The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044086	Pseudomonas luteola strain FDAARGOS_637 chromosome 1, complete sequence	4273365	1408968	1415716	4273365	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_010794652.1|1408968_1410249_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	8.2e-98
WP_150347193.1|1410248_1411640_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_150347194.1|1411636_1412644_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_010794649.1|1412674_1413646_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	67.9	4.0e-129
WP_010794648.1|1413642_1413957_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	74.7	2.6e-37
WP_037029547.1|1413953_1414253_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_010794646.1|1414249_1414609_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	62.5	1.9e-31
WP_037029544.1|1414608_1415001_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	70.3	3.4e-47
WP_010794644.1|1415047_1415716_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	74.4	3.0e-83
>prophage 2
NZ_CP044086	Pseudomonas luteola strain FDAARGOS_637 chromosome 1, complete sequence	4273365	1419661	1458879	4273365	tail,portal,capsid,terminase,integrase,head	uncultured_Caudovirales_phage(41.3%)	65	1419534:1419592	1465025:1465083
1419534:1419592	attL	GGGACTTAAAATCCCTCGGAGGAAACTCCGTGCCGGTTCGATTCCGGCTCCGGGCACCA	NA	NA	NA	NA
WP_150347196.1|1419661_1420693_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	56.9	9.9e-102
WP_150347197.1|1420695_1420902_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_167517219.1|1420949_1421120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347198.1|1421219_1421564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347199.1|1421678_1421951_-	hypothetical protein	NA	A0A2H4J5S5	uncultured_Caudovirales_phage	59.6	3.6e-19
WP_150347200.1|1422060_1422288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347201.1|1422280_1422835_-	DUF629 domain-containing protein	NA	NA	NA	NA	NA
WP_167517220.1|1422827_1422998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347202.1|1423187_1424054_-	hypothetical protein	NA	A0A2H4J418	uncultured_Caudovirales_phage	100.0	1.7e-176
WP_167517221.1|1424087_1424249_-	hypothetical protein	NA	A0A2H4J135	uncultured_Caudovirales_phage	100.0	2.6e-17
WP_150347203.1|1424261_1424450_-	hypothetical protein	NA	A0A2H4J9E3	uncultured_Caudovirales_phage	96.8	3.2e-27
WP_150347204.1|1424465_1424672_-	hypothetical protein	NA	A0A2H4J113	uncultured_Caudovirales_phage	95.6	9.9e-30
WP_150347205.1|1424679_1425291_-	ERF family protein	NA	A0A2H4J2M9	uncultured_Caudovirales_phage	52.4	3.6e-43
WP_150347206.1|1425321_1426068_-	hypothetical protein	NA	M4MB35	Vibrio_phage	38.1	4.1e-41
WP_150347207.1|1426525_1426786_-	hypothetical protein	NA	A0A2H4J123	uncultured_Caudovirales_phage	95.3	3.9e-39
WP_167517222.1|1426785_1427208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167517223.1|1427188_1427404_-	hypothetical protein	NA	A0A2H4J127	uncultured_Caudovirales_phage	87.0	1.0e-13
WP_150347209.1|1427567_1427765_-	hypothetical protein	NA	A0A0S2SYA6	Pseudomonas_phage	73.8	1.1e-22
WP_150347210.1|1427769_1428015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347211.1|1428325_1428580_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_150347212.1|1428700_1429609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347213.1|1429595_1430180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347214.1|1430220_1430907_-	helix-turn-helix domain-containing protein	NA	H2BDH4	Pseudomonas_virus	48.0	6.7e-54
WP_150347215.1|1431008_1431251_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	44.6	7.6e-05
WP_010794618.1|1431275_1431491_+	hypothetical protein	NA	A0A2H4J528	uncultured_Caudovirales_phage	41.1	4.0e-05
WP_167517224.1|1431806_1432628_+	hypothetical protein	NA	W6MYB0	Pseudomonas_phage	50.6	1.0e-56
WP_150347218.1|1432617_1433400_+	ATP-binding protein	NA	A0A059VK34	Pseudomonas_phage	45.7	1.3e-61
WP_150347219.1|1433396_1433792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347220.1|1433788_1433986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167517225.1|1434093_1434249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347221.1|1434245_1434530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347222.1|1434529_1434964_+	hypothetical protein	NA	A0A1B1ITH8	uncultured_Mediterranean_phage	45.1	2.8e-18
WP_150347223.1|1434960_1435248_+	hypothetical protein	NA	A0A2H4J993	uncultured_Caudovirales_phage	57.0	1.4e-21
WP_150347224.1|1435244_1435889_+	recombination protein NinG	NA	A0A2H4JA27	uncultured_Caudovirales_phage	63.2	6.2e-62
WP_150347225.1|1435873_1436506_+	hypothetical protein	NA	A0A2I7RQG7	Vibrio_phage	46.7	1.8e-50
WP_150347226.1|1436569_1437259_+	hypothetical protein	NA	A0A2H4J2J2	uncultured_Caudovirales_phage	97.8	5.5e-125
WP_150347227.1|1437483_1437819_+	hypothetical protein	NA	A0A2H4J8L0	uncultured_Caudovirales_phage	100.0	2.0e-40
WP_150347228.1|1437811_1438165_+	hypothetical protein	NA	A0A2H4J840	uncultured_Caudovirales_phage	100.0	3.9e-26
WP_150347229.1|1438172_1438664_+	glycoside hydrolase family 108 protein	NA	A0A2H4J0Z0	uncultured_Caudovirales_phage	96.9	2.0e-89
WP_150347230.1|1438660_1439164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347231.1|1439210_1440740_+	cellulase family glycosylhydrolase	NA	A0A2H4J3X4	uncultured_Caudovirales_phage	42.1	4.9e-73
WP_167517226.1|1440749_1440905_+	hypothetical protein	NA	A0A2H4J0W9	uncultured_Caudovirales_phage	98.0	2.6e-22
WP_150347232.1|1440901_1441114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167517227.1|1441174_1441327_+	hypothetical protein	NA	H2BDJ7	Pseudomonas_virus	63.6	1.9e-06
WP_073450260.1|1441331_1441631_+	HNH endonuclease	NA	A0A0R6PHK1	Moraxella_phage	61.5	5.1e-27
WP_150347233.1|1441806_1442250_+	hypothetical protein	NA	Q3HQS6	Burkholderia_phage	40.8	4.2e-09
WP_150347234.1|1442249_1443911_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	61.1	9.4e-195
WP_150347235.1|1443969_1445976_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	48.4	1.3e-150
WP_150347236.1|1446161_1446947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347237.1|1446955_1447234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347238.1|1447237_1448599_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	48.7	3.4e-126
WP_150348610.1|1448591_1449509_+|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	61.9	1.2e-47
WP_150347239.1|1449505_1449823_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B5WZS4	Pseudomonas_phage	44.4	9.3e-19
WP_150348611.1|1449825_1450158_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	68.2	3.9e-36
WP_150347240.1|1450150_1450645_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	53.9	1.5e-31
WP_150348612.1|1450644_1451010_+	DUF3168 domain-containing protein	NA	A0A1J0GUW9	Halomonas_phage	60.3	9.7e-36
WP_150347241.1|1451071_1451551_+|tail	phage tail protein	tail	A0A2H4PI27	Pseudomonas_phage	56.5	9.4e-47
