The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	4170	50692	5498215	portal,transposase,holin,head,tail	Enterobacteria_phage(29.27%)	60	NA	NA
WP_001023352.1|4170_4440_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|4441_5755_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230444.1|5819_6419_-	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_123097953.1|6486_9960_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.3	0.0e+00
WP_000649829.1|10093_10621_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_010917807.1|10651_10858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122998833.1|10811_11444_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	89.5	2.2e-96
WP_000194760.1|11389_12133_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|12143_12842_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|12841_13171_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082449.1|13167_15747_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	0.0e+00
WP_000533402.1|15727_16141_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|16167_16599_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|16612_17353_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|17334_17601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|17658_18006_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|18042_19548_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|19537_21130_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|21126_21333_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001301919.1|23215_23458_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|23507_25046_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|25095_25443_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000235421.1|25895_26171_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|26921_27128_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|27090_27435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|27383_27656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|27588_27783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|27815_28349_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|28569_28683_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|28904_29090_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|29617_29932_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|31288_33139_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|33256_33460_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|33906_34620_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|34714_34954_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000090264.1|36209_36581_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|36570_36942_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|36954_38004_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|38005_38284_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|38451_38664_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|38708_38846_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_097561939.1|39008_39200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000160654.1|39211_39985_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|40336_40750_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|40765_41536_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|41557_42304_-	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|42310_43402_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|43480_43936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|44142_44568_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|44551_44824_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|44932_45334_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|45361_45553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|45552_45840_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|46118_46274_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|46415_46805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|46991_47177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|47178_47484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|47750_47939_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|47935_48127_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|48220_50692_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
>prophage 2
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	283999	322096	5498215	lysis,portal,terminase,integrase,holin,protease,tail	Enterobacteria_phage(51.16%)	53	283584:283598	322170:322184
283584:283598	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|283999_284698_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_137056741.1|284744_284954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951026.1|284928_285810_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|285979_286141_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|286637_287657_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|287690_288671_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|288847_289117_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|289118_290435_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|290494_291094_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|291164_294578_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|294638_295247_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|295183_295927_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|295932_296631_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|296640_296970_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|296969_300035_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|300006_300336_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|300344_300731_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|300791_301535_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|301545_301947_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|301943_302522_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|302533_302809_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|302801_303125_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|303211_305239_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|305183_305519_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|305640_306765_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|306692_306905_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|306901_309004_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|309003_309495_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|309484_309763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|310169_310322_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|310309_310777_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|310773_311271_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|311270_311486_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|311628_312027_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|312107_312266_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|312351_313095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|313278_313968_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|313982_314105_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|314442_315402_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|315613_316279_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|316275_316896_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|316888_317059_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|317055_317238_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|317935_318616_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|318612_318795_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|318767_318959_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|318969_319251_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|319349_319571_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|319781_320384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|320508_320694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|320626_320794_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|320833_321052_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|321214_322096_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
322170:322184	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 3
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	901294	954423	5498215	plate,integrase,transposase,tail	Enterobacteria_phage(22.22%)	50	900866:900880	937094:937108
900866:900880	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|901294_902476_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|903437_904181_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|905004_905778_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|905835_906390_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000344820.1|907475_907919_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000788819.1|908648_908960_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|909911_910205_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|910323_910524_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|910624_911338_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|911465_911855_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|912094_912340_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|913409_914663_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|914674_915778_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|916065_917121_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|917159_917561_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|917618_918863_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|918954_919413_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|919673_921131_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|921187_921724_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|921656_921923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|922229_922682_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|922691_923090_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554757.1|923092_923386_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226188.1|923437_924493_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001301640.1|924563_925334_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|925293_927033_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|927850_928624_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|928809_929070_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|929088_929349_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|929504_930245_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|930215_930983_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|931087_931666_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|931905_934350_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|934392_934866_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|935019_935790_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|935906_937079_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|937159_937345_+	protein YncO	NA	NA	NA	NA	NA
