The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	5128	56733	5557507	tail,transposase,integrase	Enterobacteria_phage(31.82%)	57	7667:7683	63561:63577
WP_000749881.1|5128_6184_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|6471_7575_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|7586_8840_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
7667:7683	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_001303805.1|9909_10155_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000708838.1|10394_10784_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_000437875.1|11724_11925_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|12043_12337_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|13288_13600_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|13599_14394_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|14393_14987_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|14958_15402_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001115553.1|15422_15833_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|15862_16417_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|16474_17248_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|18071_18815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|19777_20959_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000082144.1|20962_21379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|21351_21969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251694.1|21968_22427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|22419_23052_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647284.1|23082_23673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|23672_24239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100068595.1|24297_24501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001185340.1|24648_24921_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000968317.1|24926_25478_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_000154958.1|25474_26227_-	septation initiation protein	NA	NA	NA	NA	NA
WP_001244581.1|27160_27421_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000973389.1|27417_27975_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001071227.1|27971_28193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|28192_28516_+	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_000016225.1|28529_30863_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000205213.1|30995_31952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687183.1|32627_33527_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361969.1|33625_34348_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301751.1|34514_34793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917758.1|35495_36398_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303808.1|36643_37702_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000171064.1|37843_38971_+	MFS transporter	NA	NA	NA	NA	NA
WP_000121321.1|39149_40106_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667043.1|40115_42314_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000643341.1|42310_43267_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070685.1|43263_43953_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|44370_44985_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001303809.1|45232_45562_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001301550.1|45874_46585_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001265657.1|46553_48197_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131063.1|48186_50712_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716386.1|50737_51406_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|51463_52051_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|52125_52668_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001303810.1|53140_53431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001147284.1|53492_53684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|53753_53894_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|53893_54157_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001171554.1|54420_54801_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|54797_55145_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|55194_56733_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
63561:63577	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
>prophage 2
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	599842	639252	5557507	protease,portal,transposase,holin,tail,terminase,lysis,integrase	Enterobacteria_phage(52.27%)	54	589302:589316	622887:622901
589302:589316	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|599842_600724_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|600886_601105_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|601144_601312_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_071525073.1|601244_601430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120056.1|601554_602157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|602367_602589_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|602687_602969_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_149004379.1|602979_603102_-	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	94.1	4.3e-09
WP_085948178.1|603139_604352_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000682316.1|604456_604639_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|604635_605316_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|606013_606196_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|606192_606363_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|606355_606976_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|606972_607638_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|607849_608809_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|609146_609269_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|609283_609973_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|610156_610900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|610985_611144_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|611224_611623_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|611765_611981_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|611980_612478_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|612474_612942_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|612929_613082_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_001303851.1|613488_613767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349509.1|613756_614248_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|614247_616350_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|616346_616559_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|616486_617611_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|617732_618068_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|618012_620040_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|620126_620450_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|620442_620718_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|620729_621308_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|621304_621706_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|621716_622460_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|622520_622907_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
622887:622901	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|622915_623245_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|623216_626282_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|626281_626611_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|626620_627319_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|627324_628068_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|628004_628613_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|628673_632087_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|632157_632757_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741879.1|632816_634133_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|634134_634404_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|634580_635561_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|635594_636614_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|637110_637272_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|637441_638323_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_137056741.1|638297_638507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247925.1|638553_639252_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 3
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	855967	1021271	5557507	protease,portal,transposase,bacteriocin,holin,tail,head,terminase,capsid,integrase	Escherichia_phage(46.76%)	203	892086:892145	981711:982397
WP_000156526.1|855967_857728_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|857913_858366_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|858441_859482_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|859838_860348_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|860566_861196_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|861158_863321_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|863330_863777_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|863899_865954_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|865985_866444_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|866539_867202_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|867374_867788_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|867832_868150_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|868207_869398_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|869492_869771_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|869767_870097_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|870187_870847_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|871254_872274_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|872251_872494_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|872561_875033_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|875126_875318_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|875314_875503_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001303875.1|875769_876075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|876076_876262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|876448_876838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|876979_877135_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_071525099.1|877192_877411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|877412_877700_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|877699_877891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|877918_878320_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|878428_878701_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|878684_879110_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|879316_879772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|879850_880942_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|880948_881695_+	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|881716_882487_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|882502_882916_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|883267_884041_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|884406_884544_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|884588_884801_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|884968_885247_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|885248_886298_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|886310_886682_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|886671_887043_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|887194_888013_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|888299_888539_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|888633_889347_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042853491.1|889793_889997_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000874392.1|890114_891965_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
