The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	0	37134	2848032	holin,tail,capsid,head,portal,protease,terminase,plate	Staphylococcus_phage(87.23%)	47	NA	NA
WP_001164629.1|1681_1867_+	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
WP_000113974.1|1866_2268_+	PVL family protein	NA	A0A2I6PEL5	Staphylococcus_phage	100.0	1.2e-68
WP_000022728.1|2267_2525_+	DUF3310 domain-containing protein	NA	A0A2I6PEN5	Staphylococcus_phage	100.0	2.6e-43
WP_031837453.1|2527_2728_+	hypothetical protein	NA	C5I650	Staphylococcus_phage	97.0	1.3e-29
WP_150344353.1|2742_2985_+	hypothetical protein	NA	A0A2I6PDB4	Staphylococcus_phage	96.2	1.8e-38
WP_150344354.1|3025_3403_+	hypothetical protein	NA	A0A2I6PDC0	Staphylococcus_phage	100.0	1.5e-68
WP_000983954.1|3399_3594_+	hypothetical protein	NA	A0A2I6PE33	Staphylococcus_phage	100.0	2.5e-27
WP_000982708.1|3590_4040_+	hypothetical protein	NA	A0A2I6PDH2	Staphylococcus_phage	100.0	9.3e-81
WP_150344355.1|4036_4321_+	hypothetical protein	NA	E9LT36	Staphylococcus_phage	98.9	1.0e-45
WP_061823638.1|4313_4565_+	DUF1024 family protein	NA	Q4ZBT3	Staphylococcus_virus	96.4	9.2e-38
WP_072473165.1|4904_5432_+	dUTPase	NA	B2ZYX2	Staphylococcus_phage	97.7	8.6e-94
WP_150344356.1|5468_5714_+	hypothetical protein	NA	A0A0H4ITX2	Staphylococcus_phage	98.8	7.6e-37
WP_000195791.1|5710_5917_+	DUF1381 domain-containing protein	NA	A0A0H4IPW6	Staphylococcus_phage	100.0	4.5e-30
WP_000595263.1|5913_6066_+	transcriptional activator RinB	NA	A0A2I6PEM5	Staphylococcus_phage	100.0	2.0e-19
WP_000265258.1|6133_6334_+	DUF1514 family protein	NA	A0A2I6PF41	Staphylococcus_phage	100.0	2.9e-26
WP_150344357.1|6385_8833_+	hypothetical protein	NA	Q4ZCG0	Staphylococcus_virus	98.9	0.0e+00
WP_031764095.1|8935_9031_-	hypothetical protein	NA	Q4ZCF8	Staphylococcus_virus	100.0	3.6e-11
WP_001794602.1|9173_9464_+	VRR-NUC domain-containing protein	NA	M1T308	Staphylococcus_phage	100.0	4.9e-51
WP_150344358.1|9444_10812_+	DEAD/DEAH box helicase family protein	NA	Q4ZCM9	Staphylococcus_virus	99.6	5.1e-263
WP_000513699.1|10824_11262_+	transcriptional regulator	NA	A0A2I6PDC2	Staphylococcus_phage	100.0	4.6e-77
WP_000160689.1|11418_11733_+	HNH endonuclease	NA	A0A2I6PDC4	Staphylococcus_phage	100.0	2.5e-56
WP_000778932.1|11861_12167_+|terminase	terminase	terminase	A0A2I6PE27	Staphylococcus_phage	100.0	2.9e-49
WP_150344359.1|12156_13848_+|terminase	terminase large subunit	terminase	A0A2I6PE44	Staphylococcus_phage	99.8	0.0e+00
WP_001100669.1|13852_15091_+|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	100.0	6.9e-235
WP_000061872.1|15074_15848_+|protease	Clp protease ClpP	protease	M1TAZ4	Staphylococcus_phage	100.0	9.2e-137
WP_001142739.1|15859_17023_+|capsid	phage major capsid protein	capsid	A0A2I6PDD7	Staphylococcus_phage	100.0	9.4e-218
WP_000050973.1|17091_17370_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_000395501.1|17381_17714_+	hypothetical protein	NA	A0A2I6PDD6	Staphylococcus_phage	100.0	6.2e-58
WP_000110020.1|17710_18112_+	hypothetical protein	NA	A0A2I6PDD3	Staphylococcus_phage	100.0	6.2e-68
WP_001023802.1|18112_18508_+	DUF3168 domain-containing protein	NA	A0A2I6PDD8	Staphylococcus_phage	100.0	2.6e-66
WP_000807536.1|18542_19184_+|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
WP_000169128.1|19275_19731_+	Ig domain-containing protein	NA	A0A2I6PF45	Staphylococcus_phage	100.0	1.3e-77
WP_000589165.1|19788_20139_+	hypothetical protein	NA	A0A2I6PDE6	Staphylococcus_phage	100.0	1.1e-55
WP_000438833.1|20180_20339_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_150344360.1|20352_26553_+|tail	phage tail tape measure protein	tail	A0A1X9IGU9	Staphylococcus_phage	99.7	0.0e+00
WP_001190534.1|26552_27377_+|tail	phage tail family protein	tail	I1W5Y8	Staphylococcus_phage	100.0	7.0e-159
WP_000384474.1|27385_28969_+	peptidase	NA	A0A2I6PEQ5	Staphylococcus_phage	100.0	9.3e-309
WP_031786856.1|28968_29259_+	hypothetical protein	NA	U5U457	Staphylococcus_phage	99.0	6.0e-49
WP_000429558.1|29274_31185_+	minor structural protein	NA	A0A2I6PEQ9	Staphylococcus_phage	100.0	0.0e+00
WP_086031893.1|31184_32651_+|plate	BppU family phage baseplate upper protein	plate	A0A2I6PES7	Staphylococcus_phage	99.8	7.6e-273
WP_001166599.1|32650_33040_+	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000916020.1|33032_33197_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_000466784.1|33242_33542_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000339146.1|33677_33980_+|holin	phage holin	holin	A0A2I6PET6	Staphylococcus_phage	100.0	7.0e-48
WP_000930258.1|33991_35446_+	CHAP domain-containing protein	NA	A0A0N6WMR3	Staphylococcus_phage	100.0	3.0e-290
WP_000971220.1|36418_36874_+	hypothetical protein	NA	B7T0L3	Staphylococcus_virus	100.0	2.7e-72
WP_150344361.1|36945_37134_+	hypothetical protein	NA	Q4ZCJ7	Staphylococcus_virus	98.0	6.3e-23
>prophage 2
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	41917	43480	2848032		Vibrio_phage(100.0%)	1	NA	NA
WP_064128937.1|41917_43480_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	9.3e-19
>prophage 3
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	53684	54653	2848032		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989086.1|53684_54653_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	29.1	1.0e-15
>prophage 4
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	70780	71689	2848032		Klosneuvirus(100.0%)	1	NA	NA
WP_000167867.1|70780_71689_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 5
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	88977	91797	2848032		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_000334462.1|88977_90783_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A0A1J0F994	Only_Syngen_Nebraska_virus	38.9	3.4e-97
WP_000908190.1|91014_91797_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.3e-08
>prophage 6
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	104399	108231	2848032		Clostridium_phage(50.0%)	4	NA	NA
WP_000070865.1|104399_104843_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|104963_105674_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083340.1|105987_106650_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242304.1|106929_108231_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	6.1e-133
>prophage 7
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	116168	117779	2848032		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159964.1|116168_117779_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.1e-146
>prophage 8
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	125582	133332	2848032		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|125582_126182_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460244.1|126182_127259_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248731.1|127245_128082_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_078065152.1|128114_129212_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.3	6.7e-40
WP_000697334.1|129208_129628_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654180.1|129734_130259_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|130285_131524_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|131551_132181_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723421.1|132204_133332_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
>prophage 9
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	144120	146705	2848032	transposase	Escherichia_phage(33.33%)	3	NA	NA
WP_000777467.1|144120_145413_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
WP_001066124.1|145405_146167_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
WP_000932694.1|146309_146705_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 10
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	152879	153527	2848032		Moumouvirus(100.0%)	1	NA	NA
WP_001187610.1|152879_153527_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 11
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	160727	162248	2848032		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|160727_162248_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 12
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	167919	169947	2848032		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546592.1|167919_169947_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.4	1.7e-25
>prophage 13
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	175097	178481	2848032		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|175097_175460_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|175808_176810_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|176928_177255_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190825.1|177256_177736_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041107.1|177710_178481_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 14
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	192595	197319	2848032		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094585.1|192595_194125_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	7.2e-08
WP_000214552.1|194154_195159_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|195295_195550_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047819.1|195549_197319_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	7.0e-63
>prophage 15
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	201079	213670	2848032	tRNA	Moraxella_phage(20.0%)	10	NA	NA
WP_000159046.1|201079_202105_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	4.0e-63
WP_000106314.1|202413_204024_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.0	1.1e-19
WP_001791590.1|204704_204833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602050.1|204977_206906_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.4	4.2e-53
WP_001283612.1|207158_207794_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_078065178.1|208149_209178_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581077.1|209237_209462_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052274.1|209653_210904_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.7	3.1e-41
WP_000790321.1|211086_212037_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141422.1|212185_213670_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	2.3e-19
>prophage 16
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	222831	224808	2848032		uncultured_virus(100.0%)	2	NA	NA
WP_000917289.1|222831_223116_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240656.1|223191_224808_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	4.4e-157
>prophage 17
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	228755	232334	2848032		Staphylococcus_phage(100.0%)	3	NA	NA
WP_000791403.1|228755_229811_+	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.1e-35
WP_000595398.1|229832_230849_+	bi-component leukocidin LukGH subunit G	NA	A0A2I6PER8	Staphylococcus_phage	28.4	6.7e-26
WP_000239607.1|231341_232334_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	99.6	2.4e-161
>prophage 18
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	237658	240105	2848032		Staphylococcus_phage(100.0%)	3	NA	NA
WP_000991298.1|237658_238555_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645729.1|238555_239236_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763046.1|239232_240105_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
>prophage 19
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	245352	245754	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|245352_245754_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 20
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	249951	251981	2848032		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|249951_250512_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275716.1|250883_251981_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	1.5e-47
>prophage 21
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	256010	258294	2848032		Bacillus_virus(100.0%)	2	NA	NA
WP_000284433.1|256010_257480_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	3.5e-108
WP_000040873.1|257472_258294_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	1.8e-69
>prophage 22
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	261997	268764	2848032		Gordonia_phage(33.33%)	5	NA	NA
WP_000572876.1|261997_263293_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|263401_263704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272066.1|263875_264568_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|264564_266757_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774570.1|266760_268764_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	36.1	5.0e-110
>prophage 23
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	275937	280965	2848032		Catovirus(33.33%)	5	NA	NA
WP_001231458.1|275937_276885_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_001147864.1|276965_278327_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.8	6.3e-104
WP_000548782.1|278496_279027_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140176.1|279273_280344_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|280410_280965_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 24
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	284418	284832	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_025174552.1|284418_284832_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	40.6	2.3e-17
>prophage 25
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	289886	290516	2848032		Bacillus_phage(100.0%)	1	NA	NA
WP_000153526.1|289886_290516_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.7	2.1e-06
>prophage 26
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	305996	307733	2848032		Bacillus_phage(100.0%)	1	NA	NA
WP_150344365.1|305996_307733_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.2	1.7e-53
>prophage 27
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	324194	324923	2848032		Planktothrix_phage(100.0%)	1	NA	NA
WP_001144055.1|324194_324923_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 28
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	335647	335992	2848032		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|335647_335992_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 29