937094:937108	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|937259_937523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|937724_939485_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|939487_940624_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001303801.1|940731_941022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001451832.1|941369_941939_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|942007_946222_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103107.1|946297_948439_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	7.0e-25
WP_001142958.1|948648_949167_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|949863_950364_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|950398_950623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|950673_952065_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|952155_952569_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|952572_954423_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 4
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	3170696	3194165	5498215	tail,integrase,holin,transposase	Stx2-converting_phage(37.5%)	28	3162342:3162356	3195036:3195050
3162342:3162356	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|3170696_3171902_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|3171903_3173217_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|3173213_3174845_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|3174845_3175244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3175341_3175755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024165820.1|3176150_3177377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|3177452_3177755_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|3177790_3178546_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|3178875_3179442_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|3179416_3180028_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|3180024_3180690_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|3180686_3181310_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|3181562_3182306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|3182391_3182559_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143067.1|3182966_3184820_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|3184969_3185185_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|3185189_3185534_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|3185890_3186271_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3186267_3186615_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|3186664_3187309_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|3187115_3188006_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|3188002_3188329_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|3188546_3188816_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001144077.1|3190663_3191314_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|3191496_3192087_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|3192073_3192193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|3192588_3192837_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|3193682_3194165_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3195036:3195050	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 5
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	3471777	3477164	5498215	integrase	Enterobacteria_phage(50.0%)	6	3460729:3460745	3479360:3479376
3460729:3460745	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001005794.1|3471777_3472308_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|3472307_3472775_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|3472761_3473442_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000246982.1|3473451_3474588_+	acyltransferase	NA	Q716G3	Shigella_phage	72.4	2.0e-79
WP_000958700.1|3474762_3475920_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|3476231_3477164_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3479360:3479376	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 6
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	3722778	3801653	5498215	portal,terminase,transposase,integrase,holin,protease,tRNA,tail	Enterobacteria_phage(62.35%)	97	3725253:3725273	3774445:3774465
WP_000569336.1|3722778_3723705_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|3723709_3724441_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3724421_3724529_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|3724588_3725290_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
3725253:3725273	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|3725310_3726597_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|3726630_3726885_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|3726903_3727038_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|3727041_3727284_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|3727371_3727734_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|3727730_3728087_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|3728163_3728451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304101.1|3728420_3728597_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	98.3	3.0e-27
WP_001289954.1|3728598_3729546_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|3729542_3729764_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|3729862_3730144_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|3730154_3730346_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|3730318_3730501_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|3730500_3731178_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|3731174_3731960_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|3731965_3732262_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_001478900.1|3732230_3732383_-	hypothetical protein	NA	Q08J51	Stx2-converting_phage	98.0	3.6e-21
WP_000372942.1|3732337_3732481_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|3732449_3732614_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|3732686_3733055_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|3733315_3733897_+	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|3733913_3734186_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|3734698_3735250_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|3735256_3735538_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|3735660_3736308_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|3736416_3736635_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|3736749_3737046_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_085948178.1|3737347_3738561_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000788906.1|3739326_3740028_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|3740024_3740315_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|3740385_3740664_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|3740796_3741012_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|3741022_3741259_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|3741215_3741662_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|3741658_3742186_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|3742182_3742359_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|3742361_3742763_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|3742722_3742932_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|3742924_3743530_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|3743526_3743721_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_015971135.1|3744135_3744381_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_000691354.1|3744653_3745601_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|3745610_3745880_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874257.1|3746390_3748337_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000143458.1|3748474_3748654_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|3748694_3748940_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|3749017_3749233_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|3749237_3749771_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|3750041_3750611_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|3750610_3750757_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|3750984_3751170_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|3751381_3751654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|3751686_3752163_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|3752159_3754283_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|3754279_3754492_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|3754491_3755994_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001356427.1|3756007_3756898_+|protease	Clp protease ClpP	protease	Q9EYD3	Enterobacteria_phage	100.0	5.8e-167
WP_085952772.1|3756900_3758114_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000502242.1|3758235_3759276_+	peptidase	NA	Q8VNN5	Enterobacteria_phage	99.7	5.9e-195
WP_001097065.1|3759363_3759690_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|3759682_3759964_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|3759966_3760590_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|3760602_3761001_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|3761008_3761761_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|3761774_3762197_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|3762223_3762532_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|3762575_3765221_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|3765217_3765547_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|3765546_3766245_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|3766255_3766999_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|3766944_3767574_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001356361.1|3767814_3768990_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_115801855.1|3768941_3771287_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001228289.1|3771354_3771954_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000268835.1|3772018_3773332_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|3773333_3773603_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|3773970_3774219_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|3774733_3776419_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
3774445:3774465	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|3776415_3777135_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3777181_3777652_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3777693_3778155_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_085952772.1|3778338_3779551_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001302810.1|3781592_3782729_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|3782721_3783453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|3783471_3785001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3785011_3786100_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|3787340_3787658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|3787719_3791349_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|3791358_3792900_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|3793063_3794344_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|3797672_3798885_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_064734679.1|3798851_3798971_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	75.8	1.2e-06