WP_150347242.1|1451547_1451898_+|tail	phage tail protein	tail	Q9MCA4	Pseudomonas_phage	72.4	2.8e-40
WP_150347243.1|1451930_1452194_+	hypothetical protein	NA	A0A0U4J8S9	Pseudomonas_phage	59.8	2.4e-20
WP_150347244.1|1452208_1452526_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	31.8	2.6e-05
WP_150347245.1|1452537_1452819_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	42.6	6.5e-08
WP_150347246.1|1452904_1455259_+|tail	phage tail tape measure protein	tail	A0A0H5AWE4	Pseudomonas_phage	43.2	1.1e-92
WP_150347247.1|1455255_1455747_+	DUF1833 family protein	NA	A0A2H4J983	uncultured_Caudovirales_phage	68.1	3.4e-60
WP_150347248.1|1455743_1456145_+	hypothetical protein	NA	Q9MC96	Pseudomonas_phage	40.2	1.4e-16
WP_167517228.1|1456134_1458879_+	hypothetical protein	NA	A0A2H4J0V9	uncultured_Caudovirales_phage	66.7	0.0e+00
1465025:1465083	attR	GGGACTTAAAATCCCTCGGAGGAAACTCCGTGCCGGTTCGATTCCGGCTCCGGGCACCA	NA	NA	NA	NA
>prophage 3
NZ_CP044086	Pseudomonas luteola strain FDAARGOS_637 chromosome 1, complete sequence	4273365	1473225	1519992	4273365	tail,transposase,coat,terminase,integrase,capsid	uncultured_Caudovirales_phage(80.7%)	71	1473099:1473147	1518619:1518667
1473099:1473147	attL	TGCATGGGGTGCAAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCAA	NA	NA	NA	NA
WP_150347255.1|1473225_1474395_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	71.3	8.1e-161
WP_167517229.1|1474976_1475147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347198.1|1475246_1475591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347256.1|1475705_1475957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347200.1|1476066_1476294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347201.1|1476286_1476841_-	DUF629 domain-containing protein	NA	NA	NA	NA	NA
WP_167517220.1|1476833_1477004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347202.1|1477193_1478060_-	hypothetical protein	NA	A0A2H4J418	uncultured_Caudovirales_phage	100.0	1.7e-176
WP_167517221.1|1478093_1478255_-	hypothetical protein	NA	A0A2H4J135	uncultured_Caudovirales_phage	100.0	2.6e-17
WP_150347257.1|1478267_1478456_-	hypothetical protein	NA	A0A2H4J9E3	uncultured_Caudovirales_phage	100.0	8.5e-28
WP_150347258.1|1478470_1478677_-	hypothetical protein	NA	A0A2H4J113	uncultured_Caudovirales_phage	100.0	2.4e-31
WP_150347259.1|1478684_1479287_-	ERF family protein	NA	A0A2H4J2M9	uncultured_Caudovirales_phage	100.0	2.5e-105
WP_150347260.1|1479283_1479553_-	hypothetical protein	NA	A0A2H4J8P8	uncultured_Caudovirales_phage	100.0	1.5e-46
WP_150347261.1|1479612_1479885_-	hypothetical protein	NA	A0A2H4J5S5	uncultured_Caudovirales_phage	100.0	3.4e-46
WP_150347262.1|1480005_1480578_-	hypothetical protein	NA	A0A2H4J878	uncultured_Caudovirales_phage	100.0	2.4e-113
WP_150347263.1|1480574_1480835_-	hypothetical protein	NA	A0A2H4J123	uncultured_Caudovirales_phage	100.0	3.2e-41
WP_073450199.1|1480834_1481131_-	hypothetical protein	NA	A0A2H4J410	uncultured_Caudovirales_phage	100.0	3.4e-47
WP_167517230.1|1481117_1481264_-	hypothetical protein	NA	A0A2H4J127	uncultured_Caudovirales_phage	95.8	1.2e-16
WP_150347264.1|1481762_1481960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347265.1|1482263_1482452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150347266.1|1482520_1482727_-	hypothetical protein	NA	A0A2H4J2M2	uncultured_Caudovirales_phage	91.2	2.1e-35
WP_150347267.1|1482723_1482930_-	hypothetical protein	NA	A0A2H4J8N9	uncultured_Caudovirales_phage	98.5	8.1e-32
WP_150347268.1|1483593_1483836_-	DUF1654 domain-containing protein	NA	A0A0S2SYC9	Pseudomonas_phage	36.9	3.3e-08
WP_150347269.1|1483933_1484581_-	helix-turn-helix domain-containing protein	NA	A0A2H4J8I0	uncultured_Caudovirales_phage	64.5	3.0e-48
WP_150348614.1|1484680_1484866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347270.1|1484891_1485095_+	hypothetical protein	NA	A0A2H4J115	uncultured_Caudovirales_phage	100.0	1.5e-30
WP_150347271.1|1485438_1485669_+	hypothetical protein	NA	A0A2H4J9B6	uncultured_Caudovirales_phage	91.9	4.0e-11
WP_150347272.1|1486476_1487274_+	ATP-binding protein	NA	A0A2H4J2L2	uncultured_Caudovirales_phage	98.1	8.3e-149
WP_150347273.1|1487270_1488626_+	AAA family ATPase	NA	A0A2H4J8N1	uncultured_Caudovirales_phage	100.0	4.0e-252
WP_150347274.1|1488625_1488931_+	hypothetical protein	NA	A0A2H4J5Q4	uncultured_Caudovirales_phage	100.0	2.0e-50
WP_150347275.1|1488974_1489241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347276.1|1489237_1489429_+	hypothetical protein	NA	A0A2H4J858	uncultured_Caudovirales_phage	98.4	2.4e-30
WP_150347278.1|1489681_1490152_+	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	100.0	4.8e-88
WP_150347279.1|1490148_1490463_+	DUF1364 domain-containing protein	NA	A0A2H4J3Y8	uncultured_Caudovirales_phage	98.7	2.0e-37
WP_150347280.1|1490459_1490744_+	hypothetical protein	NA	A0A2H4J993	uncultured_Caudovirales_phage	100.0	2.8e-51
WP_150347281.1|1490740_1491106_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0H5AUD2	Pseudomonas_phage	63.9	1.6e-35
WP_150347282.1|1491102_1491792_+	hypothetical protein	NA	A0A2H4J2J2	uncultured_Caudovirales_phage	100.0	7.7e-127
WP_150347227.1|1492038_1492374_+	hypothetical protein	NA	A0A2H4J8L0	uncultured_Caudovirales_phage	100.0	2.0e-40
WP_150347283.1|1492366_1492720_+	hypothetical protein	NA	A0A2H4J840	uncultured_Caudovirales_phage	100.0	3.9e-26
WP_150347284.1|1492727_1493219_+	glycoside hydrolase family 108 protein	NA	A0A2H4J0Z0	uncultured_Caudovirales_phage	100.0	2.6e-92
WP_150347285.1|1493227_1493731_+	DUF2514 domain-containing protein	NA	A0A2H4J0Y8	uncultured_Caudovirales_phage	100.0	2.6e-71
WP_150347286.1|1493793_1495386_+	glycoside hydrolase family 5 protein	NA	A0A2H4J3X4	uncultured_Caudovirales_phage	100.0	2.6e-311
WP_150347287.1|1495391_1495607_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	100.0	3.3e-36
WP_159435136.1|1495611_1495767_+	hypothetical protein	NA	A0A2H4J0W9	uncultured_Caudovirales_phage	100.0	6.7e-23
WP_150347288.1|1495766_1496291_+	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	100.0	8.3e-89
WP_150347289.1|1496293_1497778_+|terminase	terminase	terminase	A0A2H4J8J8	uncultured_Caudovirales_phage	100.0	1.6e-299
WP_150347290.1|1497777_1499226_+	DUF4055 domain-containing protein	NA	A0A2H4J5M6	uncultured_Caudovirales_phage	100.0	4.8e-280
WP_150347291.1|1499200_1500307_+|capsid	minor capsid protein	capsid	A0A2H4J831	uncultured_Caudovirales_phage	100.0	1.2e-198
WP_150347292.1|1500336_1501644_+	SGNH/GDSL hydrolase family protein	NA	A0A2H4J0Y4	uncultured_Caudovirales_phage	100.0	8.6e-252
WP_150347293.1|1502450_1503473_+|coat	coat protein	coat	A0A2H4J3W6	uncultured_Caudovirales_phage	100.0	5.2e-188
WP_150347294.1|1503554_1503875_+	hypothetical protein	NA	A0A2H4J0Y2	uncultured_Caudovirales_phage	100.0	4.6e-50
WP_150347295.1|1503880_1504381_+	hypothetical protein	NA	A0A2H4J970	uncultured_Caudovirales_phage	100.0	1.0e-88
