The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044092	Stenotrophomonas maltophilia strain FDAARGOS_649 chromosome, complete genome	4625884	1860151	1867602	4625884		Escherichia_phage(28.57%)	7	NA	NA
WP_111111844.1|1860151_1861207_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.6	6.2e-83
WP_111189305.1|1861221_1862109_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.0e-95
WP_111189306.1|1862105_1862663_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.6	1.2e-45
WP_111189307.1|1862659_1863556_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	36.8	3.7e-28
WP_111189308.1|1863649_1865053_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.4	5.5e-47
WP_150359453.1|1865064_1866411_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.2	8.5e-29
WP_099527084.1|1866645_1867602_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	48.1	5.2e-89
>prophage 2
NZ_CP044092	Stenotrophomonas maltophilia strain FDAARGOS_649 chromosome, complete genome	4625884	2251343	2362963	4625884	integrase,plate,protease,head,tail	Escherichia_phage(12.2%)	106	2285951:2285974	2331277:2331300
WP_049434066.1|2251343_2253476_-	hypothetical protein	NA	A0A076YL68	Mesorhizobium_phage	29.9	1.1e-59
WP_005412402.1|2253475_2254066_-	hypothetical protein	NA	A0A2R2ZGD2	Ralstonia_phage	41.9	1.7e-26
WP_049434069.1|2254165_2255119_-	hypothetical protein	NA	L7TJ83	Rhizobium_phage	42.4	4.1e-62
WP_049434070.1|2255145_2255931_-	hypothetical protein	NA	A0A1B1IVZ8	uncultured_Mediterranean_phage	31.1	1.1e-20
WP_005412405.1|2256091_2257648_-|head,tail	phage collar / T7-like phage head-to-tail joining protein	head,tail	L7TJ79	Rhizobium_phage	37.6	1.1e-85
WP_005412407.1|2257813_2257993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049434072.1|2258057_2258594_-	adenylate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	46.7	8.1e-31
WP_150359514.1|2258689_2259007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049397854.1|2259010_2259217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154583.1|2259204_2260038_-	hypothetical protein	NA	M1HMA9	Pelagibacter_phage	36.0	2.0e-36
WP_049434075.1|2260180_2260471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154585.1|2260467_2260716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412414.1|2260866_2261232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050483582.1|2261228_2261567_-	hypothetical protein	NA	A0A2H4P845	Pseudomonas_phage	53.2	9.6e-22
WP_065428010.1|2261548_2263423_-	DNA polymerase	NA	A0A076YNV1	Mesorhizobium_phage	48.2	8.5e-160
WP_049434078.1|2263435_2264086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412417.1|2264096_2264345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154589.1|2264510_2266142_-	toprim domain-containing protein	NA	L7TLT7	Rhizobium_phage	56.6	3.7e-151
WP_049434079.1|2266128_2266308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080101784.1|2266304_2266706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154593.1|2266702_2267065_-	putative N-acetylmuramoyl-L-alanine amidase	NA	I6Q9Z5	Yersinia_phage	40.6	2.5e-15
WP_100049893.1|2267065_2267545_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7QZP6	Vibrio_phage	31.1	1.4e-05
WP_004154595.1|2267486_2268152_-	hypothetical protein	NA	A0A076YJ33	Mesorhizobium_phage	40.9	1.5e-26
WP_049397849.1|2268309_2268594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150359515.1|2268774_2271210_-	T3/T7 RNA polymerase	NA	L7TQW5	Rhizobium_phage	40.7	3.3e-164
WP_052504338.1|2271745_2272306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043401326.1|2272596_2273892_+	trigger factor	NA	NA	NA	NA	NA
WP_004146318.1|2273968_2274595_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	7.7e-57
WP_004154600.1|2274721_2276011_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.0	2.9e-135
WP_012479268.1|2276154_2278602_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	1.5e-220
WP_005408270.1|2278819_2279092_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	62.9	4.5e-22
WP_005408271.1|2279933_2281889_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_044569572.1|2282117_2283317_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_005412427.1|2283313_2284078_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_049397081.1|2284089_2284740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005408275.1|2284753_2285206_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.4	1.0e-42
WP_005408276.1|2285210_2285942_+	DNA polymerase III subunit epsilon	NA	A0A1B2LRV5	Wolbachia_phage	42.4	3.8e-07
2285951:2285974	attL	GGTAGTGCCGGCCGCTGGCCGGCA	NA	NA	NA	NA
WP_005408277.1|2286053_2286758_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_150359516.1|2287421_2290436_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_005408281.1|2290726_2291131_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.3	1.3e-17
WP_012479274.1|2291208_2292255_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_012479275.1|2292275_2293025_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_099530082.1|2293024_2293792_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_099530081.1|2293788_2294178_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005408286.1|2294653_2294971_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_150359517.1|2295329_2306234_+	transporter	NA	NA	NA	NA	NA
WP_012479278.1|2306290_2306734_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005412437.1|2307109_2307484_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_049431274.1|2307785_2309027_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	44.1	3.0e-81
WP_080354649.1|2309921_2310143_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_080354648.1|2310139_2310649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150359518.1|2312456_2314508_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.4	2.1e-47
WP_005408298.1|2314514_2314835_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_005408299.1|2314946_2315546_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005408300.1|2315613_2315973_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_005408301.1|2316050_2316578_-	membrane protein	NA	NA	NA	NA	NA
