The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044119	Lactobacillus hilgardii strain LH500 chromosome, complete genome	2654177	107514	149009	2654177	transposase,protease	Staphylococcus_phage(16.67%)	32	NA	NA
WP_003556825.1|107514_108516_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003634085.1|108900_110079_+	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	24.9	1.9e-16
WP_003634087.1|110398_111445_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003551226.1|112492_113251_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	4.2e-33
WP_133281483.1|113312_114087_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	51.4	2.3e-26
WP_003551228.1|114122_115163_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003634094.1|115169_116264_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_003634095.1|116270_117575_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_003634097.1|117567_118740_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003634099.1|118749_119943_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003634101.1|119939_120938_+	lactate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	30.6	1.1e-33
WP_003634102.1|120954_121374_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_040472612.1|121757_122756_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003551247.1|123235_123934_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003551248.1|123948_124704_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	3.2e-25
WP_150334559.1|124703_125519_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_040472613.1|125930_126929_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003556843.1|126933_127776_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_056988841.1|127862_128891_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	1.1e-36
WP_003634113.1|129290_130226_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_056956062.1|130673_131132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056956061.1|131339_131942_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003634118.1|132079_133225_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003556866.1|133315_134287_-	NAD(P)-binding domain-containing protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	31.4	2.3e-28
WP_150334561.1|134641_135865_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	44.1	4.6e-74
WP_003556871.1|138157_138454_+	DUF3923 family protein	NA	NA	NA	NA	NA
WP_003634124.1|138533_139151_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_003634126.1|139306_140035_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	35.6	1.8e-17
WP_003634129.1|140192_141101_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_150334563.1|141309_143007_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	2.5e-94
WP_003634144.1|146551_147547_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	3.8e-10
WP_150334564.1|147980_149009_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	8.5e-37
>prophage 2
NZ_CP044119	Lactobacillus hilgardii strain LH500 chromosome, complete genome	2654177	254445	286843	2654177	bacteriocin,protease,transposase	Paramecium_bursaria_Chlorella_virus(25.0%)	26	NA	NA
WP_056988841.1|254445_255474_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	1.1e-36
WP_133281526.1|256163_257864_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.2	2.5e-94
WP_003634284.1|258327_258891_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_003634286.1|259041_259884_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003634288.1|259899_261519_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004561985.1|262313_263303_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	40.5	9.9e-59
WP_003634296.1|265861_266719_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_040472681.1|266856_268104_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_133281483.1|268170_268945_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	51.4	2.3e-26
WP_040472629.1|268995_269955_+	carbamate kinase	NA	NA	NA	NA	NA
WP_035462185.1|270088_270745_-	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_003634305.1|270876_272427_-	YfcC family protein	NA	NA	NA	NA	NA
WP_003634307.1|272534_273833_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003557121.1|273829_274672_+	response regulator	NA	NA	NA	NA	NA
WP_003551587.1|274984_276019_+	putrescine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	37.6	3.3e-12
WP_003551590.1|276040_277477_+	APC family permease	NA	NA	NA	NA	NA
WP_003551592.1|277516_278614_+	agmatine deiminase	NA	M1I5R4	Acanthocystis_turfacea_Chlorella_virus	55.7	1.6e-118
WP_003634316.1|278626_279577_+	carbamate kinase	NA	NA	NA	NA	NA
WP_003634318.1|279716_280805_+	agmatine deiminase	NA	O41120	Paramecium_bursaria_Chlorella_virus	43.1	3.4e-84
WP_003557133.1|280815_281604_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003634320.1|281710_283558_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	29.8	1.2e-46