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	345625	346366	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|345625_346366_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 30
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	354756	365459	2848032	transposase	Staphylococcus_phage(66.67%)	12	NA	NA
WP_000277723.1|354756_356403_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
WP_000206347.1|357144_357933_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	95.4	7.0e-140
WP_000777467.1|358326_359619_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
WP_001066124.1|359611_360373_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
WP_020444758.1|360551_361010_+	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
WP_000727649.1|361104_361554_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|362238_362589_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|362641_362902_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_001795394.1|362880_363189_-	hypothetical protein	NA	M9NTD8	Staphylococcus_phage	100.0	2.1e-39
WP_000669789.1|363212_363392_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_049280116.1|363808_364354_+	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	32.5	1.8e-09
WP_001044434.1|364604_365459_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	37.9	6.4e-06
>prophage 31
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	371013	410061	2848032	protease,tRNA	Staphylococcus_phage(94.29%)	44	NA	NA
WP_000414219.1|371013_371586_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_000627534.1|371686_372028_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	93.8	2.8e-53
WP_000669039.1|372068_372695_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.6	5.8e-81
WP_000070638.1|372770_373766_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	92.7	1.7e-66
WP_001838615.1|373846_374497_-	hypothetical protein	NA	A0A2H4PQM8	Staphylococcus_phage	68.5	4.7e-33
WP_078065177.1|374799_375255_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	97.9	4.0e-79
WP_000348384.1|375414_376893_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	96.7	3.4e-281
WP_000778517.1|376897_377899_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.6	4.1e-185
WP_000718107.1|377895_378153_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672009.1|378218_378692_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	3.6e-83
WP_078065176.1|378696_379443_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.0	7.8e-141
WP_150344367.1|379736_381329_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.6	0.0e+00
WP_000933822.1|381700_382894_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
WP_000366163.1|383018_383927_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000453310.1|384138_384972_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	1.3e-157
WP_000623471.1|385221_385575_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	99.1	1.0e-21
WP_001200550.1|385571_385937_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	98.3	6.2e-59
WP_000091445.1|386192_386495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096492.1|386752_387466_+	transaldolase	NA	M1PR54	Cyanophage	34.5	1.2e-18
WP_000492902.1|387934_388555_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_025175276.1|388721_389357_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_001030470.1|389654_390098_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
WP_001153740.1|390084_390528_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671047.1|390640_391111_-	RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	97.4	4.4e-81
WP_000384171.1|391309_391534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032836.1|391809_392664_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.1	4.9e-38
WP_000163243.1|393068_393461_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	98.5	1.3e-70
WP_000989100.1|393478_394771_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	97.4	2.2e-223
WP_000221186.1|394770_395085_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	95.2	1.4e-51
WP_001261664.1|395606_397109_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.1e-29
WP_000384177.1|397601_398633_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.5	9.0e-196
WP_000493883.1|398639_399272_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	2.4e-111
WP_001159028.1|399282_400464_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	99.2	1.6e-225
WP_001008551.1|400476_400941_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	99.4	5.8e-70
WP_001196343.1|401062_402064_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	98.8	1.7e-183
WP_071665630.1|401972_402164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014937042.1|402175_402295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266100.1|402297_403125_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|403696_404098_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764430.1|404217_404781_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	98.4	3.5e-101
WP_000526539.1|404777_405731_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025062.1|405840_407022_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.5	1.2e-217
WP_001108730.1|407313_409728_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
WP_000836467.1|409749_410061_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	98.1	5.3e-51
>prophage 32
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	417068	418337	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000285005.1|417068_418337_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	98.2	1.0e-55
>prophage 33
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	429859	435187	2848032		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091379.1|429859_430717_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	98.5	4.4e-71
WP_001048371.1|430745_431342_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118320.1|431362_435187_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 34
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	443770	445477	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862098.1|443770_445477_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.6	8.0e-274
>prophage 35
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	452092	454723	2848032	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186041.1|452092_453355_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	4.6e-85
WP_001279341.1|453448_454723_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 36
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	460488	464624	2848032		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808837.1|460488_462093_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291428.1|462079_463240_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553932.1|463354_463801_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174273.1|463880_464624_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	6.4e-18
>prophage 37
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	482390	485588	2848032		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226897.1|482390_485588_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.6	6.5e-136
>prophage 38
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	490521	492279	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232650.1|490521_492279_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 39
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	497161	505324	2848032		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080026.1|497161_497866_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_078065174.1|497865_499527_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849430.1|500025_501513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038293.1|501805_504436_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114460.1|504451_505324_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	1.1e-42
>prophage 40
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	509238	520392	2848032	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|509238_510159_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_031844955.1|510251_510374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|510570_512508_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049297.1|512934_514428_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|514655_515183_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|515211_515412_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|515458_515815_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|515958_516567_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_001280027.1|516585_517515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|517519_517630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127572.1|517677_518979_+	trigger factor	NA	NA	NA	NA	NA
WP_000472293.1|519129_520392_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
>prophage 41
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	529962	532593	2848032	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425344.1|529962_532593_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
>prophage 42
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	542927	578475	2848032	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|542927_543932_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019166.1|543933_544959_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|544981_546121_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|546139_546400_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749798.1|546674_548954_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_031845040.1|549156_551430_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.5	2.1e-64
WP_000364543.1|551451_551970_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.8	2.1e-28
WP_001058593.1|552396_554586_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869979.1|554597_555050_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717806.1|555046_555922_+	SH3 domain-containing protein	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590822.1|556382_557645_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044807.1|557660_559427_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	33.1	4.1e-15
WP_031845039.1|559759_559888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|559887_560661_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102738.1|560822_562097_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	1.8e-105
WP_000704122.1|562181_562604_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|562703_562886_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|562925_563072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985896.1|563308_564322_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409170.1|564633_565776_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	1.1e-32
WP_000066097.1|565776_566895_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567020.1|567524_568193_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150344371.1|568194_570672_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.3	3.2e-66
WP_000734092.1|571014_573645_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.2	1.2e-63
WP_000426912.1|573707_573968_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939061.1|573971_574400_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_150344372.1|574414_574723_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342260.1|575007_575646_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|575648_576572_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|576583_577852_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|577851_578475_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 43
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	585145	588618	2848032	transposase	Lactococcus_phage(100.0%)	2	NA	NA
WP_000542305.1|585145_586366_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.3	8.5e-52
WP_000093395.1|588132_588618_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	1.1e-18
>prophage 44
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	595952	602116	2848032		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|595952_596414_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_078090923.1|596472_598620_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.2e-32
WP_001282570.1|598676_599651_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|599695_599947_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|600292_602116_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 45
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	605793	608901	2848032		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|605793_607626_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119021.1|607761_608901_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 46
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	615371	616319	2848032		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|615371_616319_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 47
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	619373	633101	2848032	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|619373_620765_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001794939.1|621099_621723_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|621733_622552_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217251.1|622612_624412_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
WP_001283055.1|624635_625742_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_150344373.1|625872_626550_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683914.1|626552_627653_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	1.0e-08
WP_001062177.1|627766_629113_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924210.1|629122_630013_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	3.4e-26
WP_001213910.1|630138_630924_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	6.1e-19
WP_000564316.1|630965_631829_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|631815_632226_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_150344374.1|632501_633101_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.2	1.6e-59
>prophage 48
