The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040911	Acinetobacter pittii strain AB17H194 chromosome, complete genome	3844669	1163525	1183375	3844669		Acinetobacter_phage(85.19%)	30	NA	NA
WP_002118643.1|1163525_1164074_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	99.5	6.6e-97
WP_086399848.1|1164335_1165835_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	95.2	5.9e-273
WP_086399849.1|1165836_1168212_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	97.0	0.0e+00
WP_086399850.1|1168218_1169202_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	91.4	1.2e-173
WP_005307211.1|1169212_1169908_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	94.8	8.1e-116
WP_086399851.1|1169917_1170724_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	97.8	1.8e-143
WP_032035718.1|1170733_1171783_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	98.0	1.7e-186
WP_171293797.1|1171792_1172368_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	99.0	6.1e-109
WP_150378083.1|1172491_1172761_-	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	86.5	4.9e-37
WP_150378084.1|1172744_1172978_-	Fis family transcriptional regulator	NA	A0A068CBC7	Acinetobacter_phage	42.4	1.3e-06
WP_150378085.1|1172974_1173601_-	HNH endonuclease	NA	M1PKJ5	Streptococcus_phage	32.3	2.0e-20
WP_086355069.1|1173593_1173854_-	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	47.6	1.8e-12
WP_150378086.1|1173881_1174085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150378087.1|1174224_1175577_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	34.9	8.5e-45
WP_001207471.1|1175573_1176695_-	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	100.0	5.2e-213
WP_150378088.1|1176706_1177030_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	79.4	3.2e-43
WP_150378089.1|1177032_1177473_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	96.6	4.8e-74
WP_000862386.1|1177693_1177975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000212394.1|1177976_1178633_-	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	63.8	3.1e-69
WP_001077691.1|1178745_1178946_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	68.2	3.1e-20
WP_000041061.1|1178954_1179311_+	hypothetical protein	NA	J7I452	Acinetobacter_phage	97.5	2.5e-57
WP_001072908.1|1179360_1179645_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	85.7	5.4e-34
WP_001084145.1|1179641_1179938_+	hypothetical protein	NA	A0A0P0HSJ2	Acinetobacter_phage	98.0	6.8e-48
WP_024434125.1|1179934_1180297_+	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	98.3	5.4e-55
WP_000280079.1|1180289_1181219_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	99.4	1.1e-171
WP_023897136.1|1181211_1181961_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	99.6	6.2e-138
WP_078224788.1|1181957_1182365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000778996.1|1182361_1182763_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	49.2	7.6e-26
WP_078224789.1|1182755_1182971_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	42.3	1.2e-06
WP_044425177.1|1182970_1183375_+	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	50.9	5.2e-22
>prophage 2
NZ_CP040911	Acinetobacter pittii strain AB17H194 chromosome, complete genome	3844669	1186612	1226293	3844669	capsid,lysis,tail,coat,transposase,integrase,terminase	Acinetobacter_phage(79.41%)	46	1202998:1203012	1228254:1228268
WP_031992288.1|1186612_1187068_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	96.7	2.5e-81
WP_150378090.1|1187127_1187562_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	97.2	5.4e-78
WP_150378091.1|1187530_1188172_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	87.8	1.0e-112
WP_150378092.1|1188230_1188746_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	59.5	2.4e-48
WP_150378093.1|1188705_1189998_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	84.8	2.1e-210
WP_150378094.1|1190037_1191387_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	88.6	1.8e-228
WP_150378095.1|1191396_1192503_+|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	84.8	5.7e-180
WP_150378096.1|1192499_1192679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150378243.1|1192800_1193352_+	hypothetical protein	NA	A0A2H4P7H0	Pseudomonas_phage	69.6	1.2e-16
WP_150378097.1|1193461_1194193_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	75.4	2.3e-92
WP_150378098.1|1194195_1195167_+|coat	phage coat protein	coat	A0A2H4JIE6	uncultured_Caudovirales_phage	72.7	3.7e-135
WP_150378099.1|1195209_1195773_+	HeH/LEM domain protein	NA	A0A0D4DBW4	Acinetobacter_phage	42.5	1.7e-15
WP_150378100.1|1195776_1196157_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	81.7	8.5e-51
WP_150378101.1|1196156_1196543_+	glutamate 5-kinase	NA	A0A1B1P9E3	Acinetobacter_phage	84.6	8.0e-57
WP_150378102.1|1197310_1197733_+	hypothetical protein	NA	A0A1B1P9D5	Acinetobacter_phage	72.9	3.3e-56
WP_150378103.1|1197735_1198131_+	hypothetical protein	NA	A0A1B1P9D6	Acinetobacter_phage	90.1	9.1e-64
WP_150378104.1|1198296_1198839_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	38.3	2.0e-21
WP_150378105.1|1198835_1199081_+	hypothetical protein	NA	A0A1B1P9E1	Acinetobacter_phage	60.5	3.2e-19