892086:892145	attL	TTGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGAC	NA	NA	NA	NA
WP_001303878.1|893321_893636_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|894163_894349_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|894570_894684_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|894904_895438_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_001303879.1|895470_895665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|895597_895870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303880.1|895818_896163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|896125_896332_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|897082_897358_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|897433_897814_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|897810_898158_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|898207_899746_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|899795_900038_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|901920_902127_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|902123_903716_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000256723.1|905248_905596_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|905653_905920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|905901_906642_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|906655_907087_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|907113_907527_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082449.1|907507_910087_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	0.0e+00
WP_000847304.1|910083_910413_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001151078.1|910412_911111_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000194760.1|911121_911865_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|911810_912443_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001303882.1|912396_912603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649830.1|912633_913161_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_098123134.1|913294_916768_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_001230444.1|916835_917435_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268862.1|917499_918813_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001023352.1|918814_919084_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001303884.1|920557_920740_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001301613.1|921357_922476_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|922472_924266_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|924284_924992_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|924988_925576_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063969.1|925572_925971_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004940.1|925967_926825_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263572.1|926958_928503_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460778.1|928514_929651_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|929663_929756_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001301957.1|929835_931140_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000208668.1|931259_933440_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|933459_933906_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|933893_935033_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742329.1|935078_937175_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038071.1|937174_937921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301846.1|937917_938562_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001299283.1|938668_938974_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|939415_939628_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|939913_940126_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|940136_940325_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001303885.1|940299_940530_+	protein YmcE	NA	NA	NA	NA	NA
WP_050554528.1|940557_940692_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818441.1|940740_941814_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054754.1|941885_944630_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
WP_001264927.1|944712_945741_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120119.1|945713_946406_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230236.1|946535_947708_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063176.1|947707_950254_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_000209883.1|950250_950850_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|951003_951309_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420639.1|951308_952229_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_001044286.1|954036_955278_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|955315_955543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000607020.1|955563_956142_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000013654.1|956138_957449_-|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_001208773.1|957501_957786_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_001303965.1|957871_958171_-	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000212746.1|959146_959434_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|959435_959654_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000951705.1|959655_959871_-	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_000797281.1|959872_960061_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_001289936.1|960212_960986_-	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000774248.1|960982_961204_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001444000.1|961302_961584_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548534.1|961594_961786_-	DUF1382 family protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
WP_000682306.1|961758_961941_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|961937_962618_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|962614_963400_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|963405_963702_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|963776_963920_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|963888_964053_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|964125_964494_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|964676_964928_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|964986_965259_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|965236_965419_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|965987_966509_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|967010_967706_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|967781_967997_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438540.1|968138_968435_+	hypothetical protein	NA	A0A0N7BZS9	Escherichia_phage	100.0	6.8e-48
WP_000166207.1|968467_968614_+	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000065666.1|968606_969506_+	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
WP_000131484.1|969495_970932_+	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	100.0	6.1e-275
WP_001036032.1|970931_971201_+	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
WP_001000127.1|971271_971550_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|971682_971898_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|971908_972145_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|972101_972548_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153280.1|972544_973072_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|973068_973251_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|973525_974260_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004024.1|974334_975057_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107955.1|975056_975662_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_000144764.1|975658_975853_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|975845_976280_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_015967940.1|976268_976514_-	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	100.0	2.7e-34
WP_001304085.1|976528_976681_+	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_000649753.1|977063_978023_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|978034_978304_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_085948178.1|980501_981715_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000224729.1|981772_982042_+	hypothetical protein	NA	A0A0N7C066	Escherichia_phage	100.0	5.4e-44
WP_000143458.1|982176_982356_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|982396_982669_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
981711:982397	attR	GTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAAAAGTGGCGACAAACAACCTGAAACTGGGAACCTTTGGCGCATTTGATAACGAATGGCATACGCTGGCTTTCCGCTTTGCCGGGAATAACAGCCTGCAGGTGACGCCGGTTATTGATGGTCAGGATGGCACACCGTTCACGCTGACGCAGTCACCGGTCAGTGCCTTTGCGGCGGATAAACTGCATGTGACAGACATTACCAGAGGTGCGACTTACCCGGTACTGATAGACAGCATTGCGGTGGAAGTGAACAGCACAGACACTGCGGCATGATAAAAAAACCGCCAGCGACAGGAATGGACGCTGGCGGTGGTGATACCTATGGAGAAAAAATAAAGGAACGATACTTTCGTACTCTGGTTTTTAATGAAAACAGTTCTTATTGTCAACAATAACGGAAAGAAATTATGACATTTCTGAACCAGTTAATGCTGTACTTCTGTACGGTGGTCTGTGTGCTGTATCTCCTTTCGGGTGGGTACAGGGCCATGCGTGACTTCTGGCGCAGACAGATTGACAAAAGGGCCGCTGAGAAAATCAGCGCCAGTCAGTCAGCCGGAAGCAAACCCGAAGAGCCGCTCATTTAGCGGCAACTTTCTTAATCACACCTTTCGACGAGAAAATCCCA	NA	NA	NA	NA