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	639274	639898	2848032		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|639274_639898_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 49
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	645442	648254	2848032		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019687.1|645442_646789_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.7	6.3e-64
WP_000202177.1|646781_648254_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 50
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	655752	662323	2848032		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|655752_657090_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|657082_657313_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183374.1|657290_658172_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	26.1	8.9e-11
WP_001124985.1|658603_659056_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942203.1|659071_660751_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291540.1|660901_662323_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	6.6e-40
>prophage 51
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	669152	670559	2848032		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|669152_670559_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 52
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	675205	676690	2848032		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|675205_676690_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 53
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	682354	691833	2848032		Brevibacillus_phage(25.0%)	9	NA	NA
WP_000447733.1|682354_683242_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183423.1|683319_683826_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273370.1|683917_684649_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_000368658.1|684641_685184_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159570.1|685176_685914_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|686046_686772_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987767.1|686752_688504_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	2.6e-22
WP_001824281.1|688750_689659_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_021758259.1|689670_691833_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	92.0	5.5e-102
>prophage 54
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	694884	697563	2848032		Bacillus_phage(50.0%)	3	NA	NA
WP_001151997.1|694884_695133_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163813.1|695240_696194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902114.1|696183_697563_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.6	2.2e-56
>prophage 55
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	706981	712450	2848032		Bacillus_phage(25.0%)	7	NA	NA
WP_001043863.1|706981_707254_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|707684_708257_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774684.1|708259_708985_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_078062714.1|709001_709946_+	heptaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442477.1|710037_710487_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_000789522.1|710696_710897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269940.1|711283_712450_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	2.6e-34
>prophage 56
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	716112	716688	2848032		Bacillus_virus(100.0%)	1	NA	NA
WP_000005216.1|716112_716688_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.7e-08
>prophage 57
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	720074	854731	2848032	tRNA,holin,tail,capsid,head,portal,protease,integrase,terminase,lysis	Staphylococcus_phage(81.82%)	119	759678:759702	805074:805098
WP_000361537.1|720074_721277_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	5.4e-35
WP_000049916.1|721263_722235_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525073.1|722258_724952_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858789.1|725273_726566_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.9e-54
WP_000362218.1|726894_727581_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	1.2e-07
WP_000253769.1|727570_728230_+	endonuclease III	NA	NA	NA	NA	NA
WP_000182018.1|728234_728576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000138347.1|729092_731276_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_001108885.1|731272_731899_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
WP_001789942.1|731879_732005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001788819.1|732204_732384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000801.1|732438_732789_+	YppE family protein	NA	NA	NA	NA	NA
WP_000241301.1|732781_733345_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_001286320.1|733358_733703_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_000487150.1|734354_735500_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_000516799.1|735583_735916_+	DUF4889 domain-containing protein	NA	NA	NA	NA	NA
WP_000798998.1|736124_737462_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_000608498.1|737765_741206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133012.1|741225_742104_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.8e-19
WP_000959419.1|742578_743697_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_000210828.1|743791_744832_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_150344375.1|744862_746185_+	amino acid permease	NA	NA	NA	NA	NA
WP_000414687.1|746340_747732_+	multidrug efflux MFS transporter NorB	NA	NA	NA	NA	NA
759678:759702	attL	CGAAAGATGCATTGAATGGTGATGC	NA	NA	NA	NA
WP_000857185.1|761648_762686_-|integrase	site-specific integrase	integrase	Q38086	Staphylococcus_phage	100.0	4.5e-179
WP_000391618.1|762858_763398_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	33.1	9.0e-14
WP_000705238.1|763537_763705_-	hypothetical protein	NA	Q4ZDJ4	Staphylococcus_virus	100.0	1.7e-24
WP_001089804.1|763904_764090_-	hypothetical protein	NA	A0A2I6PDS4	Staphylococcus_phage	100.0	2.3e-25
WP_000094092.1|764243_764951_-	helix-turn-helix transcriptional regulator	NA	G4KNM8	Staphylococcus_phage	99.6	1.0e-129
WP_000548578.1|765121_765361_+	helix-turn-helix transcriptional regulator	NA	G4KNM9	Staphylococcus_phage	100.0	2.3e-38
WP_000435341.1|765373_765634_+	transcriptional regulator	NA	A7TW91	Staphylococcus_phage	100.0	2.7e-40
WP_000351243.1|765657_766197_-	hypothetical protein	NA	A7TW92	Staphylococcus_phage	100.0	1.7e-97
WP_001148618.1|766253_767006_+	oxidoreductase	NA	A0A1X9H0A0	Staphylococcus_phage	100.0	8.7e-140
WP_000388066.1|767022_767217_+	hypothetical protein	NA	A0A1X9H0A2	Staphylococcus_phage	100.0	1.5e-19
WP_000939496.1|767247_767388_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_000275058.1|767402_768035_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_001120197.1|768093_768414_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000066020.1|768410_768572_+	DUF1270 domain-containing protein	NA	A0A2I6PDF7	Staphylococcus_phage	100.0	1.9e-20
WP_000291489.1|768664_768925_+	DUF1108 family protein	NA	A0A1W6JQ03	Staphylococcus_phage	100.0	7.6e-43
WP_001205732.1|768933_769197_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700562.1|769205_771149_+	AAA family ATPase	NA	A0A2I6PDH3	Staphylococcus_phage	99.2	0.0e+00
WP_031764964.1|771150_772071_+	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	99.7	3.0e-166
WP_078090917.1|772151_772760_+	MBL fold metallo-hydrolase	NA	A0A1W6JPL3	Staphylococcus_phage	96.9	5.1e-82
WP_000610649.1|772760_773231_+	single-stranded DNA-binding protein	NA	S4V682	Staphylococcus_phage	96.2	3.1e-79
WP_000148302.1|773260_774145_+	DnaD domain protein	NA	S4V6D4	Staphylococcus_phage	96.6	3.1e-136
WP_000338528.1|774151_774370_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401963.1|774378_774783_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0E3XBN4	Staphylococcus_phage	98.5	1.0e-70
WP_000101275.1|774795_775164_+	hypothetical protein	NA	I1W656	Staphylococcus_phage	100.0	6.3e-51
WP_000131381.1|775167_775410_+	hypothetical protein	NA	A0A1P8L6E3	Staphylococcus_phage	100.0	3.0e-41
WP_001065046.1|775424_775676_+	DUF1024 family protein	NA	G4KNP4	Staphylococcus_phage	96.4	4.1e-38
WP_001061844.1|776298_776832_+	hypothetical protein	NA	A0A0H3U2Z8	Staphylococcus_phage	98.9	5.1e-94
WP_000195810.1|776868_777075_+	DUF1381 domain-containing protein	NA	S4V684	Staphylococcus_phage	100.0	7.6e-30
WP_000595267.1|777071_777221_+	hypothetical protein	NA	R9QSU6	Staphylococcus_phage	100.0	1.8e-17
WP_000265041.1|778028_778229_+	DUF1514 family protein	NA	R9QT57	Staphylococcus_phage	100.0	1.1e-28
WP_000590126.1|778256_778673_+	hypothetical protein	NA	A0A1X9H0U8	Staphylococcus_phage	100.0	2.9e-76
WP_000988336.1|778904_779204_+	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
WP_000402904.1|779334_779679_+	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
WP_000625088.1|779675_781337_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|781352_782540_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000861914.1|782523_783261_+|protease	Clp protease ClpP	protease	C8CH20	Staphylococcus_phage	100.0	2.3e-129
WP_000154555.1|783284_784430_+|capsid	phage major capsid protein	capsid	A0A1X9H072	Staphylococcus_phage	100.0	5.6e-215
WP_000238236.1|784449_784734_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|784723_785008_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|784991_785354_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114225.1|785350_785755_+	hypothetical protein	NA	A0A2I6PDJ6	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|785751_786159_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268741.1|786159_786804_+|tail	phage tail protein	tail	W5R9H4	Staphylococcus_phage	100.0	6.5e-120
WP_072050172.1|786845_787070_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	98.6	8.8e-32
WP_001096355.1|787119_787470_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_000504552.1|787714_792226_+|tail	phage tail tape measure protein	tail	A0A1X9H084	Staphylococcus_phage	90.8	0.0e+00
WP_000567408.1|792222_793707_+|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
WP_000582158.1|793722_797508_+	hypothetical protein	NA	A0A1X9H0H3	Staphylococcus_phage	98.4	0.0e+00
WP_001153681.1|797497_797650_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040261.1|797696_797984_+	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
WP_000539688.1|798041_798338_+	DUF2951 domain-containing protein	NA	D2JLG2	Staphylococcus_phage	100.0	2.9e-46
WP_011447039.1|798487_798664_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|798716_798824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|798875_799130_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|799141_799897_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000919350.1|800087_800579_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
WP_020444758.1|801105_801564_+	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
WP_000727651.1|801658_802108_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	99.3	2.1e-77
WP_000702262.1|802787_803138_+	complement inhibitor SCIN-A	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|803190_803451_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_001795394.1|803429_803738_-	hypothetical protein	NA	M9NTD8	Staphylococcus_phage	100.0	2.1e-39
WP_000669789.1|803761_803941_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_001062933.1|822779_823181_-	ribonuclease HI family protein	NA	NA	NA	NA	NA
805074:805098	attR	CGAAAGATGCATTGAATGGTGATGC	NA	NA	NA	NA
WP_000282171.1|823422_824127_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_014533106.1|824344_824566_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001165814.1|824577_824829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404627.1|824866_825991_+	virulence factor	NA	NA	NA	NA	NA
WP_000995285.1|826006_826444_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|826867_827824_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|828023_828503_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166052.1|828517_829357_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	3.0e-48
WP_000159902.1|829450_829984_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913315.1|829976_830405_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473654.1|830416_830917_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|830916_831138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342123.1|831329_832820_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.5	8.6e-22
WP_000620194.1|833219_833729_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000160908.1|833740_834811_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_000084773.1|834827_835442_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000166795.1|837240_838596_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	25.0	8.9e-10
WP_000180678.1|838884_841683_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_001115459.1|841696_842965_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_000334509.1|843544_844354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902174.1|844382_844586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185421.1|844766_845558_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
WP_001283670.1|845571_847458_+	nitric oxide reductase activation protein NorD	NA	NA	NA	NA	NA
WP_001039275.1|847682_849026_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_000138424.1|849099_850236_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001788788.1|850267_850897_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|850915_851185_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|851343_851652_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_001791186.1|851599_851788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000809131.1|851822_852023_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876210.1|852219_852621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558406.1|852754_853372_+|protease	protease	protease	NA	NA	NA	NA
WP_000216951.1|853465_854731_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	22.7	3.1e-12