WP_001301615.1|3799619_3801653_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 7
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	3928593	4000985	5498215	portal,terminase,transposase,integrase,head,tail	Enterobacteria_phage(33.33%)	73	3928100:3928115	3985177:3985192
3928100:3928115	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_085952406.1|3928593_3929807_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	1.8e-163
WP_000966626.1|3930178_3932326_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071525094.1|3932432_3932615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|3933773_3935312_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3935361_3935709_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3935705_3936086_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|3936447_3936993_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|3936989_3937733_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|3937744_3938824_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|3938885_3939821_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|3940277_3941195_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|3941296_3942247_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|3944633_3945350_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|3945692_3947147_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|3947248_3948565_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|3948878_3949931_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001302302.1|3958664_3959462_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|3959697_3960720_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|3960719_3960923_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|3960981_3963453_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|3963548_3963737_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|3963733_3963922_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|3964402_3964555_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|3964829_3965474_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|3965571_3965799_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|3965795_3966221_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|3966289_3967327_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|3967358_3967781_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|3967815_3968514_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|3968535_3968760_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|3968756_3969113_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|3969145_3969298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|3969294_3969606_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|3969732_3970296_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|3970405_3970510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|3970696_3970909_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|3970950_3971136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|3971076_3971355_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|3971356_3972406_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|3972418_3972778_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|3972774_3973464_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|3973494_3973617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303558.1|3974097_3974526_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|3975003_3976854_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|3976935_3978149_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000731204.1|3978677_3979022_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|3979072_3979606_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|3979761_3979944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|3979956_3980088_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|3980315_3980501_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|3981027_3981342_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|3981423_3981648_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|3982042_3982552_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|3982523_3984452_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|3984435_3984642_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|3984638_3986231_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
3985177:3985192	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|3986220_3987726_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|3987762_3988110_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|3988167_3988434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|3988415_3989156_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|3989169_3989601_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|3989627_3990041_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_101975986.1|3990021_3991884_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	1.4e-268
WP_115801854.1|3991835_3992600_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.2	3.5e-136
WP_000847298.1|3992596_3992926_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|3992925_3993624_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|3993634_3994378_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|3994323_3994953_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001356361.1|3995193_3996369_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_151120063.1|3996320_3998669_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.6	0.0e+00
WP_001230508.1|3998736_3999336_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268861.1|3999400_4000714_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|4000715_4000985_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 8
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	4058563	4078546	5498215	tail,integrase,transposase	Enterobacteria_phage(79.17%)	28	4071682:4071695	4081687:4081700
WP_032161728.1|4058563_4059697_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|4059647_4059971_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|4060128_4061313_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|4061312_4061825_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|4061879_4062245_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|4062280_4062409_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|4065211_4065700_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|4065856_4066429_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|4066472_4066889_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|4068094_4068409_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|4068413_4069373_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123463.1|4069449_4072272_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
4071682:4071695	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|4072278_4072644_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000775057.1|4072716_4072947_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|4073269_4073569_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|4073565_4073832_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|4073828_4074032_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|4074055_4074472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|4074564_4074678_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|4074674_4074917_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|4074928_4075207_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|4075217_4075568_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|4075589_4075793_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|4075864_4076002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|4076091_4076496_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|4076511_4077162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|4077191_4077539_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|4077544_4078546_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
4081687:4081700	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 9
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	4399076	4463684	5498215	portal,terminase,holin,capsid,protease,head,tail	Stx2-converting_phage(37.74%)	79	NA	NA
WP_001260835.1|4399076_4399898_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4399997_4400081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|4400173_4400509_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|4400905_4402159_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|4402265_4403159_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|4403293_4404514_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|4404638_4405334_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|4405286_4406579_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|4406736_4407351_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|4407393_4408248_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|4408249_4408867_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|4408877_4411301_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|4411361_4413788_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|4413986_4414292_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|4414399_4415110_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|4415112_4415673_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|4415707_4416049_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|4416183_4416510_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|4416682_4416808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|4417498_4417735_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|4417822_4420294_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|4420386_4420578_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4420574_4420763_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|4421163_4421328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|4421331_4421550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|4421621_4421921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|4422273_4422552_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|4422553_4422745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|4422765_4423137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|4423234_4423537_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|4423533_4423959_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|4423981_4424944_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|4424950_4425691_+	