The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044076	Providencia stuartii strain FDAARGOS_645 chromosome, complete genome	4343403	63734	81937	4343403	transposase,lysis,integrase,holin	Pectobacterium_phage(47.62%)	26	53744:53758	83057:83071
53744:53758	attL	TTTCTTTTTCATTTT	NA	NA	NA	NA
WP_014658107.1|63734_64715_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	65.3	1.1e-123
WP_150375393.1|64759_64978_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	52.2	3.4e-12
WP_014658109.1|64961_65147_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	50.9	6.2e-07
WP_150375395.1|65554_66163_-	HNH endonuclease	NA	M1PKJ5	Streptococcus_phage	38.5	3.1e-31
WP_150375397.1|66159_66390_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	60.3	6.8e-11
WP_150375399.1|66415_66595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150375401.1|66640_67141_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	55.8	5.2e-40
WP_150375403.1|67140_69114_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	40.6	4.5e-119
WP_150375405.1|69128_69461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150375407.1|69967_70609_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	37.9	2.5e-34
WP_150375409.1|70714_70900_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	60.0	5.6e-08
WP_014658120.1|70938_71394_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	6.0e-27
WP_150375411.1|71411_71636_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	63.5	1.1e-18
WP_150375413.1|71637_72447_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.2	1.8e-42
WP_150375415.1|72439_73030_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	46.5	1.8e-44
WP_150376677.1|73029_74397_+	replicative DNA helicase	NA	A0A1V0E5J4	Salmonella_phage	46.0	8.5e-101
WP_150375417.1|74417_74588_+	palmdelphin	NA	NA	NA	NA	NA
WP_150375419.1|74590_74827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150375421.1|75014_75350_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	54.5	1.8e-28
WP_150375423.1|76301_76895_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	58.7	1.0e-63
WP_150375425.1|76906_77221_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	69.8	1.0e-33
WP_076914737.1|77208_77739_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	53.3	5.7e-37
WP_076914759.1|78565_78916_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_076914736.1|78915_79308_+	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	85.1	1.0e-43
WP_076914758.1|79325_79754_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	35.1	9.3e-14
WP_150375427.1|80850_81937_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.0	3.8e-43
83057:83071	attR	AAAATGAAAAAGAAA	NA	NA	NA	NA
>prophage 2
NZ_CP044076	Providencia stuartii strain FDAARGOS_645 chromosome, complete genome	4343403	935322	946488	4343403	tail,plate	Haemophilus_phage(40.0%)	13	NA	NA
WP_004920987.1|935322_935940_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	42.3	9.9e-33
WP_150375646.1|935939_937505_-	histidine kinase	NA	K7P7Q7	Enterobacteria_phage	56.8	9.9e-37
WP_061063904.1|937491_938148_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	43.3	1.7e-35
WP_150375648.1|938140_939265_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	41.1	1.7e-78
WP_004920995.1|939248_939611_-	hypothetical protein	NA	A0A2H5BFY4	Vibrio_phage	38.3	2.5e-12
WP_004920997.1|939610_940267_-	hypothetical protein	NA	Q7Y5S7	Haemophilus_phage	50.7	2.1e-33
WP_004921005.1|940263_941088_-	hypothetical protein	NA	Q7Y5S8	Haemophilus_phage	48.4	8.5e-72
WP_036940883.1|941062_941401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053110979.1|941397_942129_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	34.0	5.7e-27
WP_040133274.1|942211_943996_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	32.6	2.4e-10
WP_014656233.1|944140_944533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004921015.1|944532_944967_-	DUF3277 family protein	NA	NA	NA	NA	NA
WP_040133275.1|944976_946488_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	40.6	5.7e-98
>prophage 3
NZ_CP044076	Providencia stuartii strain FDAARGOS_645 chromosome, complete genome	4343403	3663183	3698995	4343403	coat,integrase,holin,head,terminase	Enterobacteria_phage(17.14%)	56	3663487:3663501	3683110:3683124
WP_036943252.1|3663183_3663942_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	27.6	1.0e-07
3663487:3663501	attL	AAAAGGCACATCTAA	NA	NA	NA	NA
WP_014657675.1|3663972_3665340_-	LOG family protein	NA	NA	NA	NA	NA
WP_150376419.1|3665405_3666470_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	44.5	1.2e-86
WP_113532824.1|3666426_3666684_-	excisionase	NA	NA	NA	NA	NA
WP_150376421.1|3666684_3666885_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	79.7	4.2e-25
WP_004916556.1|3667095_3667341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150376423.1|3667333_3667564_-	hypothetical protein	NA	A0A1U9ZAB3	Proteus_phage	47.3	2.2e-09
WP_150376425.1|3667560_3667872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150376427.1|3668035_3668239_-	hook protein	NA	NA	NA	NA	NA
WP_150376429.1|3668490_3668964_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	72.4	1.5e-49