WP_003557136.1|283756_284005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003634322.1|284173_284614_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003557140.1|284616_285012_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003634326.1|285674_285833_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003634328.1|285955_286843_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP044119	Lactobacillus hilgardii strain LH500 chromosome, complete genome	2654177	350985	359549	2654177		Synechococcus_phage(33.33%)	9	NA	NA
WP_035462365.1|350985_351474_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.4	1.6e-17
WP_003634411.1|351454_352588_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003551730.1|352589_353330_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	H8ZMN3	Synechococcus_phage	39.6	3.7e-42
WP_003557250.1|353329_353593_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003634413.1|353589_354276_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003557254.1|354268_356503_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.6	3.5e-136
WP_040472684.1|356487_357933_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.0	2.2e-51
WP_003557257.1|357945_358962_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	42.2	1.2e-62
WP_003557259.1|358958_359549_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	36.1	2.5e-25
>prophage 4
NZ_CP044119	Lactobacillus hilgardii strain LH500 chromosome, complete genome	2654177	617171	651533	2654177	transposase	Staphylococcus_prophage(25.0%)	29	NA	NA
WP_150334574.1|617171_618240_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003634797.1|618542_619304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150334576.1|619672_620662_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	39.9	3.8e-58
WP_003634801.1|623798_624725_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003557767.1|624835_625027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003634802.1|625105_625891_-	ParA family protein	NA	NA	NA	NA	NA
WP_040472653.1|626093_626708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040472693.1|627537_628107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003634805.1|628262_628625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056988841.1|628883_629912_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	1.1e-36
WP_003634806.1|630256_630460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150334578.1|631161_632499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150334580.1|632495_633564_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	24.3	6.6e-08
WP_003634808.1|633637_633997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003634811.1|635046_635460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003634812.1|635483_635903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040472656.1|636010_636586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133281494.1|636871_639271_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_040472657.1|639429_639990_-	acetyltransferase	NA	NA	NA	NA	NA
WP_003634819.1|642472_642970_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_040472659.1|642966_643365_-	DUF3021 family protein	NA	NA	NA	NA	NA
WP_133281496.1|643460_643916_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040472660.1|644421_645015_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_133281497.1|645676_646546_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_003634826.1|647582_647792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133281495.1|648309_649239_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	5.0e-20
WP_133281539.1|649265_649376_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_133281540.1|649509_650529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150334574.1|650463_651533_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP044119	Lactobacillus hilgardii strain LH500 chromosome, complete genome	2654177	663952	712487	2654177	tRNA,transposase	Staphylococcus_phage(27.27%)	41	NA	NA
WP_150334582.1|663952_664981_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	1.1e-36
WP_003634845.1|665482_666523_+	acyltransferase	NA	NA	NA	NA	NA
WP_003557835.1|667154_667418_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003634846.1|667472_668483_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.4	1.4e-44
WP_003634847.1|668683_669967_-	MFS transporter	NA	NA	NA	NA	NA
WP_003634848.1|670169_671099_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003634849.1|671272_672034_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	33.2	1.4e-23
WP_003634850.1|672114_673074_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003634851.1|673066_675385_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	47.1	1.4e-39
WP_150334582.1|676441_677470_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	1.1e-36
WP_150334584.1|677540_677840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003634856.1|678687_680766_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_133281518.1|681163_682627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003634858.1|683361_683613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003634859.1|683998_684913_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	3.0e-41
WP_003634861.1|685182_685584_+	cobalamin synthesis protein	NA	NA	NA	NA	NA