WP_150347296.1|1504382_1504748_+	hypothetical protein	NA	A0A2H4J5T3	uncultured_Caudovirales_phage	100.0	2.7e-62
WP_150347297.1|1504744_1505191_+	HK97 gp10 family phage protein	NA	A0A2H4J887	uncultured_Caudovirales_phage	100.0	1.7e-79
WP_150347298.1|1505187_1505601_+	hypothetical protein	NA	A0A2H4J130	uncultured_Caudovirales_phage	90.4	9.8e-61
WP_150347299.1|1505671_1506316_+|tail	phage tail protein	tail	A0A2H4J6K6	uncultured_Caudovirales_phage	63.3	2.0e-68
WP_150347300.1|1506324_1506639_+	hypothetical protein	NA	A0A0S2SYT8	Pseudomonas_phage	52.4	1.3e-25
WP_150347301.1|1506692_1506956_+	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	52.4	4.5e-19
WP_150347302.1|1506966_1507263_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_150348615.1|1507259_1507625_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	40.0	4.0e-05
WP_150347303.1|1507859_1508249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347304.1|1508301_1511124_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	51.6	1.1e-187
WP_150347305.1|1511142_1511727_+	hypothetical protein	NA	A0A2H4IYI9	uncultured_Caudovirales_phage	63.9	8.1e-69
WP_150347306.1|1511726_1512326_+	hypothetical protein	NA	A0A059VA31	Pseudomonas_phage	78.8	2.7e-91
WP_150347307.1|1512329_1512728_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	70.5	2.3e-54
WP_150347308.1|1512727_1515763_+	DUF1983 domain-containing protein	NA	A0A059VFW9	Pseudomonas_phage	59.9	0.0e+00
WP_150347309.1|1515762_1516044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347310.1|1516040_1516748_+	hypothetical protein	NA	A0A0A0YT77	Pseudomonas_phage	32.7	1.7e-12
WP_150347311.1|1516759_1517212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347312.1|1517929_1518373_+	DUF1353 domain-containing protein	NA	A0A2H4P720	Pseudomonas_phage	52.0	1.7e-26
WP_112297852.1|1518775_1519992_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	89.0	3.8e-145
1518619:1518667	attR	TGCATGGGGTGCAAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCAA	NA	NA	NA	NA
>prophage 4
NZ_CP044086	Pseudomonas luteola strain FDAARGOS_637 chromosome 1, complete sequence	4273365	1723619	1733585	4273365		uncultured_Caudovirales_phage(62.5%)	10	NA	NA
WP_150347395.1|1723619_1724513_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	37.1	1.2e-47
WP_150347396.1|1724985_1725456_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	41.2	8.7e-21
WP_010798306.1|1726101_1726416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150347397.1|1726499_1727114_-	cyclodeaminase/cyclohydrolase family protein	NA	NA	NA	NA	NA
WP_150347398.1|1727263_1727620_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	60.2	1.4e-34
WP_150347399.1|1727650_1728934_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	79.8	2.7e-189
WP_150347400.1|1728949_1729417_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	61.9	1.2e-49
WP_125888468.1|1729454_1730141_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	86.7	2.5e-109
WP_150347401.1|1730125_1731187_-	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	63.4	3.5e-102
WP_150347402.1|1731362_1733585_+	GAF domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	22.1	1.0e-26
>prophage 5
NZ_CP044086	Pseudomonas luteola strain FDAARGOS_637 chromosome 1, complete sequence	4273365	2164799	2172622	4273365		Escherichia_phage(66.67%)	7	NA	NA
WP_150347637.1|2164799_2165729_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D8EQE2	Escherichia_phage	34.0	3.3e-32
WP_150348640.1|2165725_2166262_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	62.6	5.4e-59
WP_010797914.1|2166261_2167143_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	65.2	5.6e-106
WP_074825235.1|2167205_2168270_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.9	4.0e-98
WP_074825233.1|2168610_2170599_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	25.4	3.4e-18
WP_150347638.1|2170643_2171663_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010797910.1|2171662_2172622_-	SDR family oxidoreductase	NA	Q58M85	Prochlorococcus_phage	26.0	3.3e-11
>prophage 1
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	0	6545	585976		Salmonella_phage(100.0%)	5	NA	NA
WP_150345602.1|1340_1817_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_150345603.1|1816_2281_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_150345604.1|3181_3925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010799261.1|4331_5060_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_150345605.1|5417_6545_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	40.3	8.7e-19
>prophage 2
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	10427	16775	585976		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_150345610.1|10427_16775_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.1	8.4e-42
>prophage 3
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	24019	32221	585976	transposase	Bodo_saltans_virus(33.33%)	4	NA	NA
WP_010799245.1|24019_25624_-	SAM-dependent DNA methyltransferase	NA	A0A2H4UVB0	Bodo_saltans_virus	31.6	1.7e-20
WP_150345615.1|25667_29054_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	26.6	1.2e-15
WP_150345902.1|29102_30527_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_112297486.1|31240_32221_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.7	3.2e-94
>prophage 4
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	43650	52959	585976		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_167517143.1|43650_45486_+	hypothetical protein	NA	M1HM59	Paramecium_bursaria_Chlorella_virus	34.0	1.2e-30
WP_150345623.1|45612_46041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345624.1|46086_49497_-	TM0106 family RecB-like putative nuclease	NA	X4XVM6	Casuarina_virus	23.3	7.7e-10
WP_150345625.1|49734_50328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345626.1|50835_52959_+	AAA family ATPase	NA	A0A0R6PCP6	Moraxella_phage	32.2	1.7e-15
>prophage 5
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	74005	75508	585976		Vibrio_phage(100.0%)	1	NA	NA
WP_150345636.1|74005_75508_-	AAA family ATPase	NA	A0A2I7RIK5	Vibrio_phage	33.0	4.7e-52
>prophage 6
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	86472	92999	585976	transposase	Lactobacillus_phage(25.0%)	7	NA	NA
WP_010799181.1|86472_87270_+	AAA family ATPase	NA	E9LUK9	Lactobacillus_phage	29.0	4.6e-14
WP_150345642.1|87266_88235_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	38.2	2.4e-09
WP_010799179.1|88235_89078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167517144.1|89097_89241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085985622.1|90303_91453_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	66.7	2.2e-102
WP_150345643.1|91545_91761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150345644.1|91940_92999_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	31.0	4.6e-38
>prophage 7
