3e-64
WP_038641937.1|3307918_3308638_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_150345204.1|3308634_3310320_-	GAF domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	91.8	1.3e-281
WP_042307362.1|3310545_3311277_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	92.5	4.0e-105
WP_003027354.1|3311328_3311436_+	protein YohO	NA	NA	NA	NA	NA
WP_085047889.1|3311416_3312148_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_085047888.1|3312131_3313079_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	1.2e-08
>prophage 1
NZ_CP044100	Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence	116365	21636	51149	116365	transposase,integrase	Salmonella_phage(22.22%)	34	35000:35017	40980:40997
WP_001138071.1|21636_24609_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.0	0.0e+00
WP_001162012.1|24611_25169_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_122973921.1|25206_25500_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000845048.1|25468_26482_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_003830721.1|26642_27158_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003830719.1|27351_27684_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003155741.1|27888_28512_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	3.7e-35
WP_003830790.1|28573_29791_-	TniQ family protein	NA	NA	NA	NA	NA
WP_003830789.1|29787_30696_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003830788.1|30698_32378_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	25.7	2.2e-05
WP_003830786.1|32685_34197_+	MFS transporter	NA	NA	NA	NA	NA
WP_003830785.1|34207_34774_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
35000:35017	attL	TGTCGTTTTCAGAAGACG	NA	NA	NA	NA
WP_003830784.1|35352_36195_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003830783.1|36312_36846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077203601.1|37317_37848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003830781.1|37699_37963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003465017.1|38146_39031_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003830779.1|39126_40854_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	25.3	2.8e-08
WP_000993245.1|41034_41247_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
40980:40997	attR	CGTCTTCTGAAAACGACA	NA	NA	NA	NA
WP_001446012.1|41209_41329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|41312_41549_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|41545_41911_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|41928_43614_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|43652_44078_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|44105_44381_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294654.1|44396_44777_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|44848_45304_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000110156.1|45401_46379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135406.1|46452_46941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247114.1|47195_48311_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003830765.1|48303_49167_+	hypothetical protein	NA	K7RFY5	Vibrio_phage	35.4	1.1e-26
WP_000429587.1|49219_49615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176304.1|49611_50223_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728912.1|50219_51149_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.8	1.9e-75
>prophage 2
NZ_CP044100	Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence	116365	70680	85573	116365		Bacillus_phage(16.67%)	17	NA	NA
WP_000697973.1|70680_71361_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.5	1.9e-32
WP_001230590.1|71353_72832_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	1.8e-27
WP_000725002.1|73068_73500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695683.1|73648_73999_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	2.4e-20
WP_003830762.1|74170_75997_-	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
WP_000817638.1|76604_77810_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_000756331.1|77806_78778_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	9.6e-115
WP_000457553.1|78923_80195_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.2	2.7e-157
WP_000600201.1|80194_80617_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_000334635.1|80796_81468_-	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
WP_000085947.1|81819_82497_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_001104877.1|82496_82718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274510.1|82728_83148_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_003830760.1|83201_83981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108571.1|84385_84892_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.8	3.7e-09
WP_000761848.1|84934_85126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001667048.1|85312_85573_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	47.5	5.3e-12