WP_133281517.1|685605_685731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081447188.1|686253_686706_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003634863.1|687066_687531_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_057808143.1|688888_690091_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003635785.1|690441_690753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635787.1|690951_691260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150334586.1|691361_692252_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	4.6e-156
WP_040472848.1|692257_692509_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.7e-37
WP_003635790.1|693063_694368_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003558041.1|694852_695143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635792.1|695814_696666_+	phosphohydrolase	NA	NA	NA	NA	NA
WP_003635793.1|696833_698249_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_003635795.1|698640_699396_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_003635798.1|699490_699919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635801.1|700058_701015_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_040472800.1|701087_702056_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	4.1e-25
WP_003636804.1|702410_703634_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	44.4	6.1e-74
WP_133281475.1|703737_705303_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003635806.1|705474_706809_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003635809.1|706972_707401_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003635811.1|707430_708015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635812.1|708028_708238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150334582.1|708363_709392_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	1.1e-36
WP_003635815.1|709718_711113_+	amino acid permease	NA	NA	NA	NA	NA
WP_003635817.1|711320_712487_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP044119	Lactobacillus hilgardii strain LH500 chromosome, complete genome	2654177	1225800	1274117	2654177	integrase,transposase,tRNA,protease	Streptococcus_phage(13.33%)	44	1256377:1256433	1265869:1265925
WP_004561411.1|1225800_1226553_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003560080.1|1226536_1226809_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	44.9	2.3e-10
WP_003553778.1|1226904_1227903_+	D-2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	34.2	3.0e-47
WP_004561412.1|1228011_1228737_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_004561413.1|1228978_1229785_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003560087.1|1229873_1230752_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_035444750.1|1230945_1231668_+	UMP kinase	NA	NA	NA	NA	NA
WP_004561414.1|1231670_1232234_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_004561415.1|1232249_1232705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003560092.1|1232779_1233544_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	51.6	1.0e-26
WP_003560094.1|1233560_1234349_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_040472718.1|1234374_1235649_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_004561417.1|1235716_1237426_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004561418.1|1237547_1241864_+	PolC-type DNA polymerase III	NA	U5PWL2	Bacillus_virus	21.4	7.5e-26
WP_003553802.1|1242060_1242534_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004561419.1|1242551_1243874_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003560106.1|1243893_1244193_+	YlxR family protein	NA	NA	NA	NA	NA
WP_004561420.1|1244182_1244500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040472719.1|1244504_1247015_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.6	8.8e-19
WP_003553813.1|1247082_1247433_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004561422.1|1247529_1248441_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004561423.1|1248458_1249415_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_003553820.1|1249540_1250578_+	heat-inducible transcription repressor HrcA	NA	NA	NA	NA	NA
WP_004561424.1|1250596_1251217_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004561426.1|1251243_1253130_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	47.2	6.8e-141
WP_003560122.1|1253237_1254383_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	28.4	1.4e-27
WP_003560124.1|1254593_1256432_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.8	3.3e-23
1256377:1256433	attL	AGGAAGCCTTCATGGCGGTTCTTCAAACCGATGAGGAAGAAAAGGGCGATAAATAAG	NA	NA	NA	NA
WP_040472745.1|1256556_1257714_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	48.4	9.7e-98
WP_082603025.1|1257805_1258417_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	39.7	7.3e-28
WP_004561985.1|1258495_1259485_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	40.5	9.9e-59
WP_133281516.1|1259445_1259925_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	40.0	6.3e-19
WP_056988841.1|1260288_1261317_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	1.1e-36
WP_082603043.1|1261358_1263044_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_150334588.1|1263287_1264356_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_133281484.1|1264467_1264704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040472721.1|1264696_1265515_+	autolysin	NA	A0A0A7DMK9	Lactobacillus_phage	33.5	9.8e-20