WP_000284506.1|982745_982961_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|982965_983499_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|983769_984339_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|984338_984485_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_015971382.1|984712_984898_+	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000738505.1|984988_985282_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|985431_985635_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086069.1|985690_986497_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|986477_988184_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|988183_990328_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|990485_991493_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|991516_992731_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|992786_993176_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|993225_993687_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|993670_994234_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207924.1|994233_994884_+	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000117994.1|994880_996818_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|996819_997089_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|997228_997417_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146326.1|997711_999337_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_000455634.1|1000614_1000893_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|1000898_1001516_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|1001606_1002341_+	outer membrane protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|1002573_1002714_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1002770_1003172_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1003265_1003922_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|1003924_1004371_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|1004380_1004632_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|1004642_1005908_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000331690.1|1005977_1014359_+	hypothetical protein	NA	A0A0N7C080	Escherichia_phage	100.0	0.0e+00
WP_000971668.1|1014641_1014830_+	hypothetical protein	NA	A0A0P0ZAD9	Stx2-converting_phage	100.0	4.1e-30
WP_000756595.1|1014909_1015254_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000935259.1|1015373_1015586_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000426668.1|1015819_1016215_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_001024844.1|1017099_1017384_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_000763353.1|1017380_1017602_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_000203825.1|1017649_1018279_-	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_024177246.1|1018665_1018872_+	hypothetical protein	NA	Q7Y2P9	Escherichia_phage	100.0	1.3e-26
WP_001273654.1|1019237_1019345_+	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_001301708.1|1019427_1020756_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001028088.1|1020776_1021271_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
>prophage 4
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	1237119	1403666	5557507	plate,protease,portal,transposase,tail,holin,head,tRNA,terminase,capsid,lysis,integrase	Enterobacteria_phage(24.68%)	220	1239848:1239864	1397569:1397585
WP_000077537.1|1237119_1237650_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|1237840_1238089_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289290.1|1238090_1240181_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
1239848:1239864	attL	GGATGGCAGCGTGATTT	NA	NA	NA	NA
WP_024213057.1|1240251_1241184_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	2.6e-69
WP_000268104.1|1241186_1241408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|1241420_1241675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|1241676_1241958_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|1241954_1242227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|1242231_1242525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|1242536_1243067_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|1243164_1243707_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564280.1|1243710_1244244_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	2.8e-68
WP_000465559.1|1244243_1244759_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000977061.1|1244762_1245314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633438.1|1245310_1245622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145588.1|1245618_1245987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|1246002_1246335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024213058.1|1246327_1246525_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	2.1e-05
WP_000370523.1|1246514_1246811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|1246807_1247317_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852377.1|1247386_1247812_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|1247883_1248384_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|1248418_1248847_+	endopeptidase	NA	NA	NA	NA	NA
WP_024213059.1|1248830_1249049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342749.1|1249059_1249287_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|1249267_1249576_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279080.1|1249572_1249863_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000360581.1|1249865_1250447_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057669.1|1250446_1252111_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	72.8	3.8e-228
WP_001400311.1|1252110_1253700_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	4.2e-168
WP_000046892.1|1253683_1255015_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	8.7e-151
WP_000094808.1|1255136_1255610_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|1255786_1256911_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|1256910_1257858_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001691380.1|1257901_1258294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|1258290_1258710_+	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|1258706_1259267_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|1259267_1259513_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|1259509_1261012_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|1261020_1261386_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|1261400_1261877_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_001115265.1|1261818_1262001_+	hypothetical protein	NA	C9DGQ0	Escherichia_phage	54.8	3.2e-08
WP_000113523.1|1262003_1264079_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146117.1|1264065_1265415_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	5.9e-54
WP_000098807.1|1265398_1266523_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|1266512_1267127_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|1267119_1267557_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|1267556_1268639_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|1268629_1269190_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|1269189_1270101_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|1270135_1270657_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|1270736_1270940_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_071526725.1|1270962_1271148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904930.1|1271161_1271722_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|1271821_1273861_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|1274007_1274190_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|1274225_1274471_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|1274509_1274974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|1275088_1275289_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|1275242_1275980_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_089158671.1|1276130_1276607_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_001301779.1|1276668_1277301_-	TetR family copper-responsive transcriptional repressor ComR	NA	NA	NA	NA	NA
WP_000800153.1|1277541_1277799_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
WP_000598207.1|1277881_1278841_-	L,D-transpeptidase LdtC	NA	NA	NA	NA	NA
WP_001302008.1|1278987_1282434_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_000810293.1|1282561_1283635_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000284714.1|1283896_1285096_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_001033699.1|1285088_1285790_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251367.1|1285789_1287034_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291263.1|1287062_1287974_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|1287989_1288811_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1288966_1290013_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1290009_1290804_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1290970_1292089_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1292057_1292327_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1292388_1292778_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1292910_1293426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1293540_1293693_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1294008_1294485_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1294609_1294933_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1294916_1295342_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1295410_1296448_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_001301518.1|1296479_1296902_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000451012.1|1296935_1297652_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|1297648_1297966_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|1297962_1298265_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1298254_1298572_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1298525_1298843_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1298829_1299267_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1299268_1299460_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1299462_1300050_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1300165_1300270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1300458_1300671_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1300838_1301117_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1301118_1302168_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|1302180_1302555_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|1302551_1303373_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|1303969_1304137_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|1304451_1306389_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