WP_150376719.1|3668953_3669262_-	HNH endonuclease	NA	K7ZJS8	Xanthomonas_citri_phage	53.2	1.1e-21
WP_150376431.1|3669489_3670125_-	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	55.8	5.2e-53
WP_121874696.1|3670084_3670819_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.6	6.2e-66
WP_060561218.1|3670833_3671049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150376433.1|3671045_3671318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150376435.1|3671568_3671760_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_150376437.1|3672243_3672519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150376439.1|3672712_3673201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072503017.1|3673216_3673417_-	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	84.8	6.7e-07
WP_060561212.1|3673892_3674636_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_105874279.1|3674622_3675558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004916513.1|3675625_3675967_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	59.3	1.8e-36
WP_150376440.1|3676124_3676838_-	helix-turn-helix domain-containing protein	NA	A0A2R2X2B0	Escherichia_phage	63.4	6.2e-79
WP_150376442.1|3676800_3676983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895075.1|3676933_3677119_+	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
WP_150376444.1|3677226_3677574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141173751.1|3677669_3677849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150376446.1|3678722_3680117_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	48.5	2.6e-121
WP_014657877.1|3680520_3680733_+	DUF551 domain-containing protein	NA	A0A076G5R4	Escherichia_phage	46.3	3.4e-09
WP_148493810.1|3680923_3681124_+	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	96.7	1.3e-29
WP_004916479.1|3681113_3681398_+	hypothetical protein	NA	E5AGF1	Erwinia_phage	53.3	5.2e-21
WP_104873294.1|3681399_3681846_+	protein ninB	NA	E5AGF7	Erwinia_phage	56.6	6.3e-37
WP_150376448.1|3682060_3682273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150376450.1|3682269_3682554_+	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	73.1	3.9e-32
WP_036943321.1|3682550_3682907_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	72.4	7.2e-44
WP_150376451.1|3682906_3683539_+	antitermination protein	NA	NA	NA	NA	NA
3683110:3683124	attR	AAAAGGCACATCTAA	NA	NA	NA	NA
WP_052127994.1|3683782_3684418_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	62.7	3.4e-36
WP_004916437.1|3684934_3685252_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	58.1	1.2e-29
WP_150376453.1|3685244_3685661_+	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	56.7	1.3e-36
WP_150376455.1|3687202_3687970_+	DNA-binding protein	NA	Q9MCN2	Enterobacteria_phage	64.6	1.2e-88
WP_072502867.1|3688173_3688434_+	DUF2560 family protein	NA	NA	NA	NA	NA
WP_115113658.1|3688572_3688785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657893.1|3688793_3689195_+	hypothetical protein	NA	B6SD32	Bacteriophage	79.0	6.4e-41
WP_150376457.1|3689175_3690411_+|terminase	PBSX family phage terminase large subunit	terminase	H6WRS9	Salmonella_phage	76.9	3.2e-192
WP_150376459.1|3690410_3691865_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	49.5	4.2e-122
WP_101495269.1|3691902_3692829_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	60.9	2.3e-102
WP_036943348.1|3692841_3694233_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	63.2	3.1e-151
WP_101495248.1|3694236_3694677_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	57.7	3.1e-36
WP_150376461.1|3694687_3695764_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	67.1	2.6e-137
WP_150376463.1|3695772_3695982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004918445.1|3695965_3696337_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	44.6	8.3e-19
WP_150376465.1|3696333_3696702_+	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	63.1	2.1e-38
WP_072502874.1|3696703_3697069_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	54.2	1.1e-28
WP_052127995.1|3697065_3697434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150376467.1|3697501_3698257_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	61.0	3.9e-79
WP_061064235.1|3698308_3698995_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	64.9	1.8e-83
>prophage 4
NZ_CP044076	Providencia stuartii strain FDAARGOS_645 chromosome, complete genome	4343403	3702652	3712919	4343403		Cronobacter_phage(71.43%)	8	NA	NA
WP_150376475.1|3702652_3705994_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	43.8	2.4e-205
WP_036943368.1|3705993_3706617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150376477.1|3706649_3707132_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	66.9	4.4e-60
WP_150376479.1|3707128_3707596_+	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	53.0	3.4e-41
WP_150376481.1|3707595_3707988_+	NlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	56.1	8.8e-43
WP_150376483.1|3707974_3710449_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	48.7	8.4e-232
WP_150376485.1|3710474_3712328_+	hypothetical protein	NA	F1C5A8	Cronobacter_phage	54.9	1.2e-33
WP_036943401.1|3712367_3712919_-	serine acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	46.7	4.0e-33