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	98084	98975	585976		Lactobacillus_phage(100.0%)	1	NA	NA
WP_150345649.1|98084_98975_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	28.2	7.9e-15
>prophage 8
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	108434	109211	585976		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_150345660.1|108434_109211_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.0	4.6e-11
>prophage 9
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	112378	113440	585976		Wolbachia_phage(100.0%)	1	NA	NA
WP_150345663.1|112378_113440_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	58.6	8.9e-114
>prophage 10
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	120133	121699	585976		Salmonella_phage(100.0%)	1	NA	NA
WP_150345671.1|120133_121699_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	53.0	4.4e-45
>prophage 11
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	125079	126978	585976		Bacillus_virus(100.0%)	1	NA	NA
WP_150345675.1|125079_126978_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	37.3	8.9e-24
>prophage 12
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	130084	147375	585976	integrase,transposase	Shigella_phage(28.57%)	15	130133:130149	145267:145283
WP_150345680.1|130084_131620_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	6.1e-15
130133:130149	attL	CAGCAGCTCGGACTGGC	NA	NA	NA	NA
WP_150345681.1|131942_133436_+	response regulator	NA	A0A1V0SGX0	Hokovirus	23.0	4.1e-08
WP_084213930.1|133618_133855_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010799403.1|134683_135004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010799402.1|135067_136267_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	42.0	4.0e-78
WP_150345682.1|136263_136779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345683.1|136858_137335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345684.1|137511_138507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125890151.1|138826_139099_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	55.1	1.2e-17
WP_125890152.1|139124_139859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125890154.1|141002_143000_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	1.5e-29
WP_125890153.1|143388_143793_+	response regulator	NA	NA	NA	NA	NA
WP_085985622.1|144398_145548_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	66.7	2.2e-102
145267:145283	attR	CAGCAGCTCGGACTGGC	NA	NA	NA	NA
WP_150345685.1|145545_145836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345686.1|145839_147375_-	hypothetical protein	NA	A0A0H4IPK0	Shigella_phage	33.1	2.2e-12
>prophage 13
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	151779	159342	585976		Ralstonia_phage(25.0%)	10	NA	NA
WP_150345691.1|151779_152802_-	endonuclease	NA	U6C712	Ralstonia_phage	24.4	1.6e-06
WP_150345692.1|152892_153939_-	phage recombination protein Bet	NA	A0A0S2SY88	Pseudomonas_phage	53.5	9.2e-47
WP_150345693.1|154160_154706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345694.1|154790_155339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345695.1|155352_156336_-	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	31.4	2.9e-26
WP_150345696.1|156644_157010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345697.1|157372_157807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150345698.1|157901_158081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010799380.1|158287_158467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345699.1|159018_159342_+	hypothetical protein	NA	A0A1B1IUF2	uncultured_Mediterranean_phage	41.9	7.8e-13
>prophage 14
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	174322	174592	585976		Pseudomonas_phage(100.0%)	1	NA	NA
WP_150345712.1|174322_174592_-	hypothetical protein	NA	A0A0U4JX18	Pseudomonas_phage	44.9	3.1e-15
>prophage 15
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	189936	193217	585976		Streptococcus_phage(50.0%)	2	NA	NA
WP_167517166.1|189936_192159_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	28.0	1.0e-34
WP_167517149.1|192161_193217_+	S49 family peptidase	NA	E5AFY0	Erwinia_phage	25.8	4.4e-12
>prophage 16
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	202532	204296	585976		Bifidobacterium_phage(100.0%)	1	NA	NA
WP_167517150.1|202532_204296_+	PRTRC system ParB family protein	NA	I3NLC2	Bifidobacterium_phage	37.3	4.7e-11
>prophage 17
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	210889	235019	585976	integrase,transposase	uncultured_Caudovirales_phage(44.44%)	37	207783:207796	213282:213295
207783:207796	attL	GTCGATTGCCACGC	NA	NA	NA	NA
WP_010791757.1|210889_212572_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
WP_150345736.1|212574_213483_+	AAA family ATPase	NA	NA	NA	NA	NA
213282:213295	attR	GTCGATTGCCACGC	NA	NA	NA	NA
WP_000801210.1|213479_214697_+	TniQ family protein	NA	NA	NA	NA	NA
WP_000904941.1|214757_215372_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
WP_001087809.1|215424_215661_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003465059.1|215657_216023_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000136268.1|216039_217686_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_000654684.1|217682_217928_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000735441.1|217930_218206_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294667.1|218221_218572_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429838.1|218643_219078_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_019367236.1|219316_219760_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	46.7	1.9e-22
WP_083848906.1|219752_219887_+	DNA-directed DNA polymerase	NA	A0A218MNF2	uncultured_virus	73.5	8.2e-09
WP_019367235.1|219987_220539_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	83.8	6.1e-82
WP_019367234.1|220609_221680_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	81.7	7.3e-132
WP_019367233.1|221719_222142_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	82.1	1.5e-61
WP_019367232.1|222168_222882_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	91.6	1.0e-121
WP_019367231.1|222929_223400_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	85.9	5.0e-69
WP_019367230.1|223416_224700_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	89.9	5.5e-211
WP_019367229.1|224725_225082_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	85.8	8.5e-53
WP_167517151.1|225806_225968_+	DNA-directed DNA polymerase	NA	A0A218MNF2	uncultured_virus	68.0	4.7e-11
WP_125913034.1|226076_226943_+	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	44.8	7.6e-63
WP_026004153.1|226980_227232_-	DUF1654 domain-containing protein	NA	A0A2H4J8G7	uncultured_Caudovirales_phage	49.4	3.5e-13
WP_026004152.1|227338_227602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019367224.1|227788_228400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150345737.1|228399_229455_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	37.1	3.3e-28