WP_060380412.1|2316574_2318524_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_005408303.1|2318516_2319461_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_060380413.1|2319463_2320417_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_099530056.1|2320459_2322301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012479286.1|2322548_2323118_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_012479287.1|2323231_2323741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005408308.1|2323848_2324043_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_005408309.1|2324134_2325112_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_005408310.1|2325190_2325973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059033318.1|2326133_2327078_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_005408312.1|2327160_2327904_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	4.7e-13
WP_005408313.1|2328056_2328296_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	4.6e-10
WP_012479290.1|2328439_2329702_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_111193434.1|2329916_2331281_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_049403323.1|2331478_2332540_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
2331277:2331300	attR	GGTAGTGCCGGCCGCTGGCCGGCA	NA	NA	NA	NA
WP_005412450.1|2332536_2333202_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	34.9	5.5e-21
WP_150359519.1|2333198_2334155_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_004146965.1|2334151_2334505_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_143569501.1|2334898_2336233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099497681.1|2336243_2338124_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_099497682.1|2338859_2339267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099497683.1|2339290_2340037_+	hypothetical protein	NA	A0A291AUW2	Sinorhizobium_phage	37.3	4.7e-29
WP_099497684.1|2340046_2340745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143598847.1|2341400_2341601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099497686.1|2342112_2342676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099497687.1|2342728_2343136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099497688.1|2343703_2344084_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_099497689.1|2344164_2345238_-	phage late control D family protein	NA	D5LGY1	Escherichia_phage	51.0	1.1e-92
WP_049430174.1|2345228_2345444_-|tail	tail protein	tail	NA	NA	NA	NA
WP_049430173.1|2345427_2345895_-|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	29.6	2.2e-08
WP_099497690.1|2345897_2348345_-|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	22.4	3.5e-28
WP_005412456.1|2348465_2348756_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	58.5	1.5e-18
WP_057501934.1|2348836_2349340_-|tail	phage major tail tube protein	tail	A0A193GYM4	Enterobacter_phage	51.2	1.4e-40
WP_012479298.1|2349342_2350545_-|tail	tail protein	tail	A0A088FVH5	Escherichia_phage	54.2	6.1e-127
WP_150359520.1|2350647_2351280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150359521.1|2351281_2353282_-|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	42.1	3.3e-117
WP_150359522.1|2353289_2354069_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	50.6	1.2e-43
WP_005412462.1|2354061_2354958_-|plate	baseplate assembly protein J	plate	V5YTH6	Pseudomonas_phage	56.1	1.9e-80
WP_005408332.1|2354960_2355299_-|plate	phage baseplate protein	plate	A0A193GYY8	Enterobacter_phage	62.2	7.8e-32
WP_150359523.1|2355351_2355942_-|plate	phage baseplate assembly protein V	plate	A0A193GYL5	Enterobacter_phage	38.2	1.5e-25
WP_005408334.1|2355938_2356493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099530044.1|2356845_2357223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150359524.1|2357219_2357705_-	glycoside hydrolase family protein	NA	D5LH07	Escherichia_phage	55.0	2.0e-41
WP_005408337.1|2357701_2358052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005408338.1|2358048_2358498_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005408339.1|2358832_2359216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099530043.1|2359368_2360007_-	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	37.6	2.0e-20
WP_099530042.1|2360048_2360276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150359525.1|2360350_2360626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150359526.1|2360626_2362963_-	toprim domain-containing protein	NA	D5LH15	Escherichia_phage	43.4	2.8e-136
>prophage 3
NZ_CP044092	Stenotrophomonas maltophilia strain FDAARGOS_649 chromosome, complete genome	4625884	2963942	2972239	4625884		Vibrio_phage(12.5%)	14	NA	NA
WP_150359636.1|2963942_2964746_+	hypothetical protein	NA	A0A2I7RGI7	Vibrio_phage	50.0	7.8e-30
WP_150359637.1|2964742_2966155_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	40.0	4.4e-76
WP_032127469.1|2966154_2966334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150359638.1|2966330_2966717_+	hypothetical protein	NA	A0A0K0N7I1	Gordonia_phage	36.7	5.6e-18
WP_150359639.1|2966859_2967327_+	NinB family protein	NA	A0A1R3Y605	Salmonella_virus	35.4	2.1e-14
WP_150359640.1|2967323_2967605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150359641.1|2967601_2968075_+	hypothetical protein	NA	R9ZZU8	Cellulophaga_phage	51.3	2.7e-30
WP_150359642.1|2968071_2968269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049404214.1|2968304_2968745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150359643.1|2968908_2969115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150359644.1|2969222_2969465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150360000.1|2969493_2970102_+	hypothetical protein	NA	H9C189	Pectobacterium_phage	60.6	1.4e-71
WP_150359645.1|2970132_2970606_+	DUF2280 domain-containing protein	NA	A0A1B0VMH2	Pseudomonas_phage	71.0	8.1e-43
WP_150359646.1|2970598_2972239_+	hypothetical protein	NA	X2CY37	Brucella_phage	24.8	2.2e-63