WP_150378106.1|1199141_1199492_+	hypothetical protein	NA	J7I469	Acinetobacter_phage	83.8	4.3e-49
WP_150378107.1|1199491_1200433_+|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	45.8	1.5e-80
WP_150378108.1|1200485_1201403_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	96.1	1.7e-166
WP_150378109.1|1201473_1201989_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	94.9	4.2e-69
WP_150378111.1|1202335_1202683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150378112.1|1202780_1203182_+	hypothetical protein	NA	NA	NA	NA	NA
1202998:1203012	attL	TAGATTATTATTTTT	NA	NA	NA	NA
WP_150378113.1|1203280_1203625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171491794.1|1203714_1204041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150378115.1|1204138_1204456_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	84.0	1.7e-44
WP_150378116.1|1204577_1208675_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	51.0	7.0e-284
WP_150378117.1|1209810_1210209_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	96.2	2.7e-71
WP_150378244.1|1210208_1210715_+	DUF1833 family protein	NA	A0A0P0IKN4	Acinetobacter_phage	88.7	7.5e-87
WP_032052862.1|1210711_1211074_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	80.8	2.8e-51
WP_150378118.1|1211066_1214504_+	hypothetical protein	NA	A0A0D4DBG7	Acinetobacter_phage	92.2	0.0e+00
WP_150378119.1|1214574_1214868_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_150378120.1|1214848_1215073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150378121.1|1215130_1215676_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	93.9	6.6e-97
WP_150378122.1|1215791_1216577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150378123.1|1216848_1217313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150378124.1|1217362_1218661_-	DUF4113 domain-containing protein	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	61.6	1.7e-159
WP_150378125.1|1218657_1219155_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	60.3	8.2e-46
WP_150378126.1|1219270_1219915_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	48.3	5.1e-56
WP_171262352.1|1220192_1220366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077170226.1|1220352_1220868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171491795.1|1220878_1221526_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_004782810.1|1221589_1222336_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	5.1e-15
WP_150378127.1|1222808_1224005_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0D4DBR3	Acinetobacter_phage	95.0	7.4e-218
WP_086399853.1|1224490_1226293_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	88.8	0.0e+00
1228254:1228268	attR	TAGATTATTATTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP040911	Acinetobacter pittii strain AB17H194 chromosome, complete genome	3844669	3077159	3129555	3844669	capsid,head,tRNA,portal,tail,transposase,integrase,plate,terminase,holin	uncultured_Caudovirales_phage(31.25%)	66	3076772:3076831	3114208:3114318
3076772:3076831	attL	AATATGGTCGGAGCAGTAGGATTCGAACCTACGACCCCCTGGTCCCAAACCAGGTGCACT	NA	NA	NA	NA
WP_004842307.1|3077159_3078320_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	41.4	3.4e-74
WP_004842309.1|3078411_3079152_-	3'-5' exonuclease	NA	A0A0S0NDC6	Pseudomonas_phage	32.8	1.1e-25
WP_004842312.1|3079224_3079557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024436894.1|3079549_3079819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024436893.1|3079821_3080340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813214.1|3080336_3080879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032007302.1|3080945_3081539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150378189.1|3081555_3084285_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	38.7	1.5e-176
WP_004842319.1|3084300_3084483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004842321.1|3084487_3084721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004842322.1|3084717_3084927_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_004842324.1|3085009_3085354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024436889.1|3085396_3085957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057073303.1|3085968_3086775_-	Rha family transcriptional regulator	NA	A0A1C9IHV9	Salmonella_phage	54.9	1.7e-24
WP_033856137.1|3086779_3086983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033856136.1|3087307_3087496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033856135.1|3087492_3088017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050680892.1|3088136_3088595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033856134.1|3088603_3088801_+	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	70.5	5.2e-12
WP_033856133.1|3088797_3089034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031561830.1|3089036_3089477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031561828.1|3089473_3089704_-	hypothetical protein	NA	A0A2H4J8L3	uncultured_Caudovirales_phage	50.0	8.0e-12
WP_031561826.1|3089700_3089994_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_079376685.1|3090107_3090305_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004842347.1|3090270_3091074_+	DNA adenine methylase	NA	A0A2H4J8Q1	uncultured_Caudovirales_phage	60.8	1.4e-87