WP_150345738.1|229431_229890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019364534.1|229873_230278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019364533.1|230343_230646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019364532.1|230809_230992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019364531.1|231039_231459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026003782.1|231528_231801_-	DUF4326 domain-containing protein	NA	A0A160DCT3	Gordonia_phage	44.6	1.0e-18
WP_019364529.1|231992_232148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019364528.1|232195_232459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345739.1|232463_232892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345740.1|232946_233810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085985622.1|233869_235019_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	66.7	2.2e-102
>prophage 18
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	242175	247913	585976		Bacillus_phage(66.67%)	6	NA	NA
WP_016487025.1|242175_242850_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	4.6e-31
WP_004576066.1|242846_244265_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	6.5e-19
WP_004576065.1|244323_244911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003253450.1|245177_245399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004576064.1|245481_246936_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_033726583.1|246929_247913_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	39.2	5.4e-49
>prophage 19
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	252807	258654	585976		Streptococcus_phage(50.0%)	3	NA	NA
WP_004576057.1|252807_254805_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.3	3.6e-116
WP_004576056.1|255006_255330_-	DUF2790 domain-containing protein	NA	NA	NA	NA	NA
WP_004576055.1|255492_258654_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.9	5.4e-74
>prophage 20
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	263506	265385	585976	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_150345742.1|263506_264127_+	response regulator	NA	W8CYM9	Bacillus_phage	33.2	2.4e-18
WP_004574636.1|264095_265385_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
>prophage 21
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	269058	270208	585976	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085983004.1|269058_270208_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	65.9	1.2e-100
>prophage 22
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	278118	281268	585976		Leptospira_phage(100.0%)	1	NA	NA
WP_004374632.1|278118_281268_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.1	1.6e-54
>prophage 23
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	288468	289449	585976	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_014003920.1|288468_289449_+|transposase	IS5-like element ISPa41 family transposase	transposase	Q38213	Escherichia_phage	59.2	1.4e-102
>prophage 24
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	295723	302447	585976		Bacillus_phage(66.67%)	7	NA	NA
WP_023662984.1|295723_298084_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.6	8.1e-83
WP_003246761.1|298089_298338_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004577569.1|298417_298951_-	cupredoxin family protein	NA	NA	NA	NA	NA
WP_004577570.1|299098_299656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016487037.1|299823_300183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004577572.1|300390_301068_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.1	8.6e-30
WP_004577573.1|301064_302447_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	8.5e-16
>prophage 25
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	309176	327096	585976	transposase	Bacillus_phage(33.33%)	16	NA	NA
WP_004574524.1|309176_310859_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	1.9e-38
WP_004574523.1|310879_311296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004574522.1|311295_311658_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_004574521.1|311650_311887_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_004574520.1|312010_312223_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_004574519.1|312360_315357_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	48.3	9.1e-265
WP_004574518.1|315360_315771_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_004574517.1|315770_316010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004574516.1|316211_317138_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.4	1.8e-41
WP_073450589.1|317903_319121_-	TolC family protein	NA	NA	NA	NA	NA
WP_010799563.1|319608_320283_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.7	2.6e-34
WP_150345745.1|320279_321707_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	7.4e-23
WP_150345746.1|321716_322622_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_150345747.1|322799_323444_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010799567.1|323578_323935_-	copper-binding protein	NA	NA	NA	NA	NA
WP_150345748.1|323931_327096_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	20.1	2.4e-53
>prophage 26
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	330350	332442	585976		Bacillus_phage(100.0%)	2	NA	NA
WP_150345750.1|330350_331760_-	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.1	2.8e-14
WP_150345751.1|331752_332442_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	1.5e-29
>prophage 27
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	338633	339779	585976	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
WP_150345754.1|338633_339779_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	74.5	2.4e-157
>prophage 28
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	355188	410540	585976	integrase,transposase	Bacillus_phage(12.5%)	54	405928:405945	414385:414402
WP_150345758.1|355188_356691_-	AAA family ATPase	NA	A0A126DN25	Acinetobacter_phage	33.3	2.0e-50
WP_150345759.1|357283_360298_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.8	5.0e-69
WP_019365448.1|360294_360657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019365447.1|360782_361409_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_026003894.1|361718_364082_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.0	3.7e-59
WP_019365444.1|364747_365104_+	copper-binding protein	NA	NA	NA	NA	NA
WP_019365443.1|365241_365559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019365442.1|365591_365849_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_150345760.1|365872_366136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085985621.1|366161_367014_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	45.0	5.4e-21
WP_019365440.1|367115_368489_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	4.5e-17
WP_019365439.1|368594_370304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019365438.1|370816_371272_+	DUF305 domain-containing protein	NA	W6GVI1	Samba_virus	40.8	1.5e-06