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|4426501_4426897_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|4426953_4427538_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|4427653_4427758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|4427946_4428159_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|4428326_4428605_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|4428606_4429656_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|4429668_4430028_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|4430024_4430714_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302069.1|4430744_4430867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303509.1|4431351_4431780_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|4432258_4434109_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000411805.1|4434557_4434764_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|4434768_4435113_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|4435163_4435697_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|4435967_4436537_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|4436536_4436683_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|4436910_4437096_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|4437520_4437748_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|4437789_4438155_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|4438444_4439008_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|4439004_4440666_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|4440729_4442667_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063025.1|4442711_4442933_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_001304108.1|4442878_4445458_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|4445460_4445787_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4445796_4446147_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|4446143_4446590_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|4446586_4446931_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275500.1|4446989_4447706_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	3.1e-126
WP_001030063.1|4447711_4448086_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|4448181_4448391_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070502347.1|4448443_4451524_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	93.8	0.0e+00
WP_000807964.1|4451516_4451858_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152159.1|4451857_4452556_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000194763.1|4452566_4453310_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_064732755.1|4453255_4453888_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_010917807.1|4453841_4454048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649829.1|4454078_4454606_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515042.1|4454739_4458237_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_001230550.1|4458307_4458907_+	outer membrane protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000268955.1|4458971_4460285_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001023992.1|4460286_4460556_+|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|4460668_4461244_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|4461316_4461946_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|4462027_4462669_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|4463249_4463684_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 10
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	4645645	4756066	5498215	portal,terminase,transposase,integrase,holin,capsid,head,tRNA,tail	Escherichia_phage(38.4%)	143	4694769:4694828	4762876:4764186
WP_000214712.1|4645645_4645849_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|4645884_4647345_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|4647433_4648717_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|4648776_4649091_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001480712.1|4649087_4649222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143808.1|4649252_4649894_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001356599.1|4649975_4650605_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|4650677_4651253_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023362.1|4651366_4651636_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|4651637_4652861_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|4652925_4653525_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000514945.1|4653592_4657072_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_072147834.1|4657312_4657942_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|4657887_4658631_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001151105.1|4658641_4659340_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|4659339_4659669_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081804.1|4659665_4662278_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533440.1|4662258_4662672_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|4662698_4663121_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|4663134_4663887_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|4663894_4664290_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|4664286_4664820_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|4664834_4665188_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|4665199_4665598_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|4665639_4666665_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|4666720_4667053_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|4667062_4668382_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|4668362_4669964_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|4669960_4670167_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|4670163_4672089_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867493.1|4672063_4672609_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_032161313.1|4672722_4672980_+	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_001303940.1|4672995_4673220_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|4673301_4673616_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|4674141_4674327_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|4674549_4674696_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|4674695_4675265_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|4675535_4676069_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|4676119_4676464_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|4676468_4676675_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|4677122_4678973_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|4679450_4679882_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|4680332_4681046_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|4681181_4681379_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|4681603_4682158_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|4682220_4682526_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|4682538_4683588_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|4683589_4683862_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|4683983_4684328_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|4684447_4684660_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|4684893_4685451_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|4685452_4685671_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|4685798_4686110_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|4686102_4686330_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|4686326_4686608_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|4686640_4687357_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|4687390_4687813_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001262402.1|4687844_4688888_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|4688956_4689382_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|4689365_4689608_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|4689999_4690338_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|4690630_4690783_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|4690794_4691433_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|4691433_4691643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151120057.1|4691691_4692015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|4692205_4692394_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|4692390_4692579_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|4692671_4693916_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_010917821.1|4694554_4694809_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	82.5	3.4e-11
4694769:4694828	attL	TTGAACCGCCCCGGTTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCAT	NA	NA	NA	NA
WP_085948178.1|4694811_4696025_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001171554.1|4697144_4697525_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4697521_4697869_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|4697918_4699457_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|4700039_4700690_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_010917823.1|4700674_4701022_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001023362.1|4702089_4702359_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_064234961.1|4702360_4703674_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001230550.1|4703738_4704338_-	outer membrane protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|4704408_4707906_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|4708039_4708567_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_010917807.1|4708597_4708804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064732755.1|4708757_4709390_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|4709335_4710079_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|4710089_4710788_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|4710787_4711129_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212768.1|4711121_4714202_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_151120067.1|4714253_4714463_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	98.6	5.7e-33
WP_001030063.1|4714558_4714933_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275479.1|4714938_4715655_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|4715723_4716068_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|4716064_4716511_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|4716507_4716858_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|4716867_4717194_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063094.1|4719719_4719941_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|4719985_4721923_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|4721986_4723648_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|4723644_4724208_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001477518.1|4724399_4724534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000279786.1|4724496_4724862_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|4724903_4725131_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|4725555_4725741_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|4725968_4726115_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|4726114_4726684_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000731221.1|4727537_4727882_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|4727886_4728102_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143079.1|4728251_4730105_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|4730679_4731111_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|4731672_4732227_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|4732223_4732514_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|4732513_4733113_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|4733612_4735004_+	ATPase	NA	NA	NA	NA	NA