WP_004561438.1|1266297_1266732_-	hypothetical protein	NA	NA	NA	NA	NA
1265869:1265925	attR	AGGAAGCCTTCATGGCGGTTCTTCAAACCGATGAGGAAGAAAAGGGCGATAAATAAG	NA	NA	NA	NA
WP_004561439.1|1267065_1267488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003553836.1|1267740_1268088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004561440.1|1268138_1269101_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004561441.1|1269100_1269847_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_056956056.1|1269983_1272215_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A292GI44	Xanthomonas_phage	27.5	8.4e-05
WP_003560300.1|1272227_1272674_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_040472846.1|1272914_1274117_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP044119	Lactobacillus hilgardii strain LH500 chromosome, complete genome	2654177	1322844	1331344	2654177	tRNA	Staphylococcus_phage(28.57%)	8	NA	NA
WP_003553941.1|1322844_1323120_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	1.2e-25
WP_004561472.1|1323106_1324465_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004561473.1|1324696_1325587_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.7	5.2e-59
WP_003560377.1|1325751_1326969_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.0	1.0e-44
WP_004561474.1|1326976_1328890_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.3	2.1e-49
WP_040472725.1|1328908_1329859_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.8	2.4e-118
WP_004561476.1|1329900_1330389_+	dihydrofolate reductase	NA	A0A1Y0SUI9	Pseudomonas_phage	33.6	4.6e-17
WP_003560385.1|1330495_1331344_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.4	4.0e-16
>prophage 8
NZ_CP044119	Lactobacillus hilgardii strain LH500 chromosome, complete genome	2654177	1687722	1740129	2654177	plate,integrase,tRNA,transposase	Streptococcus_phage(16.67%)	52	1725005:1725024	1745781:1745800
WP_150334599.1|1687722_1687869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_057808143.1|1688468_1689671_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003560995.1|1690121_1691963_-	APC family permease	NA	NA	NA	NA	NA
WP_003636257.1|1692150_1693767_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	52.1	2.4e-155
WP_003554622.1|1693837_1694158_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	32.6	6.1e-10
WP_003554624.1|1694489_1695122_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003636252.1|1695345_1697292_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	27.0	1.4e-53
WP_003636250.1|1697401_1698445_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	NA	NA	NA	NA
WP_003561005.1|1698459_1699035_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003636248.1|1699018_1699750_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_150334601.1|1699721_1700516_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003636244.1|1700651_1701533_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	53.1	9.1e-80
WP_035444813.1|1701540_1701873_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_003636242.1|1701895_1702906_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.6	1.9e-33
WP_003554642.1|1702915_1703242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003561014.1|1703244_1703895_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	49.8	5.0e-51
WP_003561016.1|1704086_1704356_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003554648.1|1704368_1704968_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003554650.1|1704991_1705303_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003561018.1|1705326_1707219_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	40.5	5.5e-58
WP_003561020.1|1707535_1708009_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003636240.1|1708031_1708640_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003561022.1|1708801_1709032_+	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	48.0	3.6e-12
WP_003561024.1|1709131_1711297_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	61.2	1.3e-257
WP_003554662.1|1711339_1712296_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	65.3	1.1e-120
WP_003636235.1|1712424_1713420_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	36.7	1.1e-44
WP_003636232.1|1713584_1715051_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003636229.1|1715056_1716058_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	1.1e-52
WP_003636227.1|1716084_1717260_-	galactokinase	NA	NA	NA	NA	NA
WP_003636225.1|1717633_1718662_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003561048.1|1718729_1719662_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003561050.1|1719805_1720381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003636223.1|1720478_1723046_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003636220.1|1723564_1724788_+	hypothetical protein	NA	NA	NA	NA	NA
1725005:1725024	attL	TAACTCTCTTACTTAAGAGT	NA	NA	NA	NA
WP_082603033.1|1725493_1726339_-	cation transporter	NA	NA	NA	NA	NA
WP_056988841.1|1726452_1727481_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	1.1e-36