>prophage 5
NZ_CP044076	Providencia stuartii strain FDAARGOS_645 chromosome, complete genome	4343403	3784589	3795182	4343403		Mycobacterium_phage(25.0%)	11	NA	NA
WP_004917599.1|3784589_3785792_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.8	6.4e-28
WP_004917602.1|3786518_3787490_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.8	1.6e-133
WP_071599640.1|3787503_3789636_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.2	4.4e-213
WP_004917606.1|3789646_3790060_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.9	5.3e-14
WP_014657707.1|3790069_3790297_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	56.2	1.6e-17
WP_004917609.1|3790587_3791058_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2P1EL10	Moumouvirus	35.7	7.6e-17
WP_014657708.1|3791264_3791474_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	7.7e-22
WP_004917612.1|3791616_3792582_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_014657709.1|3792705_3793350_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004917614.1|3793610_3793874_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004917615.1|3793973_3795182_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	50.9	8.8e-110
>prophage 6
NZ_CP044076	Providencia stuartii strain FDAARGOS_645 chromosome, complete genome	4343403	4020919	4031615	4343403	tRNA,protease	Paramecium_bursaria_Chlorella_virus(16.67%)	10	NA	NA
WP_014657828.1|4020919_4021765_+	hypothetical protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	30.6	1.8e-21
WP_004918066.1|4021761_4022511_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072502942.1|4022654_4023593_+	DUF1177 domain-containing protein	NA	NA	NA	NA	NA
WP_004918068.1|4023696_4023948_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	1.3e-15
WP_004918070.1|4024331_4024652_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.4	1.7e-15
WP_004918072.1|4024682_4026968_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	8.4e-170
WP_004244560.1|4027034_4027253_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004918075.1|4027393_4028095_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_014657831.1|4028103_4029846_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A1V0SJ29	Klosneuvirus	32.7	3.0e-18
WP_014657832.1|4029848_4031615_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y302	Organic_Lake_phycodnavirus	32.8	1.4e-15
>prophage 7
NZ_CP044076	Providencia stuartii strain FDAARGOS_645 chromosome, complete genome	4343403	4186972	4226743	4343403	protease,capsid,integrase,tail,lysis,holin,head,terminase,portal	Proteus_phage(22.86%)	55	4186759:4186791	4226352:4226384
4186759:4186791	attL	GGTGTTGGTTTTCCGTTATCATCAACGGCAACA	NA	NA	NA	NA
WP_150376595.1|4186972_4188175_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	H6WRW7	Salmonella_phage	51.5	5.3e-123
WP_072502968.1|4188186_4188399_-	excisionase Xis	NA	NA	NA	NA	NA
WP_150376597.1|4188395_4188713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150376599.1|4188709_4188889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150376601.1|4189032_4189770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150376603.1|4189762_4190011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150376605.1|4190007_4190235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053110950.1|4190231_4190843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060560722.1|4190842_4191595_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	58.5	1.1e-78
WP_053110952.1|4191604_4192090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081045570.1|4192086_4192302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060560723.1|4192282_4192633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060560724.1|4192707_4193130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060560725.1|4193324_4193621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060560726.1|4193623_4193809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150376607.1|4193977_4194172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150376609.1|4194150_4194390_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_150376727.1|4194400_4194898_-	helix-turn-helix domain-containing protein	NA	H2BDH4	Pseudomonas_virus	44.4	6.4e-06
WP_150376611.1|4195141_4195747_-	helix-turn-helix domain-containing protein	NA	A0A2D1GM27	Escherichia_phage	47.4	2.8e-11
WP_150376613.1|4195845_4196100_+	helix-turn-helix domain-containing protein	NA	E5AGE7	Erwinia_phage	58.6	1.8e-12
WP_150376615.1|4196121_4197054_+	replication protein	NA	A0A068C8G6	Acinetobacter_phage	42.4	2.6e-32
WP_150376617.1|4197099_4198992_+	AAA family ATPase	NA	Q5G8S8	Enterobacteria_phage	69.0	1.3e-269
WP_150376619.1|4199003_4199783_+	antitermination protein	NA	F1C595	Cronobacter_phage	49.6	9.8e-70
WP_150376621.1|4199953_4200451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150376623.1|4201228_4201444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150376625.1|4201447_4201690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004916437.1|4201848_4202166_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	58.1	1.2e-29