WP_000016656.1|4735003_4735993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|4735960_4737112_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|4737543_4737789_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|4737867_4738029_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|4738039_4738303_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|4738304_4738469_-	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|4738554_4738767_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|4738872_4739295_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|4739310_4740072_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|4740094_4740841_-	replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|4740847_4741636_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|4741713_4742136_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|4742132_4742387_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|4742466_4742886_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_015695616.1|4742922_4743141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233809.1|4743173_4743308_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|4743318_4743474_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|4743470_4743959_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|4744400_4744622_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|4744621_4744792_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|4744866_4745142_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|4745243_4747844_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|4747836_4748646_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|4748701_4748851_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|4748888_4749077_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|4749176_4749392_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|4749393_4750629_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|4750680_4751616_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|4751744_4753118_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_124056621.1|4753076_4753307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|4753595_4754579_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|4754833_4756066_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
4762876:4764186	attR	ATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAAACCGGGGCGGTTCAAAAGTCAGCGTTTTGGTTTACGCATAGCAGGTGTCGTATCGCTACTTTTTATTGCTGCGATTGCGCTGATGGTGATCCCGGAAAACGGGATATTGCGCGATCCGATTAATCACACCGTGATGCCATCACCCTTTATTAAAGGTATCGTGCCACTGATCATTCTTTTTTTCTTTGTTGTCTCGCTGGCTTATGGCATCGCTACCCGCACAATTCGACGTCAGGCGGATTTACCGCATTTAATGATTGAACCGATGAAAGAGATGGCGGGATTTATCGTGATGGTTTTTCCCCTCGCCCAGTTTGTCGCCATGTTTAACTGGAGCAACATGGGGAAATTCATCGCCGTGGGGCTGACCGATATCCTGGAAAGTTCAGGGCTTAGCGGCATCCCGGCGTTTGTCGGTCTGGCGTTGCTTTCCTCTTTCTTATGCATGTTTATCGCCAGCGGTTCCGCAATCTGGTCGATTCTGGCCCCCATTTTCGTACCAATGTTTATGCTACTTGGCTTTCACCCGGCATTTGCGCAAATCCTCTTTCGTATTGCCGACTCATCCGTATTGCCTTTAGCGCCAGTATCTCCTTTTGTTCCACTGTTTCTTGGATTCCTGCAACGCTACAAACCAGACGCGAAACTGGGTACTTACTATTCGTTAGTCTTGCCCTATCCGCTTATCTTTTTGGTGGTATGGCTGCTGATGTTGCTGGCGTGGTATCTTGTGGGCCTGCCGATAGGTCCGGGTATTTACCCACGTTTGTCTTAAGAGAGAACGGATGCTGAGATTACTTGAAGAAAAAATTGCCACACCACTGGGTCCACTGTGGGTGATTTGCGATGAGCAATTTCGCCTGCGGGCGGTTGAATGGGAAGAGTACAGCGAACGCATGGTGCAGCTGCTGGACATCCATTATCGCAAAGAAGGCTATGAGCGCATTTCTGCCACCAATCCAGGCGGTTTAAGCGACAAGCTTCGTGAATATTTTGCCGGTAATCTTAGCATTATTGATACGCTTCCCACTGCTACGGGGGGGACGCCATTTCAGCGCGAAGTCTGGAAAACACTACGCACTATCCCCTGCGGGCAGGTAATGCATTACGGCGAACTGGCTGAGCAATTGGGCCGTCCTGGCGCGGCGCGTGCCGTTGGTGCGGCAAACGGATCGAATCCCATCAGCATCGTCGTACCTTGCCATCGGGTTATTGGCCGAAACGGCACCATGACCGGATATGCAGGCGGAGTTCAGCGAAAAGAGT	NA	NA	NA	NA
>prophage 11
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	4841011	4947515	5498215	transposase,terminase,integrase,plate,holin,capsid,protease,head,tail	Shigella_phage(27.59%)	130	4879446:4879461	4904592:4904607
WP_000422055.1|4841011_4842061_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|4842280_4843039_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|4843035_4843626_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|4843665_4844538_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|4844750_4846334_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|4846361_4846982_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|4846978_4847860_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|4847997_4848042_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|4848133_4849696_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|4849695_4851291_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000209521.1|4852663_4853857_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|4853856_4854663_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|4855043_4855223_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|4855308_4855809_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|4855854_4856361_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000147167.1|4856862_4857081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|4857674_4858103_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|4859831_4860422_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|4860605_4861253_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|4861389_4861536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|4861963_4862242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|4862581_4862962_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4862958_4863306_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|4863355_4864894_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|4865859_4866429_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|4866494_4867406_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|4867512_4867635_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_024262009.1|4868776_4868965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025672.1|4869232_4870558_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|4871584_4871854_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|4871855_4873169_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|4873320_4873920_-	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000514792.1|4873987_4877464_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_001152128.1|4877651_4878089_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|4878088_4878430_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212897.1|4878422_4881503_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
4879446:4879461	attL	GGTTTTCAGTTCACCC	NA	NA	NA	NA
WP_001453698.1|4881555_4881765_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|4881860_4882235_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275500.1|4882240_4882957_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	3.1e-126
WP_000133388.1|4883015_4883360_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|4883356_4883803_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|4883799_4884150_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|4884159_4884486_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063025.1|4887011_4887233_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173030.1|4887277_4889215_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|4889278_4890940_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_151120060.1|4890936_4891500_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	1.2e-88
WP_001477518.1|4891691_4891826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001056416.1|4892199_4892784_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_001310454.1|4892951_4893200_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001512118.1|4893201_4895292_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
WP_000129790.1|4895362_4896295_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|4896297_4896519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|4896531_4896786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4896787_4897069_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|4897065_4897338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|4897342_4897636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323221.1|4898274_4898817_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000578573.1|4898820_4899354_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000465562.1|4899353_4899869_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973023.1|4899872_4900424_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000633440.1|4900420_4900732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|4900746_4901097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|4901112_4901445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|4901437_4901635_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000378480.1|4901624_4901921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214366.1|4901917_4902427_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000852377.1|4902496_4902922_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|4902993_4903494_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|4903528_4903957_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|4903940_4904159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342747.1|4904168_4904396_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|4904376_4904685_+	DUF2730 family protein	NA	NA	NA	NA	NA
4904592:4904607	attR	GGGTGAACTGAAAACC	NA	NA	NA	NA
WP_001279082.1|4904681_4904972_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|4904974_4905556_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|4905555_4907220_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532592.1|4907219_4908809_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_000046901.1|4908792_4910124_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000094808.1|4910245_4910719_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|4910895_4912020_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|4912019_4912967_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002056.1|4913010_4913409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|4913405_4913825_+	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|4913821_4914382_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|4914382_4914628_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000015473.1|4916134_4916500_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|4916514_4916991_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_001115265.1|4916932_4917115_+	hypothetical protein	NA	C9DGQ0	Escherichia_phage	54.8	3.2e-08