WP_150378190.1|3091061_3092564_-	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	46.3	5.1e-91
WP_031561819.1|3092560_3092983_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	51.4	1.0e-33
WP_150378191.1|3092988_3095931_-|tail	phage tail tape measure protein	tail	A4PE52	Ralstonia_virus	45.0	6.9e-132
WP_025469641.1|3095927_3096047_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	52.8	3.7e-05
WP_150378192.1|3096055_3096391_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	40.0	5.8e-11
WP_004842357.1|3096453_3096972_-|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	56.7	1.1e-48
WP_150378193.1|3096982_3098155_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	69.7	4.5e-159
WP_150378194.1|3098554_3098767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004842364.1|3101700_3102231_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	34.5	3.4e-29
WP_150378195.1|3102227_3103133_-|plate	baseplate J/gp47 family protein	plate	A0A0F7LCQ9	Escherichia_phage	54.2	1.2e-82
WP_032031299.1|3103129_3103474_-	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	43.9	4.5e-19
WP_032031297.1|3103470_3104004_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	28.5	1.9e-08
WP_032031295.1|3104076_3104529_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	46.3	8.6e-26
WP_032031294.1|3104529_3105030_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	61.4	6.4e-38
WP_057689604.1|3105026_3105887_-	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	41.7	5.4e-45
WP_004842378.1|3105886_3106159_-|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	40.7	5.7e-09
WP_057689605.1|3106155_3106512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004842381.1|3106514_3106727_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	57.6	2.7e-14
WP_004842384.1|3106723_3107173_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	32.7	3.4e-14
WP_057689606.1|3107274_3108165_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	44.0	1.7e-41
WP_057689607.1|3108171_3109182_-|capsid	phage major capsid protein, P2 family	capsid	E5FFI6	Burkholderia_phage	58.0	5.5e-105
WP_057689608.1|3109238_3110069_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	51.0	3.0e-56
WP_057073733.1|3110247_3112026_+|terminase	terminase	terminase	A0A2H4JGK4	uncultured_Caudovirales_phage	67.7	1.4e-228
WP_057689610.1|3112025_3113084_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	61.0	1.3e-117
WP_150378196.1|3113331_3113646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002115913.1|3114753_3115818_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
3114208:3114318	attR	AATATGGTCGGAGCAGTAGGATTCGAACCTACGACCCCCTGGTCCCAAACCAGGTGCACTACCAGGCTGTGCTATGCTCCGAAATTGGGGTGAATGACGGGATTCGAACCC	NA	NA	NA	NA
WP_017481251.1|3115962_3117183_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_086399604.1|3117317_3117797_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.2	4.5e-25
WP_013198888.1|3117809_3118130_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_004782810.1|3118414_3119161_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	5.1e-15
WP_150378248.1|3119183_3119930_-	cation transporter	NA	NA	NA	NA	NA
WP_086399617.1|3120162_3120891_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_086399605.1|3120904_3122812_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_002115904.1|3122853_3123249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086399606.1|3123352_3124174_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017387482.1|3124530_3125217_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_086399607.1|3125401_3125674_+	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	44.2	1.8e-07
WP_086399608.1|3125679_3126525_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016144399.1|3126493_3127945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039767181.1|3128081_3128873_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_086399609.1|3128889_3129555_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP040912	Acinetobacter pittii strain AB17H194 plasmid pAB17H194-1, complete sequence	88002	485	72500	88002	integrase,transposase	uncultured_virus(15.38%)	59	10209:10233	72526:72550
WP_001120888.1|485_1979_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002006931.1|3161_4322_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.2	3.1e-19
WP_001255015.1|4349_4655_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000777554.1|5360_5834_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_000480968.1|5854_6691_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|6690_7494_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|7554_8370_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
10209:10233	attL	TCTCCGACAAACCCGGTACGGTTCA	NA	NA	NA	NA
WP_005096107.1|10446_10815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150378253.1|10863_12189_+	TolC family protein	NA	NA	NA	NA	NA
WP_016658777.1|12190_13420_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_096902762.1|13409_16550_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.4	1.2e-73