WP_150376627.1|4202158_4202575_+	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	58.7	1.9e-35
WP_150376629.1|4202770_4203346_+	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	64.4	1.8e-68
WP_150376729.1|4203357_4203795_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	38.1	1.1e-14
WP_141173786.1|4204421_4205126_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	48.4	1.2e-05
WP_150376631.1|4205122_4205461_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	66.1	7.1e-41
WP_105874216.1|4205491_4205701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060561544.1|4205824_4206301_+	hypothetical protein	NA	Q77WA1	Escherichia_phage	80.6	2.4e-63
WP_053110565.1|4206310_4207828_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	72.3	3.1e-213
WP_060561545.1|4207827_4209144_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	68.6	9.4e-174
WP_150376633.1|4209149_4210001_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	84.1	1.6e-129
WP_060561547.1|4210012_4211227_+|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	92.6	6.0e-207
WP_150376635.1|4211274_4211460_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	68.9	8.7e-09
WP_036940621.1|4211459_4211786_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	74.1	3.7e-39
WP_036940618.1|4211795_4212119_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	70.1	5.9e-37
WP_060561550.1|4212111_4212561_+	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	67.3	2.5e-49
WP_014656484.1|4212557_4212890_+	hypothetical protein	NA	A0A1P8DTJ3	Proteus_phage	63.1	2.2e-34
WP_150376637.1|4212951_4213434_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	67.5	1.4e-53
WP_014656482.1|4213433_4213826_+|tail	tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	47.5	4.8e-25
WP_014656481.1|4213882_4214110_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_150376639.1|4214131_4217212_+	tape measure protein	NA	Q6UAW7	Klebsiella_phage	29.3	9.0e-58
WP_014656479.1|4217214_4217811_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	55.6	1.7e-58
WP_014656478.1|4217810_4218392_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.2	1.4e-49
WP_014656477.1|4218500_4219379_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	37.3	8.6e-06
WP_060561557.1|4219459_4219858_+	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.7	4.4e-34
WP_150376641.1|4219858_4224241_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	50.1	7.2e-194
WP_150376643.1|4224310_4225711_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	30.4	7.5e-52
WP_060561364.1|4225789_4226071_-	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	38.3	1.5e-12
WP_004918488.1|4226338_4226743_-	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	38.9	1.0e-09
4226352:4226384	attR	GGTGTTGGTTTTCCGTTATCATCAACGGCAACA	NA	NA	NA	NA
>prophage 1
NZ_CP044075	Providencia stuartii strain FDAARGOS_645 plasmid unnamed1, complete sequence	186363	9258	49094	186363	integrase,transposase	Escherichia_phage(21.43%)	48	9196:9255	15136:15957
9196:9255	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|9258_9963_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077249983.1|10122_11631_+|transposase	IS21-like element ISCfr8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.7	9.9e-26
WP_012695455.1|11617_12358_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.7	4.4e-43
WP_032488579.1|12585_13140_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_002075255.1|13316_14330_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001067855.1|14427_15132_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_064717956.1|15156_15894_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214119.1|16110_17325_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
15136:15957	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTTTATTCTTCCTATACGTGCCGCGTTCCAGGCGGCGACTATGAGGGCTATGTCGATGCCCATGTGCGCCGGCTGGAGGCGCTACGCCGGGCCGGTATCGTCGAGCGGATCGACGCCGACCAATGGCGCATCCCCGATGATCTGGTCAGCCGTGCCGCCGCCCATGACGCCGGCCGAGACAGTCAGGCCAGCGTTCGCGTCCTTTCCCCGGTCGATCTGAACAAACAGATCGGATCGGACGGCGCGACCTGGCTGGACCGGCGGCTGATCCACGGCGAGACGGCCGACCTTGCGCCAACCGGCTTCGGGCAACAAGTCCGCGAAGCCATGGACCAGCGCCGCGAGCACCATATCGAACAGGGCGACGCCACCCGCAGCCGGGACAGCCGCGTCTTCTACCGGCGCAACCTTCTCGCCATCCTGCGGGAGCGCGAGGTAGCCGGCGTCGGATCGGATATGGCTTTGAGTAAGGGCCTGCCGTTCCGCGCCGCCACGGACGGCGAGAGCGTCAGCGGCAAGTTTACCGGAACCGTGCATCTATCGAGCGGCAAGTTCGCCGTGGTCGAGAAATCCCATGAGTTCACCCTTGTCCCGTGGCGGCCGATCATCGACCGCCAACTCGGCCGCGAGGTTATGGGCATCGTGCAGGGCGGGTCGGTGTCGTGGCAGTTAGGGCGGCAGAGGGGGCTGGAACGCTGAGTGCGCCCATGCCGCATTGCGAAGCAAAAGATAATCGGATAAAATGTAGCAATTCATATTCGT	NA	NA	NA	NA