WP_000113523.1|4917117_4919193_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146116.1|4919179_4920529_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|4920512_4921637_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|4921626_4922241_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|4922233_4922671_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|4922670_4923753_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|4923743_4924304_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|4924303_4925215_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|4925249_4925771_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|4925850_4926054_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_071526725.1|4926076_4926262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904930.1|4926275_4926836_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|4926935_4928975_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|4929121_4929304_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|4929339_4929585_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|4929623_4930088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444515.1|4930202_4930403_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528254.1|4930356_4931094_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_000095736.1|4931494_4931722_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|4932146_4932332_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|4932559_4932706_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|4932705_4933275_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|4933545_4934079_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|4934129_4934474_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|4934478_4934694_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|4934843_4936697_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_064761991.1|4936816_4937002_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000935548.1|4937493_4938552_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|4938702_4938900_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|4939141_4939672_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|4939680_4940040_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|4940052_4941099_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|4941100_4941379_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|4941448_4941706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|4941926_4942139_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|4942417_4943176_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|4943874_4944039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|4944035_4944617_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|4944803_4945226_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|4945257_4946298_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|4946269_4946821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|4947107_4947515_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
>prophage 12
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	5000540	5172743	5498215	portal,transposase,terminase,integrase,holin,capsid,protease,head,tRNA,tail	Enterobacteria_phage(31.62%)	201	5158310:5158330	5179400:5179420
WP_001299679.1|5000540_5001797_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|5002010_5002634_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|5002633_5003485_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|5003635_5004583_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|5004707_5006387_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|5006441_5006720_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|5006997_5007582_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|5007698_5008790_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|5011611_5012682_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|5012692_5013325_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|5013335_5014754_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001366914.1|5015066_5015195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001459046.1|5016784_5016985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|5017092_5018115_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|5018114_5019095_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|5019091_5019850_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000903990.1|5019859_5020504_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010917800.1|5020448_5020730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576838.1|5020668_5021523_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|5021548_5023519_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|5023568_5023823_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|5024023_5024620_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_085952403.1|5024671_5025884_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|5026072_5026684_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|5026783_5027698_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|5027793_5029530_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|5029921_5030992_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|5031001_5032300_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|5032662_5034195_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|5034246_5034966_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|5035187_5036729_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|5036874_5037405_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|5037450_5038719_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|5038718_5039138_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|5039510_5040422_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|5040628_5041090_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|5041166_5041826_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|5041897_5042191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|5042431_5042833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|5042935_5043304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|5043823_5044519_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|5044542_5045355_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|5045358_5045625_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_085948178.1|5046790_5048004_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000361109.1|5048137_5048761_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|5049259_5050213_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|5050399_5051884_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|5052186_5053725_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|5053774_5054122_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|5054118_5054499_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|5054574_5054823_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|5054879_5055548_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|5056045_5056228_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|5056306_5056807_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|5056843_5057350_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|5057368_5058259_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|5058378_5058960_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|5058959_5061875_-	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|5061939_5062539_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|5062605_5066004_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|5066064_5066697_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|5066633_5067377_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|5067382_5068081_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|5068080_5068410_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|5068406_5070956_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|5070948_5071383_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|5071364_5071787_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|5071802_5072543_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|5072550_5072946_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000753014.1|5073531_5073885_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_000158906.1|5073896_5074295_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|5074336_5075362_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|5075417_5075750_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|5075759_5077079_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|5077059_5078661_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|5078657_5078864_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|5078860_5080786_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|5080760_5081306_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|5081694_5081889_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|5082053_5082260_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|5082545_5082956_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|5083247_5083541_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_001180487.1|5084029_5084506_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|5084492_5084798_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|5085119_5085809_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|5085805_5085946_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|5085942_5086305_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|5086301_5086592_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|5086584_5086755_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|5086754_5087210_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|5087400_5087592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|5087711_5089238_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|5089295_5089418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|5089482_5089815_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|5089882_5090185_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|5090181_5090883_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|5090879_5091704_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|5091807_5092044_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|5092033_5093176_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|5093289_5094540_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|5094711_5095365_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|5095374_5095836_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|5095889_5096996_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|5097031_5097673_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|5097676_5099047_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|5099215_5099887_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|5099886_5101347_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001302829.1|5101649_5101898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133425.1|5102202_5102484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127900.1|5102497_5104159_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	9.8e-277