WP_150378254.1|16636_17536_+	cation diffusion facilitator family transporter	NA	A0A1V0SED0	Indivirus	31.5	1.2e-10
WP_005245137.1|18299_18557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150378078.1|18777_20382_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	9.5e-144
WP_004691519.1|20456_20792_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_004762545.1|20788_21172_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_004658347.1|21385_21982_-	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_005245168.1|21994_22162_-	DUF2559 family protein	NA	NA	NA	NA	NA
WP_000911011.1|22436_22901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002058482.1|22913_25253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150378255.1|25257_28458_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_150378241.1|28531_29740_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	3.5e-50
WP_150378268.1|30113_30344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067856.1|32249_32954_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_000902128.1|33045_33225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018326.1|33378_34194_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067856.1|34323_35028_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_015060210.1|35168_35549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060246.1|35743_36355_+	recombinase family protein	NA	NA	NA	NA	NA
WP_150378241.1|36451_37660_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	3.5e-50
WP_000155092.1|37872_38757_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|38812_40288_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_001067856.1|40712_41417_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_085947932.1|43932_44693_-|transposase	IS5-like element ISKpn12 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.0e-11
WP_001143775.1|44981_47987_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001217881.1|48147_48705_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_011645017.1|48887_49748_+	class A broad-spectrum beta-lactamase TEM-2	NA	Q1MVP3	Enterobacteria_phage	99.7	1.3e-160
WP_000557452.1|49929_50790_+	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_002063889.1|50802_51345_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_040234282.1|51926_52118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197549.1|52281_52467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947932.1|53358_54119_-|transposase	IS5-like element ISKpn12 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.0e-11
WP_000480968.1|54405_55242_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_150378074.1|56577_57552_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	26.1	1.7e-15
WP_000038641.1|57919_58546_-	hypothetical protein	NA	A0A2H4J538	uncultured_Caudovirales_phage	41.6	4.1e-26
WP_002046584.1|58657_59299_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	53.3	3.4e-52
WP_150378256.1|59545_60652_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	26.2	7.0e-29
WP_001052588.1|60664_61375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001986287.1|62232_62946_+	hypothetical protein	NA	A0A0R6PHM5	Moraxella_phage	41.7	3.9e-41
WP_000059636.1|63339_64539_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	29.1	9.6e-40
WP_000937271.1|65069_65321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004658364.1|65515_65737_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001219642.1|66887_67295_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_150378257.1|67390_68287_+	cation transporter	NA	NA	NA	NA	NA
WP_150378258.1|68290_68803_+	signal peptidase II	NA	NA	NA	NA	NA
WP_127800924.1|69443_69989_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_016165531.1|70459_70750_+	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	37.5	9.4e-10
WP_035268402.1|70751_71153_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_150378259.1|71280_72500_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	2.4e-78
72526:72550	attR	TCTCCGACAAACCCGGTACGGTTCA	NA	NA	NA	NA
>prophage 1
NZ_CP040913	Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence	76962	11582	18460	76962		Acinetobacter_phage(66.67%)	11	NA	NA
WP_150378269.1|11582_12035_+	hypothetical protein	NA	A0A2H4JDI9	uncultured_Caudovirales_phage	66.4	2.2e-53
WP_004795942.1|12101_12284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152660.1|12476_12713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005071565.1|13374_13830_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	94.7	6.1e-80
WP_005071563.1|13890_14358_+	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	71.6	3.3e-57
WP_005071561.1|14326_14968_+	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	82.6	5.7e-108
WP_005071556.1|15552_16869_+	hypothetical protein	NA	A0A0N7IRE3	Acinetobacter_phage	95.7	3.7e-255
WP_002033982.1|17037_17469_+	hypothetical protein	NA	A0A0P0IDW1	Acinetobacter_phage	91.3	7.3e-67
WP_005071551.1|17489_17714_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	47.9	7.5e-07
WP_001258992.1|17997_18285_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	48.4	7.4e-15
WP_000033474.1|18271_18460_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	69.6	4.1e-14