WP_003636214.1|1727819_1728095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636212.1|1728091_1728937_-	autolysin	NA	L0P6H6	Lactobacillus_phage	27.5	3.9e-11
WP_003636210.1|1728929_1729412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636208.1|1730312_1730738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636206.1|1730837_1731239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636204.1|1731350_1731932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150334603.1|1731972_1732434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636200.1|1732445_1733420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636198.1|1733421_1734042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636196.1|1734028_1735186_-|plate	baseplate J/gp47 family protein	plate	G0YPL8	Erwinia_phage	30.9	9.3e-16
WP_003560260.1|1735178_1735544_-	DUF2634 domain-containing protein	NA	E5DV62	Deep-sea_thermophilic_phage	36.8	2.6e-09
WP_003636194.1|1735553_1735970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636192.1|1735966_1737199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636190.1|1737195_1737672_-	hypothetical protein	NA	A8ATH8	Listeria_phage	36.0	3.6e-14
WP_109249140.1|1738044_1739113_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	24.3	6.6e-08
WP_133281473.1|1739712_1740129_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1745781:1745800	attR	TAACTCTCTTACTTAAGAGT	NA	NA	NA	NA
>prophage 9
NZ_CP044119	Lactobacillus hilgardii strain LH500 chromosome, complete genome	2654177	1842205	1930586	2654177	integrase,capsid,portal,head,transposase,terminase,tail,tRNA,protease	Lactobacillus_phage(45.71%)	74	1870528:1870547	1913812:1913831
WP_003636496.1|1842205_1844233_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	8.2e-92
WP_003636494.1|1844412_1845261_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003561654.1|1845286_1846015_-	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	30.6	1.9e-22
WP_003561653.1|1846044_1847016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035463095.1|1847025_1848276_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003561649.1|1848384_1849323_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003636489.1|1849337_1850354_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003636487.1|1850925_1853244_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003636486.1|1853454_1854432_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	27.1	2.3e-07
WP_003636484.1|1854594_1855878_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	58.8	3.0e-55
WP_003636482.1|1855893_1856505_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	56.5	2.1e-59
WP_003636480.1|1856968_1858708_-	thiol reductant ABC exporter subunit CydC	NA	A0A1V0SE00	Indivirus	33.3	1.8e-23
WP_003636478.1|1858704_1860492_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.3	1.0e-21
WP_003561635.1|1860633_1861644_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003636476.1|1861636_1863103_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003636474.1|1863455_1865096_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003636471.1|1865233_1866004_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	3.1e-15
WP_003636469.1|1865990_1866947_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003636467.1|1866943_1867849_-	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
WP_003636465.1|1867864_1868707_-	cell surface protein	NA	NA	NA	NA	NA
WP_003636464.1|1868693_1869890_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
1870528:1870547	attL	TGACCGTTATTTGACCGTTA	NA	NA	NA	NA
WP_003636463.1|1870612_1870864_-	hypothetical protein	NA	E9LUR9	Lactobacillus_phage	41.2	1.3e-07
WP_003636460.1|1870863_1871688_-	autolysin	NA	U3PJ04	Lactobacillus_phage	36.6	3.6e-30
WP_003636459.1|1871700_1872183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636457.1|1872246_1872408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636455.1|1872435_1872897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636437.1|1875379_1876225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040472821.1|1876221_1878804_-	phage minor structural protein	NA	A0A2P0ZLF8	Lactobacillus_phage	30.0	7.5e-90
WP_003636435.1|1878853_1879603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056956053.1|1879608_1880862_-|tail	phage tail protein	tail	E9LUR2	Lactobacillus_phage	31.9	6.9e-49
WP_150334607.1|1880861_1881931_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	23.9	3.3e-07
WP_003636433.1|1882016_1887593_-|tail	phage tail tape measure protein	tail	Q9AZS0	Lactococcus_phage	35.2	1.2e-103
WP_003636428.1|1888239_1888902_-|tail	tail protein	tail	NA	NA	NA	NA
WP_003636425.1|1888902_1889292_-	DUF806 family protein	NA	NA	NA	NA	NA
WP_003636422.1|1889291_1889690_-|head,tail	head-tail joining protein	head,tail	Q38219	Leuconostoc_phage	50.0	3.8e-17
WP_003636420.1|1889682_1890045_-|head	phage head closure protein	head	Q94MA7	Lactococcus_phage	36.3	9.6e-12
WP_003636417.1|1890034_1890301_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_003636415.1|1890388_1891630_-|capsid	phage major capsid protein	capsid	Q9T1F6	Lactobacillus_phage	44.0	6.6e-84
WP_003636413.1|1891633_1892341_-|protease	Clp protease ClpP	protease	Q9T1F7	Lactobacillus_phage	51.9	4.4e-53