|1306536_1306719_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1306756_1307026_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1307101_1307317_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1307321_1307666_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1307716_1308250_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1308520_1309090_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1309089_1309236_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1309463_1309670_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1309734_1309959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1310315_1310456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|1310585_1310771_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|1310812_1311178_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1311467_1312031_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|1312027_1313689_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1313752_1315690_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1315734_1315956_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|1315901_1318403_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|1318482_1318809_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1318818_1319169_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1319165_1319612_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1319608_1319953_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275506.1|1320011_1320728_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_001030063.1|1320733_1321108_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1321203_1321413_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212899.1|1321465_1324708_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_000807950.1|1324700_1325042_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001179478.1|1325041_1325740_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000170104.1|1325756_1326011_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1326120_1326231_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1326533_1327412_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1327465_1328203_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1328148_1328385_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1328397_1328487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1328506_1330855_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1331445_1334847_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|1336950_1337076_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1337155_1337431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1337491_1338853_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303923.1|1338973_1339186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000799385.1|1339216_1340080_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1340063_1341200_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1341449_1342676_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1342724_1343846_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085257.1|1344094_1345324_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_000953272.1|1345688_1345877_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_001304194.1|1345934_1346678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|1346703_1346901_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|1346893_1347079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|1347078_1347270_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000794515.1|1347259_1347502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770148.1|1347507_1347807_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761781.1|1347803_1349936_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000198852.1|1350306_1350558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|1350554_1350965_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233299.1|1350975_1351248_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|1351372_1351597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137345.1|1351889_1353047_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504050.1|1353086_1353659_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_000171117.1|1353696_1354872_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	2.4e-184
WP_001020660.1|1354868_1355207_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|1355203_1355500_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145903.1|1355499_1355940_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000174068.1|1355923_1356106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|1356229_1356586_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127900.1|1356569_1358231_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	9.8e-277
WP_000133425.1|1358244_1358526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302829.1|1358830_1359079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1359382_1360843_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1360842_1361514_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1361682_1363053_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1363056_1363698_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1363733_1364840_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1364893_1365355_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1365364_1366018_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1366189_1367440_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1367553_1368696_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1368685_1368922_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|1369025_1369850_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|1369846_1370548_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1370544_1370847_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1370914_1371247_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1371311_1371434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1371491_1373018_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_071525067.1|1373137_1373329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1373510_1374724_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001053040.1|1374832_1375288_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1375287_1375458_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1375450_1375741_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1375737_1376100_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1376096_1376237_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1376233_1376923_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1377244_1377550_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1377536_1378013_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1378229_1378412_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1378502_1378796_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1379087_1379498_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1379783_1379990_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1380154_1380349_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1380737_1381283_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1381257_1383183_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1383179_1383386_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1383382_1384984_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1384964_1386284_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1386293_1386626_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1386681_1387707_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1387748_1388147_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1388158_1388512_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1388523_1389102_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1389098_1389494_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1389501_1390242_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1390257_1390680_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1390661_1391096_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1391088_1393638_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1393634_1393964_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1393963_1394662_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1394667_1395411_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1395347_1395980_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1396040_1399439_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
1397569:1397585	attR	AAATCACGCTGCCATCC	NA	NA	NA	NA
WP_001230340.1|1399505_1400105_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000268883.1|1400169_1403085_+	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_000885629.1|1403084_1403666_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
>prophage 5
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	1506856	1577683	5557507	protease,portal,transposase,holin,tail,head,terminase,capsid,integrase	Stx2-converting_phage(37.5%)	84	1506693:1506720	1562155:1562182
1506693:1506720	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1506856_1507987_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1507964_1508213_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|1508277_1510749_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|1510841_1511033_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1511029_1511218_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122994727.1|1511554_1511698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1511691_1511925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1511902_1512310_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1512332_1512551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1512623_1512923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1513186_1513594_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1513669_1513897_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1513880_1514432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1514403_1515444_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|1515475_1515898_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|1516084_1516666_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1516662_1516827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1517525_1518284_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1518562_1518775_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1518995_1519253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1519322_1519601_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1519602_1520649_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1520661_1521021_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1521029_1521560_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1521801_