>prophage 58
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	862576	864178	2848032		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|862576_864178_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 59
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	868604	872060	2848032		Indivirus(50.0%)	3	NA	NA
WP_000079452.1|868604_869456_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
WP_000974847.1|869462_870104_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077558.1|870245_872060_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	46.8	5.7e-153
>prophage 60
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	875474	876176	2848032		Tupanvirus(100.0%)	1	NA	NA
WP_000571245.1|875474_876176_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	28.3	5.8e-13
>prophage 61
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	884476	886047	2848032		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000173835.1|884476_885475_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.9	1.1e-33
WP_000604804.1|885480_886047_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	31.3	3.8e-23
>prophage 62
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	890365	891628	2848032		Bacillus_phage(100.0%)	1	NA	NA
WP_000283026.1|890365_891628_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.6	2.6e-96
>prophage 63
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	901274	905668	2848032		Bacillus_phage(50.0%)	2	NA	NA
WP_031901612.1|901274_903677_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.4	3.9e-93
WP_033848152.1|903676_905668_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.4	4.0e-115
>prophage 64
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	911445	913092	2848032		Vibrio_phage(100.0%)	1	NA	NA
WP_001088978.1|911445_913092_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 65
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	916761	917883	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691293.1|916761_917883_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	3.3e-10
>prophage 66
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	922033	927689	2848032		Phage_Wrath(25.0%)	7	NA	NA
WP_150344377.1|922033_922657_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380725.1|923036_923900_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	2.4e-16
WP_001791425.1|923973_924078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688126.1|924074_925052_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	100.0	2.1e-186
WP_001085655.1|925208_925478_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|925931_926081_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000078506.1|926171_927689_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	1.8e-91
>prophage 67
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	937860	938394	2848032		Bacillus_phage(100.0%)	1	NA	NA
WP_000841351.1|937860_938394_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
>prophage 68
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	943816	951755	2848032	transposase,head	Staphylococcus_phage(66.67%)	14	NA	NA
WP_078237844.1|943816_944485_-|head	phage head morphogenesis protein	head	Q4ZE35	Staphylococcus_virus	68.7	3.2e-29
WP_025174548.1|944687_944957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000440735.1|945002_945281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031786973.1|945247_945376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000780597.1|945436_945631_-	hypothetical protein	NA	A0A1J0MG79	Staphylococcus_phage	71.4	2.8e-18
WP_001813273.1|945630_945885_-	hypothetical protein	NA	A0A1J0MF61	Staphylococcus_phage	62.7	1.4e-25
WP_000956747.1|946358_946610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477491.1|946736_946841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000006110.1|947352_947538_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_000777467.1|947871_949164_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
WP_001066124.1|949156_949918_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
WP_001002343.1|950141_950348_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
WP_078065144.1|950643_950868_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	71.0	4.3e-18
WP_001659797.1|951557_951755_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 69
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	956825	957302	2848032		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448084.1|956825_957302_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	37.3	7.9e-22
>prophage 70
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	963244	969725	2848032		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103747.1|963244_964063_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	3.1e-26
WP_001077635.1|964536_965079_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516254.1|965084_967094_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.5	5.3e-59
WP_000073335.1|967106_969725_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.6	1.4e-40
>prophage 71
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	979140	980184	2848032		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|979140_980184_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 72
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	984920	990464	2848032		Bacillus_virus(33.33%)	4	NA	NA
WP_000664781.1|984920_986207_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	28.4	7.9e-16
WP_000089936.1|986206_987472_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	27.0	5.4e-41
WP_001293310.1|987502_988216_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078091196.1|988220_990464_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 73
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	995605	1007420	2848032	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864174.1|995605_996577_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282295.1|996591_997509_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|997678_998029_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043639.1|998415_1000533_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.3	6.2e-26
WP_000020853.1|1000537_1000855_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|1000851_1001136_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097463.1|1001156_1002332_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|1002352_1002820_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_078065168.1|1003109_1007420_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 74
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1011718	1012489	2848032		Flavobacterium_phage(100.0%)	1	NA	NA
WP_150344378.1|1011718_1012489_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	1.2e-24
>prophage 75
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1017263	1030027	2848032	protease,tRNA	Erwinia_phage(20.0%)	10	NA	NA
WP_000379054.1|1017263_1018667_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	4.9e-27
WP_000072681.1|1018732_1019278_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015609.1|1019274_1020171_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	6.1e-31
WP_000195254.1|1020588_1021896_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|1022051_1024127_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000620183.1|1024299_1025172_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000672856.1|1025343_1026588_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_000110253.1|1027054_1027963_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|1027984_1029151_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176399.1|1029259_1030027_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 76
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1043322	1045443	2848032		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|1043322_1044054_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|1044169_1044403_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|1044708_1045443_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 77
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1055813	1057808	2848032		Moumouvirus(100.0%)	1	NA	NA
WP_000579552.1|1055813_1057808_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 78
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1060955	1061891	2848032	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161279.1|1060955_1061891_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	6.2e-10
>prophage 79
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1066896	1069153	2848032		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722166.1|1066896_1068096_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	2.1e-42
WP_000933956.1|1068311_1068530_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368225.1|1068529_1069153_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	6.1e-22
>prophage 80
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1072668	1073280	2848032		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|1072668_1073280_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 81
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1077247	1081858	2848032		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|1077247_1078348_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_000767026.1|1078349_1079624_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|1079641_1080523_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178613.1|1080550_1081858_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 82
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1087662	1090416	2848032	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_150344379.1|1087662_1090416_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 83
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1109998	1110187	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245798.1|1109998_1110187_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	8.5e-20
>prophage 84
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1119328	1122410	2848032		Staphylococcus_phage(100.0%)	5	NA	NA
WP_001802045.1|1119328_1119553_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765708.1|1119509_1119656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857485.1|1120328_1121288_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	1.3e-34
WP_000231631.1|1121764_1121998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138269798.1|1122161_1122410_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	52.5	3.2e-06
>prophage 85
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1135353	1139911	2848032		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|1135353_1135668_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249291.1|1135840_1138189_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.8	2.9e-16
WP_000161946.1|1138198_1139911_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	8.9e-15
>prophage 86
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1144788	1145847	2848032	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|1144788_1145847_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 87
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1157793	1160704	2848032		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|1157793_1158276_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263802.1|1158277_1158820_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|1158889_1159279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|1159281_1159536_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757578.1|1159774_1160704_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	25.8	2.2e-12
>prophage 88
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1172178	1176693	2848032	transposase	Erysipelothrix_phage(50.0%)	5	NA	NA
WP_000182659.1|1172178_1174026_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
WP_000810617.1|1174127_1174319_+	YlaF family protein	NA	NA	NA	NA	NA
WP_001240322.1|1174472_1175300_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_000170598.1|1175456_1176071_+	YktB family protein	NA	NA	NA	NA	NA
WP_064128952.1|1176207_1176693_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	3.8e-19
>prophage 89
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1184825	1193659	2848032		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433555.1|1184825_1185920_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020622.1|1185932_1186472_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455590.1|1186615_1186891_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|1187059_1188466_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863437.1|1188469_1189762_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|1189852_1190830_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_150344382.1|1190833_1191946_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668338.1|1192116_1192743_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957036.1|1193107_1193659_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 90
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1202747	1203920	2848032		Streptococcus_phage(100.0%)	1	NA	NA
WP_000685063.1|1202747_1203920_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
>prophage 91
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1207099	1221860	2848032		Prochlorococcus_phage(22.22%)	15	NA	NA
WP_000921971.1|1207099_1208500_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273256.1|1208492_1209299_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_071665620.1|1209403_1209601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150344383.1|1209564_1210812_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709285.1|1210833_1212312_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	2.7e-76
WP_000238670.1|1212326_1212893_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
WP_000030818.1|1212895_1213924_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	1.3e-61
WP_000483726.1|1213916_1215401_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.5	1.6e-44
WP_000032747.1|1215379_1217569_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	1.8e-140