WP_150345761.1|371558_372593_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	30.3	2.6e-09
WP_019365436.1|372970_373300_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_019365435.1|373775_374585_-	cytochrome c	NA	NA	NA	NA	NA
WP_026003893.1|374594_375593_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_019365433.1|375582_375885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345762.1|375897_377751_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_112297486.1|377863_378844_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.7	3.2e-94
WP_019366369.1|379513_379723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019366370.1|380145_380826_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	1.5e-29
WP_019366371.1|380916_382230_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_019366372.1|382251_382995_-	phage Gp37/Gp68 family protein	NA	A0A088F7U1	Mycobacterium_phage	44.2	2.7e-61
WP_019366373.1|383024_383996_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_019366374.1|384174_385206_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_019366375.1|385308_385617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019365854.1|385900_386317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019365855.1|386306_386552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150345763.1|386631_387678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345764.1|387738_388701_-	replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_019365327.1|389138_389354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150345765.1|389489_389729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019364813.1|390142_391324_+	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	27.3	5.2e-30
WP_019364814.1|391323_392421_+	ParB/RepB/Spo0J family partition protein	NA	A0A240F4U0	Ochrobactrum_phage	30.0	9.1e-13
WP_100217720.1|392696_393791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019364817.1|393970_394186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150345766.1|394187_395768_+	exodeoxyribonuclease VII large subunit	NA	M1NLU2	Moumouvirus	33.7	3.9e-17
WP_019364509.1|395896_396628_+	DUF4145 domain-containing protein	NA	A0A1L2JZ52	Aeribacillus_phage	36.3	6.9e-33
WP_150345767.1|396676_398452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019364511.1|398541_398865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345768.1|399122_399644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150345769.1|399861_400047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345770.1|400162_400555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345909.1|400569_400863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345771.1|400977_401451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345772.1|401743_402514_+	protein KlaA	NA	NA	NA	NA	NA
WP_150345773.1|402533_403655_+	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_150345774.1|403651_404659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150345775.1|404694_405213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150345776.1|405285_405660_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
405928:405945	attL	GGCCAATGGCATTGCCGG	NA	NA	NA	NA
WP_150345777.1|406426_407500_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S6L1B6	Ralstonia_phage	40.3	1.7e-59
WP_167517154.1|407652_408291_-	EcsC family protein	NA	NA	NA	NA	NA
WP_150345780.1|409025_410540_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	51.8	3.4e-143
414385:414402	attR	CCGGCAATGCCATTGGCC	NA	NA	NA	NA
>prophage 29
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	435031	444685	585976	integrase,transposase	Shigella_phage(25.0%)	10	424219:424232	448016:448029
424219:424232	attL	GGGAAGCCTTGCTG	NA	NA	NA	NA
WP_085985622.1|435031_436182_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	66.7	2.2e-102
WP_150345796.1|436340_436931_+	response regulator	NA	NA	NA	NA	NA
WP_010799403.1|438177_438498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150345797.1|438561_439761_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	40.6	1.2e-74
WP_150345798.1|439921_441097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345799.1|441236_441509_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	55.1	2.3e-18
WP_150345800.1|441534_442269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345801.1|442428_442806_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_150345802.1|442870_443164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345803.1|443167_444685_-	hypothetical protein	NA	A0A1B5FPA8	Escherichia_phage	37.9	8.2e-12
448016:448029	attR	GGGAAGCCTTGCTG	NA	NA	NA	NA
>prophage 30
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	449561	453969	585976		Ralstonia_phage(33.33%)	5	NA	NA
WP_150345809.1|449561_450584_-	endonuclease	NA	U6C712	Ralstonia_phage	24.3	1.0e-05
WP_150345810.1|450675_451710_-	phage recombination protein Bet	NA	A0A0H5BBT9	Pseudomonas_phage	55.3	8.2e-48
WP_150345811.1|451805_452348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345812.1|452432_452978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345813.1|452994_453969_-	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	31.1	3.7e-26
>prophage 31
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	458054	458378	585976		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_150345816.1|458054_458378_+	hypothetical protein	NA	A0A1B1IUF2	uncultured_Mediterranean_phage	41.9	3.5e-13
>prophage 32
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	470708	470978	585976		Pseudomonas_phage(100.0%)	1	NA	NA
WP_125890181.1|470708_470978_-	hypothetical protein	NA	A0A0U1W088	Pseudomonas_phage	46.1	3.1e-15
>prophage 33
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	486045	489326	585976		Streptococcus_phage(50.0%)	2	NA	NA
WP_167517168.1|486045_488268_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	28.0	1.2e-35
WP_167517157.1|488270_489326_+	S49 family peptidase	NA	E5AFY0	Erwinia_phage	25.8	5.7e-12
>prophage 34
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	494184	499155	585976		Aureococcus_anophage(100.0%)	1	NA	NA
WP_150345836.1|494184_499155_-	AAA family ATPase	NA	A0A076FFX0	Aureococcus_anophage	20.1	4.3e-09
>prophage 35
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	505888	506869	585976	transposase	Ralstonia_phage(100.0%)	1	NA	NA
WP_112297486.1|505888_506869_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.7	3.2e-94
>prophage 36
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	512826	514593	585976		Bifidobacterium_phage(100.0%)	1	NA	NA
WP_150345845.1|512826_514593_+	PRTRC system ParB family protein	NA	I3NLC2	Bifidobacterium_phage	38.1	4.3e-12
>prophage 37
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	526588	538962	585976	transposase	Erysipelothrix_phage(16.67%)	15	NA	NA