1521999_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1522149_1523208_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_064761991.1|1523699_1523885_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000143067.1|1524004_1525858_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1526007_1526223_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1526227_1526572_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1526622_1527156_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1527426_1527996_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1527995_1528142_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1528369_1528555_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1528979_1529207_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|1529248_1529614_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1529903_1530467_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|1530463_1532125_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1532188_1534126_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|1534170_1534392_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|1534337_1536917_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|1536919_1537246_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1537255_1537606_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1537602_1538049_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1538045_1538390_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275479.1|1538458_1539175_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_001030060.1|1539180_1539555_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|1539650_1539860_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_089158663.1|1539911_1542761_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	86.7	0.0e+00
WP_000807954.1|1542753_1543095_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179481.1|1543094_1543793_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|1543803_1544547_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|1544492_1545125_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|1545466_1546642_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_001230508.1|1549008_1549608_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|1549672_1550896_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|1550897_1551167_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_010917823.1|1552234_1552582_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001121225.1|1552566_1553217_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|1553799_1555338_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1555387_1555735_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1555731_1556112_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|1556451_1556730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1557157_1557304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1557440_1558088_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1558271_1558862_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001302903.1|1560590_1561019_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_000147167.1|1561612_1561831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|1562332_1562839_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1562155:1562182	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1562884_1563385_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1563470_1563650_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1564030_1564837_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1564836_1566030_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|1566041_1567400_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|1567403_1568999_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|1568998_1570561_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1570652_1570697_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1570834_1571716_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1571712_1572333_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1572360_1573944_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1574156_1575029_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1575068_1575659_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1575655_1576414_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1576633_1577683_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	1655803	1774215	5557507	portal,transposase,holin,tail,head,tRNA,terminase,capsid,integrase	Escherichia_phage(39.06%)	149	1645683:1645698	1700150:1700165
1645683:1645698	attL	GAATTTGCCTGAATAT	NA	NA	NA	NA
WP_085948178.1|1655803_1657017_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001156434.1|1657876_1659322_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000444937.1|1659321_1660632_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_000885454.1|1660807_1661716_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046821.1|1662045_1662609_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628061.1|1662629_1663862_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1664116_1665100_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_124056621.1|1665388_1665619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|1665577_1666951_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1667079_1668015_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|1668066_1669302_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|1669303_1669519_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1669618_1669807_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1669844_1669994_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1670049_1670859_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|1670851_1673452_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|1673553_1673829_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|1673903_1674074_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1674073_1674295_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1674736_1675225_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1675221_1675377_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|1675387_1675522_-	phage protein	NA	NA	NA	NA	NA
WP_015695616.1|1675554_1675773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|1675809_1676229_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1676308_1676563_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|1676559_1676982_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|1677059_1677848_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|1677854_1678601_+	replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|1678623_1679385_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|1679400_1679823_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|1679928_1680141_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1680226_1680391_+	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1680392_1680656_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|1680666_1680828_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|1680906_1681152_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|1681583_1682735_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|1682702_1683692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|1683691_1685083_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|1685582_1686182_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|1686181_1686472_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|1686468_1687023_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|1687584_1688016_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143079.1|1688590_1690444_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000284522.1|1690593_1690809_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|1690813_1691158_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992086.1|1691208_1691742_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000661712.1|1692015_1692711_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280923.1|1692805_1692937_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|1693159_1693345_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_077631024.1|1693436_1693637_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	71.8	7.2e-09
WP_001412416.1|1693627_1693810_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	98.3	2.2e-25
WP_000828070.1|1693745_1694072_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1694203_1694404_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|1694445_1694811_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|1695099_1695663_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001411753.1|1695659_1697321_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173010.1|1697384_1699322_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
WP_001063025.1|1699366_1699588_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1702114_1702441_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
1700150:1700165	attR	ATATTCAGGCAAATTC	NA	NA	NA	NA
WP_001007911.1|1702450_1702801_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|1702797_1703244_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1703240_1703585_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275479.1|1703653_1704370_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_001030060.1|1704375_1704750_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|1704845_1705055_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_151098642.1|1705106_1708187_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.6	0.0e+00