WP_000666799.1|1217561_1218233_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_150344384.1|1218234_1218498_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174047.1|1218497_1219202_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.2	1.4e-46
WP_001010401.1|1219205_1220330_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861570.1|1220316_1220799_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225832.1|1220999_1221860_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
>prophage 92
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1232175	1235940	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074527.1|1232175_1235940_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
>prophage 93
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1239607	1258907	2848032	transposase,protease,holin,bacteriocin	Staphylococcus_phage(50.0%)	22	NA	NA
WP_000676553.1|1239607_1240627_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.3e-16
WP_001088784.1|1240708_1241890_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284457.1|1241927_1242257_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184947.1|1242495_1243317_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150220.1|1243309_1244113_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526687.1|1244099_1245773_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001804449.1|1245759_1246971_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_072357920.1|1247074_1247152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070968.1|1247302_1248241_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620942.1|1248291_1248843_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001788574.1|1248932_1249223_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
WP_020978112.1|1249286_1249418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081331.1|1249463_1250423_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766009.1|1250910_1251267_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001824253.1|1251355_1251493_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_000571185.1|1252016_1252658_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000668628.1|1252654_1252975_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870825.1|1252977_1254942_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_029656376.1|1254985_1255252_-|bacteriocin	bacteriocin transporter	bacteriocin	NA	NA	NA	NA
WP_099112139.1|1255901_1255979_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_014363402.1|1256262_1257909_-|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	99.3	3.7e-292
WP_001033867.1|1258304_1258907_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 94
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1264874	1278511	2848032	transposase,protease	Streptococcus_phage(33.33%)	12	NA	NA
WP_078064575.1|1264874_1267199_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.1e-11
WP_000928413.1|1267414_1268218_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049957.1|1268519_1270082_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
WP_001798480.1|1270081_1270342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340127.1|1270322_1271807_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_078055982.1|1272141_1272678_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	7.6e-29
WP_000746375.1|1272658_1273162_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001255377.1|1273270_1273612_-	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000810443.1|1273667_1274258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049284735.1|1274264_1275311_-	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
WP_000681144.1|1275300_1277148_-	membrane protein	NA	NA	NA	NA	NA
WP_001251211.1|1277152_1278511_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	2.0e-41
>prophage 95
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1304641	1306450	2848032		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|1304641_1306450_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 96
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1310399	1316150	2848032	transposase	Bacillus_virus(66.67%)	5	NA	NA
WP_000277723.1|1310399_1312046_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
WP_001180264.1|1312332_1313214_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593421.1|1313225_1314188_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000427764.1|1314180_1315161_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001067032.1|1315163_1316150_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
>prophage 97
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1319802	1321816	2848032		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786743.1|1319802_1320744_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
WP_000140050.1|1320733_1321816_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 98
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1330409	1337219	2848032		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619354.1|1330409_1331555_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.3	3.9e-06
WP_001047064.1|1331664_1332534_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353962.1|1332592_1335202_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.7	9.5e-117
WP_001044212.1|1335404_1337219_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	34.4	1.8e-37
>prophage 99
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1342443	1346097	2848032		Bacillus_phage(100.0%)	1	NA	NA
WP_000154915.1|1342443_1346097_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.5	1.2e-24
>prophage 100
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1356850	1363845	2848032		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000185327.1|1356850_1357780_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.7	1.5e-16
WP_000138487.1|1358118_1359363_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_000167314.1|1359471_1360662_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
WP_000838027.1|1360970_1362098_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1362459_1362837_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1363251_1363845_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 101
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1373779	1377397	2848032		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009700.1|1373779_1375255_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.2	4.0e-48
WP_000046076.1|1375385_1376594_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001143497.1|1377037_1377397_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 102
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1381441	1384110	2848032		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1381441_1382656_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129662.1|1382652_1384110_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	2.6e-39
>prophage 103
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1397573	1421837	2848032	coat,integrase,terminase	Staphylococcus_phage(75.0%)	35	1402846:1402867	1423510:1423531
WP_000807670.1|1397573_1398815_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	8.2e-111
WP_000205572.1|1398929_1400237_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1400334_1401096_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
WP_001183851.1|1401424_1402276_+	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_064128943.1|1402509_1402704_-	CsbD family protein	NA	NA	NA	NA	NA
1402846:1402867	attL	AGGGAGTGGGACAGAAATGATA	NA	NA	NA	NA
WP_000382163.1|1403828_1404029_-	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
WP_000139423.1|1404015_1404126_-	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
WP_001795626.1|1404196_1404349_-	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	98.0	7.6e-19
WP_001035631.1|1404722_1405280_+	DUF4888 domain-containing protein	NA	A0A1W6JQE5	Staphylococcus_phage	73.8	1.4e-70
WP_000278085.1|1405357_1406158_-	staphylococcal enterotoxin type B	NA	A0A097PAT7	Streptococcus_pyogenes_phage	49.4	1.0e-53
WP_001293067.1|1406465_1407035_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	97.9	1.0e-100
WP_045181470.1|1407031_1407244_-	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	98.6	1.1e-31
WP_000771368.1|1407375_1407903_-|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_150344385.1|1407953_1408172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000846285.1|1408189_1408768_-	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
WP_001190615.1|1408779_1409121_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	99.1	1.4e-57
WP_001019764.1|1409637_1410279_-	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	91.5	1.5e-108
WP_000998181.1|1410275_1410560_-	hypothetical protein	NA	A0A1W6JQE4	Staphylococcus_phage	95.7	1.9e-47
WP_001039168.1|1410561_1410924_-	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	99.2	8.9e-66
WP_000390454.1|1411209_1412679_-	hypothetical protein	NA	A0A1W6JQD6	Staphylococcus_phage	99.0	2.9e-288
WP_001002732.1|1412695_1413565_-	hypothetical protein	NA	A0A1W6JQL5	Staphylococcus_phage	92.7	3.4e-156
WP_001103942.1|1413628_1413949_-	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	51.9	1.3e-20
WP_001058486.1|1413951_1414161_-	hypothetical protein	NA	Q4ZE76	Staphylococcus_phage	94.2	1.7e-29
WP_000784875.1|1414153_1414300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091731.1|1414311_1414584_-	winged helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	90.0	9.7e-41
WP_000243851.1|1414576_1414840_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J9X2	uncultured_Caudovirales_phage	94.8	3.1e-36
WP_001260004.1|1415032_1415365_+	helix-turn-helix transcriptional regulator	NA	A0A1J0MFC1	Staphylococcus_phage	74.5	1.6e-37
WP_150344386.1|1415376_1415835_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0H4J322	Staphylococcus_phage	82.4	1.1e-65
WP_001228759.1|1415851_1416283_+	hypothetical protein	NA	Q4ZCB6	Staphylococcus_virus	56.0	5.1e-36
WP_001033316.1|1416352_1417081_+	staphylococcal enterotoxin type Q	NA	A0EX09	Staphylococcus_phage	35.4	2.3e-28
WP_000733774.1|1417104_1417833_+	staphylococcal enterotoxin type K	NA	A0EX09	Staphylococcus_phage	31.8	5.5e-22
WP_000266157.1|1417921_1419142_+|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	47.5	6.4e-100
WP_000732334.1|1419284_1420106_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000520233.1|1420123_1420819_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000571213.1|1420811_1421837_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	9.4e-28
1423510:1423531	attR	TATCATTTCTGTCCCACTCCCT	NA	NA	NA	NA
>prophage 104
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1424884	1432277	2848032	transposase	Streptococcus_phage(40.0%)	10	NA	NA
WP_000277723.1|1424884_1426531_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
WP_000290491.1|1426561_1426942_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000589549.1|1427099_1427456_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147955.1|1427599_1427920_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1428069_1428609_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150029.1|1428691_1429408_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.1	6.8e-17
WP_000974455.1|1429555_1429978_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569881.1|1430376_1430871_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255554.1|1431026_1431644_+	amino acid transporter	NA	NA	NA	NA	NA
WP_072353886.1|1431716_1432277_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	2.2e-31
>prophage 105
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1435683	1436927	2848032		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1435683_1435884_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001823812.1|1436240_1436927_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	53.4	1.1e-32
>prophage 106
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1446299	1455059	2848032		Staphylococcus_phage(50.0%)	8	NA	NA
WP_000757406.1|1446299_1447028_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	37.5	1.3e-18
WP_000999092.1|1447315_1447930_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_001085185.1|1448896_1449361_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_001050031.1|1449382_1451755_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
WP_001165974.1|1451788_1452529_-	carboxylesterase	NA	NA	NA	NA	NA
WP_000556760.1|1452657_1452891_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1452957_1453416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1453754_1455059_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 107
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1466214	1471915	2848032		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1466214_1466802_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1467371_1468316_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248941.1|1468426_1469422_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369719.1|1469418_1470330_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134959.1|1470979_1471915_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	4.9e-84
>prophage 108
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1476308	1479155	2848032		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_031844946.1|1476308_1479155_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 109
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1482473	1483313	2848032		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_150344390.1|1482473_1483313_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	41.3	5.0e-11
>prophage 110
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1489391	1495104	2848032		Streptococcus_phage(66.67%)	5	NA	NA
WP_000370987.1|1489391_1490474_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.5	3.4e-44
WP_000686342.1|1490837_1491704_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192947.1|1491847_1492489_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000258151.1|1492660_1493716_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1494033_1495104_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 111
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1504386	1528472	2848032	transposase	uncultured_Caudovirales_phage(33.33%)	23	NA	NA