WP_000113645.1|5104142_5104499_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|5104622_5104805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|5104788_5105229_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|5105228_5105525_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|5105521_5105860_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000171117.1|5105856_5107032_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	2.4e-184
WP_000504050.1|5107069_5107642_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|5107681_5108839_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|5109131_5109356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|5109480_5109753_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|5109763_5110174_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|5110170_5110422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|5110792_5112925_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|5112921_5113221_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|5113226_5113469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|5113458_5113650_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|5113649_5113835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|5113827_5114025_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|5114050_5114794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|5114851_5115040_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|5115404_5116634_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|5116882_5118004_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|5118052_5119279_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|5119528_5120665_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|5120648_5121512_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001303923.1|5121542_5121755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|5121875_5123237_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|5123297_5123573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|5123652_5123778_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301673.1|5129872_5132221_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|5132240_5132330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|5132342_5132579_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|5132524_5133262_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|5133315_5134194_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|5134496_5134607_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|5134716_5134971_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|5134987_5135686_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|5135685_5136027_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|5136019_5139262_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_151120067.1|5139314_5139524_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	98.6	5.7e-33
WP_001030063.1|5139619_5139994_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275479.1|5139999_5140716_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|5140782_5141127_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|5141123_5141570_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|5141566_5141917_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|5141926_5142253_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063094.1|5144778_5145000_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|5145044_5146982_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_000958416.1|5148703_5149267_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001477518.1|5149458_5149593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000279786.1|5149555_5149921_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|5149962_5150148_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347015.1|5150267_5150417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|5150773_5150998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|5151062_5151269_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|5151496_5151643_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|5151642_5152212_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|5152482_5153016_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|5153066_5153411_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|5153415_5153631_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|5153706_5153976_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|5154013_5154196_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|5154343_5156281_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|5156595_5156763_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|5157359_5158181_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|5158177_5158552_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
5158310:5158330	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|5158564_5159614_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|5159615_5159894_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|5160061_5160274_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|5160462_5160567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|5160682_5161270_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|5161272_5161464_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|5161465_5161903_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|5161889_5162207_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|5162160_5162478_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|5162467_5162770_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|5162766_5163084_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|5163080_5163797_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|5163830_5164253_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001262323.1|5164284_5165322_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|5165390_5165816_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|5165799_5166123_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|5166247_5166724_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|5167039_5167192_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|5167306_5167822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|5167954_5168344_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|5168405_5168675_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|5168643_5169762_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|5169928_5170723_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|5170719_5171766_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|5171921_5172743_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
5179400:5179420	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 13
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	5400207	5406837	5498215		Enterobacteria_phage(27.27%)	11	NA	NA
WP_001028088.1|5400207_5400702_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|5400722_5402051_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|5402133_5402241_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_024177246.1|5402606_5402813_-	hypothetical protein	NA	Q7Y2P9	Escherichia_phage	100.0	1.3e-26
WP_000203825.1|5403199_5403829_+	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_000763353.1|5403876_5404098_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|5404094_5404379_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_000426668.1|5405263_5405659_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|5405892_5406105_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|5406224_5406569_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000971668.1|5406648_5406837_-	hypothetical protein	NA	A0A0P0ZAD9	Stx2-converting_phage	100.0	4.1e-30
>prophage 14
NZ_CP044140	Escherichia coli O157 strain AR-0430 chromosome, complete genome	5498215	5415568	5465335	5498215	portal,terminase,transposase,integrase,holin,capsid,protease,bacteriocin,tail	Escherichia_phage(66.67%)	75	5400939:5400954	5467056:5467071
5400939:5400954	attL	TTCTTTATTACCGGCG	NA	NA	NA	NA
WP_000012450.1|5415568_5416834_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|5416844_5417096_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|5417105_5417552_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|5417554_5418211_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|5418304_5418706_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|5418762_5418903_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|5419135_5419870_-	outer membrane protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|5419960_5420578_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|5420583_5420862_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|5420876_5422145_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|5422141_5423767_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|5424061_5424250_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|5424388_5424658_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|5424659_5426597_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|5426593_5427244_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|5427243_5427807_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|5427790_5428252_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|5428301_5428691_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|5428746_5429961_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|5429984_5430992_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|5431148_5433293_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|5433292_5434999_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|5434979_5435786_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|5435841_5436045_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|5436194_5436488_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_015971382.1|5436578_5436764_-	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|5436991_5437138_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|5437137_5437707_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|5437977_5438511_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|5438515_5438731_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|5438807_5439080_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|5439120_5439300_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000224729.1|5439434_5439704_-	hypothetical protein	NA	A0A0N7C066	Escherichia_phage	100.0	5.4e-44
WP_085948178.1|5439761_5440974_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000738068.1|5443172_5443442_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|5443453_5444413_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001304085.1|5444795_5444948_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_015967940.1|5444962_5445208_+	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	100.0	2.7e-34