WP_000807954.1|1708179_1708521_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|1708520_1708958_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000514792.1|1709145_1712622_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_001228304.1|1712689_1713289_+	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|1713440_1714754_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|1714755_1715025_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1716051_1717377_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_024262009.1|1717644_1717833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106409364.1|1718974_1719097_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1719203_1720115_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1720180_1720750_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|1721715_1723254_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1723303_1723651_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1723647_1724028_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|1724990_1725305_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|1725943_1727188_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|1727280_1727469_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1727465_1727654_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|1728218_1728428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|1728428_1729067_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|1729078_1729231_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|1729523_1729862_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|1730253_1730496_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|1730479_1730905_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|1730973_1732017_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_001379651.1|1732048_1732471_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000450627.1|1732504_1733221_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|1733253_1733535_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|1733531_1733759_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|1733751_1734063_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|1734190_1734409_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|1734410_1734968_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1735201_1735414_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1735533_1735878_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|1735999_1736272_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|1736273_1737323_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|1737335_1737641_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|1737703_1738258_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|1738482_1738680_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|1738814_1739528_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|1739978_1740410_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|1740887_1742738_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411805.1|1743185_1743392_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|1743396_1743741_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1743791_1744325_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1744595_1745165_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|1745164_1745311_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|1745533_1745719_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1746244_1746559_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1746640_1746865_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|1746880_1747138_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867493.1|1747251_1747797_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|1747771_1749697_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|1749693_1749900_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1749896_1751498_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1751478_1752798_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1752807_1753140_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1753195_1754221_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1754262_1754661_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|1754672_1755026_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|1755040_1755574_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|1755570_1755966_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|1755973_1756726_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|1756739_1757162_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|1757188_1757602_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|1757582_1760195_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|1760191_1760521_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_089158661.1|1760520_1761219_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	99.1	1.2e-132
WP_000194798.1|1761229_1761973_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_127446151.1|1761918_1762548_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_001413764.1|1762788_1763964_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_115801853.1|1763915_1766267_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|1766334_1766934_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|1766998_1768222_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|1768223_1768493_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|1768607_1769183_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|1769255_1769885_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|1769966_1770608_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001480712.1|1770638_1770773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241229.1|1770769_1771084_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|1771143_1772427_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|1772515_1773976_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|1774011_1774215_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	1956182	1996642	5557507	portal,tail,holin,head,terminase,capsid	Stx2-converting_phage(43.48%)	51	NA	NA
WP_001295593.1|1956182_1956617_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|1957197_1957839_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|1957920_1958550_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|1958622_1959198_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|1959310_1959580_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|1959581_1960895_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|1960959_1961559_-	outer membrane protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|1961629_1965127_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|1965260_1965788_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_010917807.1|1965818_1966025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064732755.1|1965978_1966611_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|1966556_1967300_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|1967310_1968009_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|1968008_1968350_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_151098643.1|1968342_1971423_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	93.6	0.0e+00
WP_001453698.1|1971475_1971685_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|1971780_1972155_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275500.1|1972160_1972877_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	3.1e-126
WP_000133388.1|1972944_1973289_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|1973285_1973732_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|1973728_1974079_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|1974088_1974415_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001304108.1|1974417_1976997_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_001063094.1|1976942_1977164_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|1977208_1979146_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|1979209_1980871_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|1980867_1981431_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001477518.1|1981622_1981757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000279786.1|1981719_1982085_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|1982126_1982354_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|1982778_1982964_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|1983191_1983338_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1983337_1983907_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|1984177_1984711_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|1984761_1985106_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|1985110_1985317_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023202.1|1985765_1987616_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|1988094_1988523_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001302069.1|1989009_1989132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059381.1|1989162_1989852_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|1989848_1990208_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|1990220_1991270_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|1991271_1991550_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|1991717_1991930_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|1992118_1992223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|1992338_1992923_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|1992979_1993375_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|1994185_1994926_-	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|1994932_1995895_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|1995917_1996343_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|1996339_1996642_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 8
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	2303587	2361326	5557507	tRNA,tail,transposase,integrase	Enterobacteria_phage(63.33%)	63	2303431:2303446	2361405:2361420
2303431:2303446	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_000564730.1|2303587_2304559_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176813.1|2304723_2307153_-	Trimethylamine-N-oxide reductase 2	NA	NA	NA	NA	NA
WP_001214277.1|2307177_2308278_-	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
WP_001185748.1|2308665_2309412_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001302537.1|2309425_2309992_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025318.1|2310207_2311941_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2312117_2312606_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2312725_2313118_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2313117_2315196_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2315188_2316337_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2316538_2317183_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2317193_2317583_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2317597_2318647_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2318649_2319510_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2319528_2321130_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2321175_2322837_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2322979_2323483_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2323503_2325468_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2325472_2326399_-	motility protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2326395_2327283_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2327409_2327988_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2327990_2328341_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2329120_2329549_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089030.1|2329555_2330980_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2330954_2331755_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001187819.1|2332922_2334437_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2334506_2335496_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|2336292_2336796_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2336875_2337127_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2337241_2337328_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2337589_2337913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2338083_2338581_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2338617_2338857_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2339048_2340260_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2340321_2340987_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2341343_2342345_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2342350_2342698_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2342727_2343378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2343393_2343798_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2343887_2344025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2344096_2344300_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2344321_2344672_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2344682_2344961_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2344972_2345215_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2345211_2345325_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2345417_2345834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2345857_2346061_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2346057_2346324_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2346320_2346620_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000775057.1|2346942_2347173_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000599379.1|2347245_2347611_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2347617_2350440_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686531.1|2350516_2351476_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000211280.1|2351480_2351795_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|2353000_2353417_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|2353460_2354033_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2354189_2354678_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|2357480_2357609_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|2357644_2358010_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2358064_2358577_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2358576_2359761_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2359918_2360242_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161728.1|2360192_2361326_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
2361405:2361420	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 9
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	2418906	2460200	5557507	portal,transposase,tail,holin,head,terminase,integrase	Escherichia_phage(34.88%)	55	2453629:2453643	2465899:2465913
WP_001023407.1|2418906_2419176_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268861.1|2419177_2420491_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001230508.1|2420555_2421155_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_115801853.1|2421222_2423574_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001413764.1|2423525_2424701_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_127446151.1|2424941_2425571_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_000194798.1|2425516_2426260_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_089158661.1|2426270_2426969_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	99.1	1.2e-132
WP_000847298.1|2426968_2427298_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032339796.1|2427294_2429874_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|2429854_2430268_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2430294_2430726_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2430739_2431480_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2431461_2431728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|2431785_2432133_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000831796.1|2433665_2435258_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|2435254_2435461_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|2435444_2437373_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000235436.1|2437344_2437854_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2438248_2438473_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2438554_2438869_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2439395_2439581_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2439808_2439940_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2439952_2440135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2440290_2440824_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2440874_2441219_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|2441223_2441430_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|2441749_2442962_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|2443044_2444895_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|2445372_2445801_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001302069.1|2446280_2446403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059369.1|2446433_2447123_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2447119_2447479_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2447491_2448541_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2448542_2448821_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001302544.1|2448761_2448947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2448988_2449201_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2449387_2449492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2449601_2450165_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2450291_2450603_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2450599_2450752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2450784_2451141_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2451137_2451362_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2451383_2452082_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|2452116_2452539_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262409.1|2452570_2453608_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
2453629:2453643	attL	AACTTTACCCTCGAA	NA	NA	NA	NA
WP_000693816.1|2453676_2454102_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2454098_2454326_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2454423_2455068_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2455342_2455495_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2455975_2456164_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2456160_2456349_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2456444_2458916_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2458974_2459178_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2459177_2460200_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
2465899:2465913	attR	AACTTTACCCTCGAA	NA	NA	NA	NA
>prophage 10
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	2618255	2691875	5557507	protease,portal,tail,holin,tRNA,terminase,integrase	Enterobacteria_phage(67.86%)	96	2642815:2642835	2689381:2689401
WP_001301615.1|2618255_2620289_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001411921.1|2624251_2625532_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|2625695_2627237_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|2627246_2630876_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2630937_2631255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2632495_2633584_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2633594_2635124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|2635142_2635874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|2635866_2637003_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087234.1|2636999_2639018_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2639124_2639586_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2639627_2640098_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2640144_2640864_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2640860_2642546_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
2642815:2642835	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261937.1|2643060_2643309_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023431.1|2643676_2643946_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001302809.1|2643947_2645261_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001228289.1|2645325_2645925_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_151098654.1|2645992_2648338_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.6	0.0e+00
WP_001413764.1|2648289_2649465_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_127446151.1|2649705_2650335_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_000194798.1|2650280_2651024_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_089158661.1|2651034_2651733_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	99.1	1.2e-132
WP_000847298.1|2651732_2652062_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|2652058_2654704_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000532073.1|2654747_2655056_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2655082_2655505_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2655518_2656271_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2656278_2656677_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2656689_2657313_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2657315_2657597_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2657589_2657916_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_000502242.1|2658003_2659044_-	peptidase	NA	Q8VNN5	Enterobacteria_phage	99.7	5.9e-195
WP_001450953.1|2658962_2659958_-|protease	Clp protease ClpP	protease	Q9EYD3	Enterobacteria_phage	98.3	9.4e-158
WP_000974564.1|2659971_2661474_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2661473_2661686_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|2661682_2663806_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2663802_2664279_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|2664311_2664584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2664795_2664981_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2665208_2665355_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2665354_2665924_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2666194_2666728_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2666732_2666948_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2667025_2667271_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2667311_2667491_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874257.1|2667628_2669575_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_042817377.1|2669692_2670025_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	99.1	2.1e-58