WP_000616873.1|1504386_1505148_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	8.5e-18
WP_150344392.1|1505144_1506101_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876318.1|1506087_1507059_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_000499195.1|1507097_1507253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562499.1|1507752_1508724_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.0	2.7e-170
WP_000855505.1|1508841_1510947_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1510909_1511308_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001790091.1|1511457_1511724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068497.1|1512108_1512975_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1512994_1513495_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_071665613.1|1513524_1513773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193751.1|1513834_1515340_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031760357.1|1515417_1515519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429011.1|1515611_1516529_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	6.2e-07
WP_138269778.1|1516934_1517147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197262.1|1517136_1517679_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663039.1|1517837_1518896_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.4	1.4e-21
WP_000180997.1|1519135_1520650_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589262.1|1520642_1521620_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
WP_000983680.1|1521841_1523623_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	36.8	8.5e-77
WP_000525113.1|1523634_1525518_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	3.3e-55
WP_064128952.1|1525862_1526348_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	3.8e-19
WP_000098285.1|1526531_1528472_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 112
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1531620	1541467	2848032		Pandoravirus(12.5%)	12	NA	NA
WP_001217797.1|1531620_1532772_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
WP_000604508.1|1532755_1533349_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_000446724.1|1533699_1534368_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1534369_1534789_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062976.1|1534792_1535506_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000637683.1|1535604_1536189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093553.1|1536468_1536909_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1537250_1537724_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1537698_1538385_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244415.1|1538384_1539440_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702774.1|1539512_1540496_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	4.3e-62
WP_000931233.1|1540627_1541467_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.9	6.7e-56
>prophage 113
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1553009	1554383	2848032		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000952025.1|1553009_1554383_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	6.6e-45
>prophage 114
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1559360	1565639	2848032		Bacillus_phage(33.33%)	6	NA	NA
WP_000857614.1|1559360_1561034_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.6	2.6e-11
WP_000737156.1|1561030_1562662_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	5.7e-11
WP_000469897.1|1562880_1563756_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358501.1|1563926_1564610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148822.1|1564612_1565071_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1565072_1565639_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
>prophage 115
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1572906	1573380	2848032		Pandoravirus(100.0%)	1	NA	NA
WP_000833479.1|1572906_1573380_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 116
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1578643	1579441	2848032		Bacillus_phage(100.0%)	1	NA	NA
WP_000731644.1|1578643_1579441_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 117
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1584270	1585032	2848032		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1584270_1585032_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 118
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1589406	1590450	2848032		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_001030774.1|1589406_1590450_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	28.0	4.4e-17
>prophage 119
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1596973	1597771	2848032		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1596973_1597771_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 120
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1600998	1604957	2848032		Bacillus_phage(33.33%)	3	NA	NA
WP_000817960.1|1600998_1602726_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793062.1|1603146_1604442_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1604558_1604957_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 121
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1611891	1612635	2848032		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1611891_1612635_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 122
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1623586	1624147	2848032	integrase	Streptococcus_phage(100.0%)	1	1617740:1617754	1627738:1627752
1617740:1617754	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044917.1|1623586_1624147_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S9C2	Streptococcus_phage	35.4	1.1e-19
WP_001044917.1|1623586_1624147_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S9C2	Streptococcus_phage	35.4	1.1e-19
1627738:1627752	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 123
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1637100	1640454	2848032		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1637100_1638111_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1638609_1639131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180234.1|1639158_1640454_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 124
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1650823	1652146	2848032		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860593.1|1650823_1652146_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.6	9.1e-108
>prophage 125
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1663447	1664104	2848032		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455258.1|1663447_1664104_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 126
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1667772	1671093	2848032		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100844.1|1667772_1669149_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.1	5.7e-20
WP_000347074.1|1669692_1671093_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	1.6e-54
>prophage 127
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1677352	1682346	2848032	transposase	Staphylococcus_virus(50.0%)	3	NA	NA
WP_000277723.1|1677352_1678999_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
WP_001106109.1|1679259_1680750_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001106712.1|1680873_1682346_-	glycosyltransferase	NA	A0A1V0SGA9	Hokovirus	23.3	5.5e-05
>prophage 128
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1696761	1697424	2848032		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067259.1|1696761_1697424_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	36.9	3.1e-24
>prophage 129
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1703999	1705187	2848032		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250828.1|1703999_1705187_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.8	8.8e-46
>prophage 130
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1708215	1719169	2848032		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1708215_1710297_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1710419_1710890_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1710955_1711369_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1711466_1711721_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001819727.1|1711857_1715454_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	4.3e-67
WP_000918667.1|1715617_1719169_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 131
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1722852	1727635	2848032	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1722852_1723401_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1723413_1723596_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1723651_1723795_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872872.1|1723909_1724479_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664738.1|1724559_1725084_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390339.1|1725083_1725830_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370186.1|1725837_1726242_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631977.1|1726234_1727635_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	5.5e-55
>prophage 132
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1733647	1736104	2848032	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1733647_1736104_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 133
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1755016	1765302	2848032	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288207.1|1755016_1756504_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.9	7.8e-92
WP_001790128.1|1756556_1756649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613718.1|1757041_1757518_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1757514_1757880_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167940.1|1757857_1758661_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.8	8.7e-21
WP_000057594.1|1758876_1759809_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1759987_1760869_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1761111_1763205_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1763462_1764002_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176711.1|1764006_1765302_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	4.8e-13
>prophage 134
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1774558	1777884	2848032	transposase	Hokovirus(33.33%)	3	NA	NA
WP_000933774.1|1774558_1775524_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252528.1|1775670_1777023_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
WP_000093393.1|1777398_1777884_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
>prophage 135
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1783646	1786744	2848032	tRNA	Hokovirus(50.0%)	2	NA	NA
WP_150344397.1|1783646_1785620_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	3.2e-93
WP_000279919.1|1785904_1786744_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 136
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1790650	1791268	2848032		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1790650_1791268_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 137
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1800121	1801819	2848032		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109053.1|1800121_1801819_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.1	4.3e-54
>prophage 138
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1818469	1824709	2848032		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170262.1|1818469_1819474_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.5	1.2e-24
WP_000825529.1|1819805_1820648_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467994.1|1820684_1821344_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569285.1|1821347_1822373_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	3.1e-31
WP_001036653.1|1822668_1823811_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634111.1|1823803_1824709_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	2.5e-48
>prophage 139
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1842328	1844375	2848032	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000777467.1|1842328_1843621_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
WP_001066124.1|1843613_1844375_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
>prophage 140
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1850560	1853219	2848032		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072559.1|1850560_1851670_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	43.9	4.5e-68
WP_000028589.1|1851662_1853219_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	95.9	2.4e-285
>prophage 141
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1862612	1863098	2848032	transposase	Lactococcus_phage(100.0%)	1	NA	NA
WP_000093393.1|1862612_1863098_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
>prophage 142
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1874350	1877383	2848032		Hokovirus(50.0%)	2	NA	NA
WP_000424963.1|1874350_1875892_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1875916_1877383_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 143
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1886341	1887865	2848032		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930507.1|1886341_1887865_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.9	6.4e-41
>prophage 144
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1895687	1906064	2848032	transposase,integrase	Staphylococcus_phage(42.86%)	13	1890461:1890476	1899134:1899149
1890461:1890476	attL	TCTTAAATTCTCTATC	NA	NA	NA	NA
WP_071665653.1|1895687_1895921_+|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZE80	Staphylococcus_phage	77.8	7.8e-23
WP_078055966.1|1896030_1896969_+	Abi family protein	NA	NA	NA	NA	NA
WP_000897044.1|1897234_1897477_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_000934799.1|1897528_1898032_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1898052_1898349_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052486.1|1898592_1898757_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	76.5	3.1e-18