WP_003636411.1|1892315_1893464_-|portal	phage portal protein	portal	A0A0M9JJ63	Lactobacillus_phage	45.7	8.2e-89
WP_003636406.1|1895596_1896115_-|terminase	phage terminase small subunit P27 family	terminase	Q5K5J8	Oenococcus_phage	47.7	1.7e-25
WP_003636397.1|1896769_1897237_-	hypothetical protein	NA	Q9AZM8	Lactococcus_phage	41.7	5.0e-29
WP_003636396.1|1897214_1898111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636386.1|1898142_1898472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636384.1|1898583_1898778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636381.1|1898774_1898987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050768682.1|1899172_1899652_-	hypothetical protein	NA	A0A0A0YV57	Streptococcus_phage	33.3	9.8e-12
WP_040472820.1|1899657_1900071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039933389.1|1900073_1900388_-	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	56.9	1.4e-30
WP_003636373.1|1900656_1902960_-	primase	NA	Q9T0Y1	Lactobacillus_phage	62.9	1.0e-292
WP_003636372.1|1902971_1903565_-	DUF669 domain-containing protein	NA	Q9T0Y2	Lactobacillus_phage	51.3	2.3e-50
WP_003636371.1|1903581_1904937_-	DEAD/DEAH box helicase family protein	NA	Q9T0Y3	Lactobacillus_phage	60.9	3.6e-152
WP_003636370.1|1904939_1905617_-	AAA family ATPase	NA	B4XYS4	Lactobacillus_phage	60.2	3.8e-78
WP_003636369.1|1905619_1906477_-	DUF1351 domain-containing protein	NA	K4JU67	Streptococcus_phage	28.6	4.8e-09
WP_003636368.1|1906497_1906767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636367.1|1906921_1907134_+	hypothetical protein	NA	A0A0A7RTK6	Clostridium_phage	40.9	6.0e-06
WP_003636366.1|1907102_1907297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636364.1|1907539_1907866_-	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	50.9	1.4e-25
WP_003636363.1|1907904_1908120_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JBV7	uncultured_Caudovirales_phage	60.3	1.7e-16
WP_003636362.1|1908308_1909016_+	LexA family transcriptional regulator	NA	Q4ZA68	Staphylococcus_virus	42.4	1.7e-36
WP_003636361.1|1909138_1909450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003636351.1|1909514_1910276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040472819.1|1910377_1910776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003636345.1|1910874_1911549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150334609.1|1911535_1912135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636343.1|1912602_1913742_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	49.5	3.6e-97
WP_003635756.1|1919772_1921836_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.1	3.4e-154
1913812:1913831	attR	TGACCGTTATTTGACCGTTA	NA	NA	NA	NA
WP_003635755.1|1922014_1923055_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_056956015.1|1923057_1924080_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003635751.1|1924100_1925318_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003635750.1|1925542_1927264_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_035444692.1|1927268_1927535_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003559689.1|1927706_1927928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003559687.1|1928351_1930586_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.6	2.4e-124
>prophage 10
NZ_CP044119	Lactobacillus hilgardii strain LH500 chromosome, complete genome	2654177	2225379	2302500	2654177	capsid,plate,portal,transposase,terminase,tail,protease	Lactobacillus_phage(40.74%)	78	NA	NA
WP_003635369.1|2225379_2227416_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A248SJW6	Salicola_phage	39.6	1.6e-119
WP_035178119.1|2227610_2227814_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	68.8	5.0e-18
WP_003635367.1|2228000_2229782_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003558870.1|2230797_2231823_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_003635362.1|2232291_2233071_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003635360.1|2233215_2234541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056956037.1|2234566_2239237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150334616.1|2239466_2240669_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_056956031.1|2240775_2242269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003558859.1|2242653_2243436_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.7	7.2e-12
WP_003635351.1|2243663_2244710_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_150334613.1|2244817_2246521_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	29.3	1.1e-57
WP_003558853.1|2246849_2247065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635345.1|2247270_2247999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635340.1|2249824_2251567_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003635339.1|2251620_2252610_+	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_003635338.1|2252699_2253719_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_003635332.1|2254294_2254741_-	universal stress protein	NA	NA	NA	NA	NA
WP_003635330.1|2255389_2256562_+	Abi family protein	NA	NA	NA	NA	NA