WP_001255015.1|17352_17658_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|17769_19263_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|19293_19545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|19438_19741_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|19827_20643_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000338945.1|20949_21261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|21434_22220_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|22223_23405_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|23453_23726_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000074431.1|23778_24414_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_001125904.1|24975_25353_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000044823.1|25345_25627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|25601_26276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|26343_26775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348669.1|26759_27092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647188.1|27100_27601_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_000936897.1|27604_29032_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000268552.1|29031_29688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464630.1|29743_30361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000505706.1|30361_30568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326171.1|30572_30872_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_000467110.1|30962_31451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366823.1|31465_33658_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
WP_001191890.1|33657_33891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001249395.1|33872_34490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326173.1|34657_37630_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_000178857.1|37626_39492_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000332868.1|39502_40087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743449.1|40043_40673_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000122507.1|40682_41129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000869297.1|41138_41516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231464.1|41515_42178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326174.1|42501_42879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805625.1|43023_43305_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001049717.1|43301_43928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000794249.1|43911_44829_+	conjugal transfer protein TraK	NA	NA	NA	NA	NA
WP_000595749.1|44825_46142_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000793435.1|46138_46717_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_000479535.1|46720_47113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|47946_49094_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
>prophage 2
NZ_CP044075	Providencia stuartii strain FDAARGOS_645 plasmid unnamed1, complete sequence	186363	93388	123426	186363	integrase,transposase	Salmonella_phage(37.5%)	35	121158:121173	126088:126103
WP_032430687.1|93388_94393_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|94471_94906_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|94977_95328_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|95341_95617_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|95652_96075_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|96126_97821_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|97838_98201_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|98197_98434_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|98430_99138_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935451.1|99176_100892_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001381192.1|100894_101887_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000376623.1|101855_102356_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|102374_102554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|102483_103323_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|103316_103664_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001209508.1|103827_104619_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000846390.1|104635_105436_-	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_085851271.1|105561_105750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150375376.1|105700_106990_-	CmlA family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_002075255.1|107205_108219_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001447826.1|108163_108487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001162012.1|108524_109082_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|109084_112057_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_032430687.1|112135_113140_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001326390.1|113755_114157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988731.1|114270_114996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032410269.1|114970_115174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|115128_119382_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_001326394.1|119353_119794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|119964_120417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|120432_121035_-	hypothetical protein	NA	NA	NA	NA	NA
121158:121173	attL	TAATTATGATAATTAC	NA	NA	NA	NA
WP_000243801.1|121257_121578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932880.1|121596_121884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|121876_122413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|122415_123426_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
126088:126103	attR	TAATTATGATAATTAC	NA	NA	NA	NA