WP_000144764.1|5445622_5445817_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|5445813_5446419_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_001004024.1|5446418_5447141_-	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211422.1|5447215_5447950_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|5448224_5448407_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|5448403_5448931_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|5448927_5449374_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001000127.1|5449924_5450203_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_001036032.1|5450273_5450543_-	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
WP_000131484.1|5450542_5451979_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	100.0	6.1e-275
WP_000065666.1|5451968_5452868_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
WP_000166207.1|5452860_5453007_-	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438540.1|5453039_5453336_-	hypothetical protein	NA	A0A0N7BZS9	Escherichia_phage	100.0	6.8e-48
WP_000067727.1|5453477_5453693_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|5453768_5454464_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|5454964_5455486_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|5456054_5456237_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|5456214_5456487_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|5456545_5456797_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|5456979_5457348_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|5457420_5457585_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|5457553_5457697_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|5457771_5458068_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|5458073_5458859_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186812.1|5458855_5459536_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_000682306.1|5459532_5459715_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548534.1|5459687_5459879_+	DUF1382 family protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
WP_001444000.1|5459889_5460171_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000774248.1|5460269_5460491_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289936.1|5460487_5461261_+	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000797281.1|5461412_5461601_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|5461602_5461818_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|5461819_5462038_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|5462039_5462327_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001303965.1|5463302_5463602_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|5463687_5463972_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|5464024_5465335_+|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
5467056:5467071	attR	CGCCGGTAATAAAGAA	NA	NA	NA	NA
>prophage 1
NZ_CP044139	Escherichia coli O157 strain AR-0430 plasmid pAR-0430-3, complete sequence	92728	11665	58622	92728	protease,transposase,integrase	Macacine_betaherpesvirus(50.0%)	39	28102:28116	62544:62558
WP_000817031.1|11665_12637_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|12636_13803_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_151120044.1|13758_13974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071525396.1|14389_14728_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_085948178.1|14689_15902_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_077631973.1|15868_15949_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_000016989.1|16624_17431_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_001159868.1|17431_17737_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|17738_17957_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_010891291.1|18415_19099_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001248529.1|19095_19716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|19712_19913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127460642.1|19819_20041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361615.1|20320_21298_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_001066920.1|21582_22323_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_010891288.1|22443_22674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302186.1|22644_22842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|22842_23127_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303402.1|23156_23351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001213545.1|23417_24857_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987091.1|24860_26981_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_000217739.1|27030_30027_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
28102:28116	attL	TCCTGTTGCATCAAT	NA	NA	NA	NA
WP_000971918.1|32432_32834_-	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_001004187.1|33815_34328_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_071525076.1|34314_35487_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000776550.1|35525_36503_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_000082782.1|36499_37099_-	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000173396.1|37095_37443_-	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082929.1|37457_38012_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_001173152.1|38472_39696_-	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_000092338.1|39697_41203_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001449993.1|41202_43113_-	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_001358886.1|44131_46828_-|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302198.1|46890_47106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302181.1|47732_48731_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000975743.1|50614_51721_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|51720_52542_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_071525077.1|53142_53322_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001034100.1|54719_58622_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
62544:62558	attR	ATTGATGCAACAGGA	NA	NA	NA	NA
>prophage 1
NZ_CP044141	Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4	50155	721	29300	50155	protease,integrase	Escherichia_phage(60.78%)	51	22670:22704	27686:27720
WP_151120086.1|721_907_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	65.1	2.6e-05
WP_000738068.1|2933_3203_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3214_4174_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001304085.1|4556_4709_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_015967940.1|4723_4969_+	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	100.0	2.7e-34
WP_000144764.1|5383_5578_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|5574_6180_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_001004024.1|6179_6902_-	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211422.1|6976_7711_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|7985_8168_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|8164_8692_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|8688_9135_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|9091_9328_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|9338_9554_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|9686_9965_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_001036032.1|10035_10305_-	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
WP_000131484.1|10304_11741_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	100.0	6.1e-275
WP_000065666.1|11730_12630_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
WP_000166207.1|12622_12769_-	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438540.1|12801_13098_-	hypothetical protein	NA	A0A0N7BZS9	Escherichia_phage	100.0	6.8e-48
WP_000067727.1|13239_13455_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|13530_14226_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|14727_15249_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|15817_16000_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|15977_16250_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|16308_16560_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|16742_17111_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|17183_17348_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|17316_17460_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|17534_17831_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|17836_18622_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186812.1|18618_19299_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_000682306.1|19295_19478_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548534.1|19450_19642_+	DUF1382 family protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
WP_001444000.1|19652_19934_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000774248.1|20032_20254_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289936.1|20250_21024_+	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000797281.1|21175_21364_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|21365_21581_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|21582_21801_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|21802_22090_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
22670:22704	attL	CACTGGATGCCGCTACCAGAACCGCCGCAGGAGGT	NA	NA	NA	NA
WP_001303965.1|23064_23364_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|23449_23734_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|23786_25097_+|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000203825.1|25662_26292_+	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_000763353.1|26339_26561_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|26557_26842_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_000426668.1|27726_28122_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
27686:27720	attR	CACTGGATGCCGCTACCAGAACCGCCGCAGGAGGT	NA	NA	NA	NA
WP_000935259.1|28355_28568_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|28687_29032_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000971668.1|29111_29300_-	hypothetical protein	NA	A0A0P0ZAD9	Stx2-converting_phage	100.0	4.1e-30
>prophage 2
NZ_CP044141	Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4	50155	38026	43029	50155	bacteriocin	Escherichia_phage(66.67%)	6	NA	NA
WP_000012450.1|38026_39292_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|39302_39554_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|39563_40010_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000078907.1|41216_41357_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|41589_42324_-	outer membrane protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_151120088.1|42810_43029_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	81.6	1.1e-15