WP_001066124.1|1898812_1899574_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
1899134:1899149	attR	TCTTAAATTCTCTATC	NA	NA	NA	NA
WP_000777467.1|1899566_1900859_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
WP_001218732.1|1901074_1902172_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1902183_1902387_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373077.1|1902416_1903298_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_014363379.1|1903451_1904297_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	33.8	3.5e-12
WP_000655692.1|1904960_1906064_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 145
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1915985	1916828	2848032		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209561.1|1915985_1916828_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.7	1.0e-11
>prophage 146
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1936795	1939530	2848032		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280816.1|1936795_1937818_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	8.8e-10
WP_001191930.1|1937795_1938740_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449065.1|1938729_1939530_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.0	3.1e-42
>prophage 147
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1957757	1958435	2848032		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911020.1|1957757_1958435_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.2e-31
>prophage 148
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1976625	1981074	2848032		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549292.1|1976625_1981074_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.7e-28
>prophage 149
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	1991679	1993342	2848032		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_000570070.1|1991679_1992339_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736789.1|1992391_1993342_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 150
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2002118	2003555	2848032		Pandoravirus(100.0%)	1	NA	NA
WP_000163992.1|2002118_2003555_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.8	4.8e-30
>prophage 151
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2007315	2011855	2848032		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|2007315_2009055_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_000608828.1|2009315_2009990_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975351.1|2010133_2011855_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 152
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2021182	2022226	2848032		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645592.1|2021182_2022226_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	7.8e-14
>prophage 153
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2029440	2030970	2848032		Vibrio_phage(100.0%)	1	NA	NA
WP_000838207.1|2029440_2030970_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	49.4	8.2e-12
>prophage 154
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2039846	2041352	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008406.1|2039846_2041352_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	3.5e-39
>prophage 155
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2052556	2057915	2848032		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|2052556_2054806_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837101.1|2055393_2056362_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127984.1|2056358_2057915_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 156
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2068229	2070289	2848032		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818914.1|2068229_2069327_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166908.1|2069710_2070289_-	M23 family metallopeptidase	NA	A0A1Q1PW35	Staphylococcus_phage	39.0	8.7e-15
>prophage 157
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2078589	2080182	2848032		Planktothrix_phage(100.0%)	1	NA	NA
WP_000067354.1|2078589_2080182_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	3.1e-22
>prophage 158
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2096842	2098027	2848032		Klosneuvirus(100.0%)	1	NA	NA
WP_001084449.1|2096842_2098027_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.8e-35
>prophage 159
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2102884	2110060	2848032		Tupanvirus(100.0%)	1	NA	NA
WP_000605285.1|2102884_2110060_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.9	1.3e-67
>prophage 160
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2115173	2118170	2848032		Bacillus_virus(50.0%)	4	NA	NA
WP_000590858.1|2115173_2115914_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	1.1e-38
WP_000171922.1|2116255_2116768_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|2116946_2117150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013483.1|2117210_2118170_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	8.8e-12
>prophage 161
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2121509	2123994	2848032		Catovirus(50.0%)	2	NA	NA
WP_000723443.1|2121509_2122655_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.1	5.4e-24
WP_000779512.1|2122731_2123994_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.8	3.3e-22
>prophage 162
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2131011	2137576	2848032		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|2131011_2132136_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028285.1|2132139_2133249_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459065.1|2133261_2134290_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	2.0e-41
WP_000940777.1|2134279_2136103_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.1	5.2e-29
WP_000565290.1|2136122_2136887_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037326.1|2136889_2137576_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 163
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2141600	2142776	2848032		Clostridium_phage(100.0%)	1	NA	NA
WP_000469827.1|2141600_2142776_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.1	2.3e-30
>prophage 164
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2148234	2149008	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|2148234_2149008_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 165
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2156190	2156790	2848032		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874684.1|2156190_2156790_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	2.2e-53
>prophage 166
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2161727	2162708	2848032		Catovirus(100.0%)	1	NA	NA
WP_078065132.1|2161727_2162708_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.3e-47
>prophage 167
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2166266	2167469	2848032		Tupanvirus(100.0%)	1	NA	NA
WP_001223705.1|2166266_2167469_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	3.9e-09
>prophage 168
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2175735	2179945	2848032		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570804.1|2175735_2176716_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.7e-40
WP_001045111.1|2176946_2177939_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000924997.1|2177954_2178950_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136629.1|2178946_2179945_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	2.0e-14
>prophage 169
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2195577	2197224	2848032	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277723.1|2195577_2197224_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
>prophage 170
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2206529	2208576	2848032	transposase	Lactococcus_phage(50.0%)	2	NA	NA
WP_001066124.1|2206529_2207291_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
WP_000777467.1|2207283_2208576_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
>prophage 171
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2223173	2224688	2848032		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000627204.1|2223173_2224688_-	protein kinase	NA	A0A0G2YBE6	Acanthamoeba_polyphaga_mimivirus	27.4	6.2e-12
>prophage 172
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2228248	2231248	2848032		Bacillus_phage(100.0%)	2	NA	NA
WP_000815640.1|2228248_2229598_+	recombinase family protein	NA	Q9T200	Bacillus_phage	24.8	1.4e-18
WP_001186608.1|2229619_2231248_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	31.4	5.4e-46
>prophage 173
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2240588	2241263	2848032	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001106057.1|2240588_2241263_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
>prophage 174
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2246906	2256910	2848032		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2246906_2247707_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104161.1|2248094_2248883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060149.1|2248883_2250218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|2250210_2252037_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|2252049_2252751_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2253947_2255231_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2255509_2256910_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 175
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2263596	2272632	2848032	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884334.1|2263596_2264883_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177463.1|2265260_2266775_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.6	3.0e-91
WP_000449218.1|2267100_2267913_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_150344401.1|2268000_2270661_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	1.3e-118
WP_000255586.1|2270697_2272632_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.7e-143
>prophage 176
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2282719	2286132	2848032		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_000742837.1|2282719_2283559_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491384.1|2284168_2284522_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779135.1|2284589_2284985_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054123.1|2285235_2285805_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|2285931_2286132_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 177
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2290429	2291188	2848032		Planktothrix_phage(100.0%)	1	NA	NA
WP_000154165.1|2290429_2291188_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.0	1.0e-34
>prophage 178
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2305616	2307329	2848032		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138662.1|2305616_2307329_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	2.1e-19
>prophage 179
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2312965	2313979	2848032		Faustovirus(100.0%)	1	NA	NA
WP_000639176.1|2312965_2313979_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.4	5.3e-07
>prophage 180
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2326910	2327603	2848032		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|2326910_2327603_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 181
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2357056	2358916	2848032		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125615.1|2357056_2358916_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 182
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2384757	2386508	2848032		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143422.1|2384757_2385645_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	23.0	3.3e-05
WP_000923775.1|2385752_2386508_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 183
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2389938	2390436	2848032		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2389938_2390436_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 184
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2395472	2397856	2848032		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071714.1|2395472_2397323_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.6e-235
WP_000173331.1|2397319_2397856_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.0	3.9e-41
>prophage 185
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2402733	2412846	2848032	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2402733_2404443_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2404722_2404935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028780.1|2405214_2405658_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172340.1|2405851_2407450_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_025174545.1|2407509_2407839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2408134_2409631_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031407.1|2409825_2410716_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237630.1|2410838_2411255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030049.1|2411508_2412846_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.8e-18
>prophage 186
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2443188	2446970	2848032		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000751271.1|2443188_2443890_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	6.8e-38
WP_000996742.1|2444165_2444654_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000379824.1|2445158_2446970_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 187
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2455403	2459446	2848032		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_000161354.1|2455403_2456402_+	D-lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	32.6	5.9e-35