WP_004574524.1|526588_528271_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	1.9e-38
WP_004574523.1|528291_528708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004574522.1|528707_529070_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_004574521.1|529062_529299_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_004574520.1|529422_529635_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_004574519.1|529772_532769_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	48.3	9.1e-265
WP_004574518.1|532772_533183_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_004574517.1|533182_533422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004574516.1|533623_534550_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.4	1.8e-41
WP_150345857.1|534708_535986_+	MFS transporter	NA	NA	NA	NA	NA
WP_125889998.1|536311_536866_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	64.3	1.6e-61
WP_150345858.1|536913_537996_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_150345916.1|538072_538174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150345859.1|538375_538666_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	41.7	1.6e-09
WP_150345860.1|538662_538962_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	60.0	9.7e-26
>prophage 38
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	552099	552555	585976		Lactobacillus_phage(100.0%)	1	NA	NA
WP_150345870.1|552099_552555_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	29.2	6.9e-07
>prophage 39
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	559899	562211	585976		Gordonia_phage(50.0%)	2	NA	NA
WP_150345920.1|559899_560184_-	DUF4326 domain-containing protein	NA	A0A160DCT3	Gordonia_phage	45.0	1.9e-18
WP_150345883.1|560510_562211_-	DUF4942 domain-containing protein	NA	A0A059VA49	Pseudomonas_phage	49.9	1.6e-144
>prophage 40
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	573055	573912	585976		Wolbachia_phage(50.0%)	2	NA	NA
WP_150345890.1|573055_573556_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	30.4	8.9e-16
WP_010799281.1|573636_573912_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	56.2	6.2e-19
>prophage 41
NZ_CP044084	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence	585976	577128	578661	585976		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_150345895.1|577128_578661_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	2.1e-07
>prophage 1
NZ_CP044087	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed2	120674	2824	92331	120674	plate,holin,terminase,protease,portal,transposase,tail,lysis,head,capsid	uncultured_Caudovirales_phage(45.07%)	113	NA	NA
WP_150348712.1|2824_4108_-|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	59.2	2.8e-82
WP_150348713.1|4104_4713_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	65.8	3.3e-73
WP_150348714.1|5625_5967_-|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	57.7	1.3e-29
WP_150348715.1|5963_6521_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	58.8	6.6e-52
WP_167517301.1|6624_7008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150348717.1|7783_8311_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	61.5	2.1e-55
WP_150348718.1|8843_9053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348798.1|9857_10178_-|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	50.0	1.8e-17
WP_150348719.1|10204_10426_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	61.4	7.2e-18
WP_150348720.1|10425_10887_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	50.0	4.2e-36
WP_004574517.1|12967_13207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004574518.1|13206_13617_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_004574519.1|13620_16617_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	48.3	9.1e-265
WP_004574520.1|16754_16967_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_004574521.1|17090_17327_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_004574522.1|17319_17682_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_004574523.1|17681_18098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004574524.1|18118_19801_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	1.9e-38
WP_004574525.1|19813_20245_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_004574526.1|20257_20536_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_004574527.1|20549_20900_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_004574528.1|20971_21391_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004574529.1|21543_21762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348721.1|21840_22038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150348722.1|22046_22835_-	hypothetical protein	NA	A0A219YA47	Aeromonas_phage	31.4	1.2e-09
WP_150348723.1|24106_24982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348724.1|25043_25406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167517302.1|25402_25684_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_150348799.1|25813_26260_-	hypothetical protein	NA	A0A2H4JG61	uncultured_Caudovirales_phage	63.2	6.7e-47
WP_010799797.1|26322_26538_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	66.1	7.2e-15
WP_150348726.1|26629_26974_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	55.8	7.2e-25
WP_010799795.1|27040_27499_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_150348727.1|27696_28971_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	70.3	1.6e-165
WP_150348728.1|28967_29408_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	68.5	6.2e-53
WP_150348729.1|29414_32015_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	33.7	1.1e-104
WP_010799791.1|32001_32124_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	71.1	2.2e-08
WP_150348730.1|32132_32465_-|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	59.1	5.2e-20
WP_150348731.1|32544_33060_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	73.7	6.5e-70
WP_150348732.1|33109_34276_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	71.0	5.6e-154
WP_010799787.1|34373_34901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348800.1|35216_35654_-	hypothetical protein	NA	A0A2H4J973	uncultured_Caudovirales_phage	54.7	1.6e-40
WP_150348733.1|35653_36235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167517303.1|36246_37566_-|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	59.2	3.8e-82
WP_150348734.1|37562_38171_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	65.8	5.7e-73
WP_150348735.1|38167_39085_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	61.8	9.4e-96
WP_150348736.1|39086_39428_-|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	58.6	9.7e-30
WP_150348737.1|39424_39976_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	55.4	3.6e-50
WP_150348738.1|40110_41106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150348739.1|41090_41543_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	58.5	6.1e-40