WP_003635326.1|2257044_2257518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635325.1|2257713_2257989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635324.1|2257985_2258831_-	autolysin	NA	A0A1S5S946	Streptococcus_phage	31.7	2.0e-07
WP_040472766.1|2258823_2259312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635321.1|2262505_2264422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635320.1|2264423_2265044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635319.1|2265036_2266185_-|plate	baseplate J/gp47 family protein	plate	A0A1L2JY69	Aeribacillus_phage	33.4	4.4e-50
WP_003558815.1|2266181_2266550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635318.1|2266554_2266974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635317.1|2266982_2268230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635316.1|2268226_2268697_-	hypothetical protein	NA	E5DV60	Deep-sea_thermophilic_phage	50.0	6.9e-18
WP_003635315.1|2268708_2270697_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V592	Lactobacillus_phage	30.6	8.8e-22
WP_003635314.1|2270696_2276183_-|tail	phage tail tape measure protein	tail	A0A2H4PBB0	Lactobacillus_phage	32.9	1.6e-44
WP_003635313.1|2276183_2276399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003558799.1|2276391_2276784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635312.1|2276806_2277220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003558794.1|2277236_2278025_-	DUF3383 family protein	NA	NA	NA	NA	NA
WP_003558792.1|2278045_2278315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635311.1|2278329_2279136_-	Ig domain-containing protein	NA	K7YH45	Serratia_phage	37.8	1.5e-12
WP_003558788.1|2279148_2279634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635310.1|2279617_2280034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635309.1|2280030_2280636_-	hypothetical protein	NA	D6PSY0	Lactobacillus_phage	41.0	8.8e-34
WP_003558783.1|2280637_2280994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040472784.1|2281002_2281203_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081447201.1|2281222_2282224_-|capsid	major capsid protein E	capsid	NA	NA	NA	NA
WP_003558777.1|2282274_2282667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056956029.1|2282687_2283509_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_003558773.1|2283684_2284650_-	hypothetical protein	NA	Q6SED6	Lactobacillus_prophage	23.4	3.5e-08
WP_003635304.1|2284646_2286272_-|portal	phage portal protein	portal	A0A1P8BLJ1	Lactococcus_phage	32.3	2.4e-54
WP_003635303.1|2286278_2287637_-|terminase	PBSX family phage terminase large subunit	terminase	U3PBE8	Lactobacillus_phage	59.4	3.6e-152
WP_003635302.1|2287626_2288331_-|terminase	terminase	terminase	V5URT8	Oenococcus_phage	47.3	4.2e-11
WP_003558765.1|2288385_2288793_-	dUTP diphosphatase	NA	A0A1L2BX65	Bacteriophage	23.6	1.2e-05
WP_003635301.1|2289039_2289312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003554816.1|2289454_2289661_+	CsbD family protein	NA	NA	NA	NA	NA
WP_003558755.1|2290546_2291014_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	48.6	5.2e-34
WP_003635300.1|2291305_2291497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635299.1|2291610_2291886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635297.1|2292243_2292456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635296.1|2292430_2293147_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	59.4	9.7e-64
WP_003635295.1|2293143_2293440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635294.1|2293436_2294243_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	42.0	5.6e-52
WP_003635291.1|2294257_2294599_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_003635289.1|2294561_2295032_-	helix-turn-helix domain-containing protein	NA	A0A1B0Y2R2	Lactobacillus_phage	56.1	1.7e-13
WP_003635286.1|2295084_2295657_-	DUF669 domain-containing protein	NA	D2KRE3	Lactobacillus_phage	50.3	1.3e-34
WP_003635285.1|2295637_2296348_-	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	72.6	2.8e-87
WP_003635283.1|2296365_2297187_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	44.7	2.8e-67
WP_003635282.1|2297186_2297375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635279.1|2297603_2297831_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003558723.1|2297955_2298279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003635277.1|2298284_2298806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003558715.1|2299134_2299377_+	hypothetical protein	NA	A0A1S5SDG8	Streptococcus_phage	55.0	9.6e-08
WP_040472764.1|2299621_2299816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003558709.1|2299927_2300131_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003558707.1|2300273_2300510_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	38.6	1.5e-10
WP_003635270.1|2300545_2300857_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003635268.1|2300939_2301272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635267.1|2301337_2301589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635266.1|2301674_2301911_-	helix-turn-helix transcriptional regulator	NA	Q6SEA0	Lactobacillus_prophage	44.4	8.8e-06
WP_040472763.1|2302104_2302500_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	28.2	2.3e-06