WP_086107283.1|2456491_2456698_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024120.1|2457037_2459446_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	7.6e-129
>prophage 188
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2468686	2471679	2848032	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001063329.1|2468686_2470795_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.7	4.1e-118
WP_000262593.1|2471157_2471679_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.7	3.4e-26
>prophage 189
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2479029	2485393	2848032		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062648.1|2479029_2480769_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	3.5e-35
WP_000473671.1|2481068_2483135_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206030.1|2483495_2483906_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240662.1|2483947_2484292_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228163.1|2484424_2485393_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	4.0e-12
>prophage 190
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2494687	2498292	2848032	transposase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_000161536.1|2494687_2495680_-	D-lactate dehydrogenase	NA	M1HYB0	Acanthocystis_turfacea_Chlorella_virus	31.5	1.1e-36
WP_000069097.1|2495949_2496609_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000863974.1|2496740_2497547_-	VOC family protein	NA	NA	NA	NA	NA
WP_000093393.1|2497806_2498292_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
>prophage 191
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2505497	2507144	2848032	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_038412683.1|2505497_2507144_+|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	99.3	8.2e-292
>prophage 192
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2512726	2513422	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382894.1|2512726_2513422_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	6.8e-38
>prophage 193
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2516975	2519022	2848032	transposase	Lactococcus_phage(50.0%)	2	NA	NA
WP_001066124.1|2516975_2517737_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
WP_000777467.1|2517729_2519022_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
>prophage 194
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2534978	2535845	2848032		Bacillus_phage(100.0%)	1	NA	NA
WP_000721337.1|2534978_2535845_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.9	3.4e-79
>prophage 195
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2545561	2547199	2848032		Streptococcus_phage(100.0%)	1	NA	NA
WP_000356869.1|2545561_2547199_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	38.1	4.4e-96
>prophage 196
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2559487	2560183	2848032		Bacillus_phage(100.0%)	1	NA	NA
WP_000217461.1|2559487_2560183_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	8.6e-09
>prophage 197
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2565382	2566201	2848032		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824935.1|2565382_2566201_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.7	8.3e-11
>prophage 198
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2574071	2575629	2848032		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173873.1|2574071_2574887_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	3.6e-14
WP_000590515.1|2574879_2575629_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 199
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2581998	2586425	2848032		Bacillus_phage(50.0%)	4	NA	NA
WP_000923515.1|2581998_2582661_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
WP_000072152.1|2582653_2583430_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026185.1|2583823_2585011_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700919.1|2585072_2586425_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 200
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2589818	2591045	2848032		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000948987.1|2589818_2591045_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 201
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2609425	2615631	2848032		Bacillus_phage(66.67%)	5	NA	NA
WP_001176863.1|2609425_2610568_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779353.1|2610835_2611222_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2611354_2611462_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064822.1|2612109_2613873_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.3	1.8e-34
WP_000488493.1|2613897_2615631_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	4.8e-32
>prophage 202
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2619092	2624864	2848032		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971541.1|2619092_2620208_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	3.2e-21
WP_000286874.1|2620218_2620911_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200957.1|2620921_2621389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783428.1|2621440_2622418_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
WP_000916705.1|2622419_2623367_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.8	2.4e-139
WP_031845052.1|2623934_2624864_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	70.7	1.2e-119
>prophage 203
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2632708	2633440	2848032		Bacillus_virus(100.0%)	1	NA	NA
WP_000615464.1|2632708_2633440_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	6.9e-25
>prophage 204
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2650251	2651811	2848032		Escherichia_phage(100.0%)	1	NA	NA
WP_000692644.1|2650251_2651811_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 205
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2673152	2674187	2848032		Bacillus_virus(100.0%)	1	NA	NA
WP_000655978.1|2673152_2674187_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 206
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2684127	2690685	2848032		Staphylococcus_phage(25.0%)	8	NA	NA
WP_000340145.1|2684127_2684856_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.5e-27
WP_000372851.1|2684989_2685553_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000793174.1|2685730_2686186_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000977025.1|2686182_2686626_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000477337.1|2686788_2688162_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	1.8e-13
WP_000249498.1|2688154_2688829_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761404.1|2688964_2690020_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229921.1|2690019_2690685_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	4.6e-36
>prophage 207
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2695746	2701041	2848032	transposase	Staphylococcus_virus(50.0%)	4	NA	NA
WP_000277723.1|2695746_2697393_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
WP_000828571.1|2697774_2698329_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000738244.1|2698449_2699097_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000205257.1|2699109_2701041_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A2H4PQR6	Staphylococcus_phage	28.4	9.4e-05
>prophage 208
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2709673	2710573	2848032		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524841.1|2709673_2710573_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 209
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2723748	2724630	2848032		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730035.1|2723748_2724630_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	45.9	1.1e-61
>prophage 210
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2732508	2733144	2848032		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2732508_2733144_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 211
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2746154	2750546	2848032		Staphylococcus_phage(50.0%)	4	NA	NA
WP_072460394.1|2746154_2746793_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
WP_000684155.1|2747515_2748640_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
WP_000417016.1|2748731_2749685_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	2.9e-31
WP_000737705.1|2750045_2750546_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 212
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2754463	2755273	2848032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717388.1|2754463_2755273_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 213
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2774253	2774859	2848032		Pithovirus(100.0%)	1	NA	NA
WP_000913006.1|2774253_2774859_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 214
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2786889	2790057	2848032		Leptospira_phage(100.0%)	1	NA	NA
WP_000592327.1|2786889_2790057_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.9	3.3e-63
>prophage 215
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2813650	2815317	2848032		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000389659.1|2813650_2814460_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.1	7.4e-20
WP_000155389.1|2814456_2815317_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	9.7e-10
>prophage 216
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2818358	2823250	2848032		Mycobacterium_phage(50.0%)	3	NA	NA
WP_000204273.1|2818358_2819795_+	MarR family transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	31.0	6.0e-57
WP_000655237.1|2820964_2821147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130153.1|2821585_2823250_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.8	1.8e-44
>prophage 217
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2830140	2832471	2848032		Indivirus(50.0%)	3	NA	NA
WP_001015494.1|2830140_2830989_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	34.6	4.1e-37
WP_000875477.1|2831221_2831425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078090911.1|2831730_2832471_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.4	5.6e-14
>prophage 218
NZ_CP044106	Staphylococcus aureus strain FDAARGOS_660 chromosome, complete genome	2848032	2839466	2847681	2848032	integrase	Staphylococcus_phage(100.0%)	17	2830887:2830899	2841367:2841379
2830887:2830899	attL	TAAACAACAAATT	NA	NA	NA	NA
WP_000264751.1|2839466_2840672_-|integrase	site-specific integrase	integrase	A0A2I6PEN0	Staphylococcus_phage	100.0	7.7e-223
WP_000191466.1|2840797_2841412_+	hypothetical protein	NA	A0A2I6PEZ0	Staphylococcus_phage	100.0	6.7e-106
2841367:2841379	attR	TAAACAACAAATT	NA	NA	NA	NA
WP_001795334.1|2841408_2841555_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	100.0	1.2e-16
WP_000449655.1|2841645_2842041_-	hypothetical protein	NA	A0A2I6PEJ7	Staphylococcus_phage	100.0	3.8e-70
WP_000755718.1|2842069_2842504_-	hypothetical protein	NA	A0A2I6PEM0	Staphylococcus_phage	100.0	1.2e-24
WP_000525000.1|2842521_2842983_-	hypothetical protein	NA	A0A2I6PEK4	Staphylococcus_phage	99.3	1.3e-85
WP_000429766.1|2842995_2843325_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PEN2	Staphylococcus_phage	100.0	3.2e-54
WP_001115060.1|2843485_2843677_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PEL6	Staphylococcus_phage	100.0	2.3e-28
WP_001548903.1|2843933_2844173_-	hypothetical protein	NA	A0A2I6PE22	Staphylococcus_phage	100.0	6.7e-38
WP_001036299.1|2844219_2844435_+	hypothetical protein	NA	A0A2I6PEK7	Staphylococcus_phage	100.0	1.0e-32
WP_001124198.1|2844459_2844723_+	helix-turn-helix domain-containing protein	NA	A0A2I6PEL8	Staphylococcus_phage	100.0	2.5e-46
WP_001285951.1|2844734_2844896_+	DUF1270 domain-containing protein	NA	A0A2I6PEK6	Staphylococcus_phage	100.0	1.1e-20
WP_016060011.1|2844988_2845318_+	hypothetical protein	NA	I1W611	Staphylococcus_phage	100.0	2.0e-32
WP_031786849.1|2845298_2845559_+	DUF1108 family protein	NA	I1W613	Staphylococcus_phage	100.0	3.4e-43
WP_000985979.1|2845572_2845935_+	hypothetical protein	NA	A0A2I6PEM7	Staphylococcus_phage	100.0	3.7e-56
WP_150344410.1|2845931_2847098_+	DUF2800 domain-containing protein	NA	A0A2I6PEL9	Staphylococcus_phage	99.7	4.1e-221
WP_000645048.1|2847123_2847681_+	DUF2815 family protein	NA	A0A2I6PEP8	Staphylococcus_phage	100.0	1.8e-97
>prophage 1
NZ_CP044105	Staphylococcus aureus strain FDAARGOS_660 plasmid unnamed1, complete sequence	22780	0	4178	22780		Mycobacterium_phage(50.0%)	4	NA	NA
WP_000196697.1|1410_2310_+	Mph(C) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000583528.1|2795_3404_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	30.2	1.0e-13
WP_001049146.1|3649_3988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797248.1|3992_4178_+	helix-turn-helix transcriptional regulator	NA	A0A142LP09	Marinitoga_camini_virus	37.9	9.9e-05
>prophage 2
NZ_CP044105	Staphylococcus aureus strain FDAARGOS_660 plasmid unnamed1, complete sequence	22780	10478	22152	22780	transposase	Streptococcus_phage(42.86%)	13	NA	NA
WP_000119690.1|10478_10826_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	36.8	4.9e-13
WP_001791613.1|10982_11075_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000481279.1|11246_12218_-	oxidoreductase	NA	NA	NA	NA	NA
WP_000418035.1|12341_12761_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000733287.1|13286_14132_-	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	34.0	5.7e-31
WP_001096381.1|14238_15996_+	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
WP_000182645.1|15985_16366_+	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_000690637.1|16629_17208_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	4.9e-42
WP_001037130.1|17430_17616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001105991.1|17948_18623_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9SKD3	Staphylococcus_phage	99.6	6.8e-128
WP_001096887.1|19275_20070_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_000627290.1|20162_20705_-	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001105960.1|21477_22152_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	97.3	1.7e-126