WP_150348740.1|41539_42076_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	62.9	2.1e-55
WP_167517304.1|42068_42212_-	hypothetical protein	NA	A0A2H4JCP0	uncultured_Caudovirales_phage	51.2	9.0e-06
WP_150348741.1|42171_42615_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	33.3	1.7e-05
WP_150348742.1|42611_42821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348743.1|42820_43630_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	63.2	1.2e-83
WP_150348801.1|43626_43947_-|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	50.0	1.8e-17
WP_010799811.1|43973_44195_-|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	62.9	2.5e-18
WP_150348744.1|44194_44656_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	53.8	3.1e-39
WP_150348745.1|44756_45455_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	67.3	1.2e-74
WP_150348746.1|45458_46490_-|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	75.9	1.4e-143
WP_150348747.1|46518_47361_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	55.6	2.7e-73
WP_150348748.1|47540_49301_+|terminase	terminase ATPase subunit family protein	terminase	A0A2H4JGK4	uncultured_Caudovirales_phage	83.6	1.9e-286
WP_150348749.1|49300_50329_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	78.0	1.5e-150
WP_150348750.1|50592_50922_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_150348751.1|51040_51325_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	71.0	9.5e-31
WP_150348752.1|51482_52220_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_150348753.1|52458_53886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348754.1|54086_54479_-	GFA family protein	NA	NA	NA	NA	NA
WP_150348755.1|54746_55022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010799301.1|55985_56222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348756.1|56562_57411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150348757.1|58240_58891_+	recombinase family protein	NA	NA	NA	NA	NA
WP_150348758.1|59267_61064_-|protease	trypsin-like serine protease	protease	Q7M2A9	Enterobacteria_phage	37.0	7.4e-12
WP_150348760.1|61760_62492_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_150348761.1|63106_63397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348762.1|63393_64062_-	AAA family ATPase	NA	E5FFJ3	Burkholderia_phage	47.4	7.2e-45
WP_150348763.1|65041_65920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348764.1|65980_66343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167517305.1|66339_66621_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_150348802.1|66754_67201_-	PTS sugar transporter subunit IIA	NA	A0A2H4JG61	uncultured_Caudovirales_phage	63.4	5.7e-46
WP_150348766.1|67263_67476_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	58.2	1.3e-08
WP_150348767.1|67529_67889_+	transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	42.7	2.9e-16
WP_150348803.1|68361_68685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348768.1|68725_69997_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	69.6	3.6e-162
WP_150348769.1|69993_70434_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	69.9	7.3e-54
WP_150348770.1|70440_73167_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	33.6	3.1e-110
WP_010799791.1|73153_73276_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	71.1	2.2e-08
WP_150348771.1|73284_73623_-|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	61.2	9.0e-20
WP_150348772.1|73701_74217_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	76.6	2.0e-71
WP_150348773.1|74265_75432_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	69.9	1.2e-151
WP_150348774.1|75569_76097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348796.1|76100_76433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348797.1|77458_77896_-	hypothetical protein	NA	A0A2H4J973	uncultured_Caudovirales_phage	55.4	2.4e-41
WP_150348775.1|77895_78477_-	hypothetical protein	NA	R9U4D4	Rhizobium_phage	42.3	1.5e-19
WP_150348776.1|78488_79808_-|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	59.2	2.9e-82
WP_150348713.1|79804_80413_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	65.8	3.3e-73
WP_150348804.1|80409_81327_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	62.8	2.5e-96
WP_150348714.1|81328_81670_-|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	57.7	1.3e-29
WP_150348715.1|81666_82224_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	58.8	6.6e-52
WP_150348777.1|82334_82877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150348778.1|83036_83489_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	58.0	1.0e-39
WP_150348717.1|83491_84019_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	61.5	2.1e-55
WP_167517306.1|84011_84155_-	hypothetical protein	NA	A0A2H4JCP0	uncultured_Caudovirales_phage	53.7	2.4e-06
WP_167517307.1|84114_84558_-|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	43.3	2.9e-18
WP_150348718.1|84554_84764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348780.1|84763_85573_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	63.0	1.1e-82
WP_150348798.1|85569_85890_-|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	50.0	1.8e-17
WP_150348719.1|85916_86138_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	61.4	7.2e-18
WP_150348720.1|86137_86599_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	50.0	4.2e-36
WP_150348781.1|86700_87399_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	67.7	9.1e-75
WP_004574516.1|87553_88480_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.4	1.8e-41
WP_004574517.1|88681_88921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004574518.1|88920_89331_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_004574519.1|89334_92331_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	48.3	9.1e-265
>prophage 2
NZ_CP044087	Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed2	120674	97595	106244	120674	terminase,portal,capsid	uncultured_Caudovirales_phage(62.5%)	9	NA	NA
WP_150348782.1|97595_98537_-|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	79.5	3.1e-134
WP_150348783.1|98564_99407_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	55.2	1.0e-72
WP_150348784.1|99586_101347_+|terminase	terminase ATPase subunit family protein	terminase	A0A2H4JGK4	uncultured_Caudovirales_phage	84.0	5.0e-287
WP_150348785.1|101346_102375_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	77.5	3.3e-150
WP_150348786.1|102405_103200_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	83.5	5.6e-129
WP_150348787.1|103307_103490_+	addiction module toxin, HicA family	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	55.9	3.8e-09
WP_150348788.1|103605_104028_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	51.8	5.4e-30
WP_150348789.1|104105_105545_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_150348805.1|105920_106244_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	36.6	1.9e-06