WP_000752026.1|2670085_2670355_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2670364_2671312_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_015971135.1|2671584_2671830_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_001204849.1|2671818_2672253_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|2672245_2672440_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107983.1|2672436_2673042_-	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_001543885.1|2673034_2673244_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_000924601.1|2673203_2673605_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|2673607_2673784_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000153268.1|2673780_2674308_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001304104.1|2674304_2674751_-	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_001281772.1|2674707_2674944_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103678.1|2674954_2675170_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2675302_2675581_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|2675651_2675942_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788906.1|2675938_2676640_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000185456.1|2676636_2677575_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000035953.1|2677607_2677904_-	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_001033078.1|2678018_2678237_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_001299796.1|2678345_2678993_+	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001280993.1|2679115_2679397_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_000990548.1|2679403_2679955_+	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_000256574.1|2680467_2680740_+	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_001066169.1|2680756_2681338_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000065377.1|2681598_2681967_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198861.1|2682039_2682204_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372942.1|2682172_2682316_+	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001478900.1|2682270_2682423_+	hypothetical protein	NA	Q08J51	Stx2-converting_phage	98.0	3.6e-21
WP_000995395.1|2682391_2682688_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|2682693_2683479_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2683475_2684153_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2684152_2684335_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2684307_2684499_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|2684509_2684791_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2684889_2685111_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2685107_2686055_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001304101.1|2686056_2686233_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	98.3	3.0e-27
WP_001113545.1|2686202_2686490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000207903.1|2686566_2686923_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2686919_2687282_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2687369_2687612_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|2687615_2687750_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|2687768_2688023_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2688056_2689343_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2689363_2690065_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
2689381:2689401	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|2690124_2690232_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2690212_2690944_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2690948_2691875_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 11
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	2906768	3004048	5557507	protease,portal,bacteriocin,transposase,tail,holin,tRNA,terminase,capsid,integrase	Escherichia_phage(46.07%)	116	2927942:2927958	3001076:3001092
WP_001283590.1|2906768_2907581_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289184.1|2907580_2908594_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|2908659_2909796_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615801.1|2909894_2910890_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127753.1|2910886_2912065_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|2912339_2913560_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683769.1|2913718_2915725_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2915845_2916124_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|2916157_2916706_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2916705_2917515_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043834.1|2917514_2918339_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|2918342_2919428_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|2919462_2920395_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|2920560_2921112_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|2921282_2922125_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|2922126_2922648_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001415277.1|2922644_2923073_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|2923111_2923612_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182852.1|2923622_2924381_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112845.1|2924403_2927043_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|2927124_2927688_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
2927942:2927958	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_001195817.1|2928333_2928819_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426148.1|2929021_2931166_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531969.1|2931165_2932476_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|2932655_2932940_-	DUF406 family protein	NA	NA	NA	NA	NA
WP_001301981.1|2933311_2934652_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|2935016_2936048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301650.1|2936121_2936238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2936442_2937198_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2937491_2938424_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_106913919.1|2938646_2947016_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	93.5	0.0e+00
WP_000012449.1|2947084_2948350_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	98.8	9.9e-205
WP_000540391.1|2948360_2948612_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|2948621_2949068_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509481.1|2949070_2949727_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|2949820_2950222_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|2950278_2950419_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|2950651_2951386_-	outer membrane protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|2951476_2952094_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|2952099_2952378_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000162954.1|2952392_2953661_-	host specificity protein J	NA	A0A2L1IV54	Escherichia_phage	89.5	2.6e-213
WP_151098644.1|2953657_2955283_-	hypothetical protein	NA	A0A2L1IV27	Escherichia_phage	97.6	0.0e+00
WP_001303606.1|2955577_2955766_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|2955905_2956175_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|2956176_2958114_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|2958110_2958761_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|2958760_2959324_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|2959307_2959769_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|2959818_2960208_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|2960263_2961478_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|2961501_2962509_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|2962666_2964811_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|2964810_2966517_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086066.1|2966497_2967292_-	hypothetical protein	NA	A0A2R2Z334	Escherichia_phage	96.3	2.4e-132
WP_001108577.1|2967584_2968136_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.5	8.4e-100
WP_012816804.1|2968374_2968560_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000539792.1|2968787_2968934_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2968933_2969503_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2969773_2970307_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2970311_2970527_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2970604_2970850_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2970890_2971070_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_151098645.1|2971206_2973144_-	DUF1737 domain-containing protein	NA	A0A1I9LJQ8	Stx_converting_phage	99.2	0.0e+00
WP_000738068.1|2973641_2973911_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_032360617.1|2973922_2974882_-	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	99.7	2.1e-175
WP_001304085.1|2975264_2975417_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_015971135.1|2975431_2975677_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_151098646.1|2975665_2976100_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	99.3	2.4e-81
WP_000144764.1|2976092_2976287_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_151098647.1|2976283_2976889_-	recombination protein NinG	NA	G9L693	Escherichia_phage	98.5	9.6e-97
WP_001004017.1|2976888_2977611_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	98.8	3.3e-128
WP_151098648.1|2977685_2978360_-	phage antirepressor Ant	NA	G9L689	Escherichia_phage	98.7	3.4e-127
WP_001254210.1|2978628_2978811_-	NinE family protein	NA	Q4A1A6	Enterobacteria_phage	100.0	4.3e-29
WP_000153270.1|2978807_2979335_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000814576.1|2979331_2979778_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|2979734_2979971_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|2979981_2980197_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|2980329_2980608_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_001036032.1|2980678_2980948_-	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
WP_141033965.1|2980947_2982384_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	99.8	6.7e-274
WP_000065666.1|2982373_2983273_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
WP_000166207.1|2983265_2983412_-	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438527.1|2983444_2983741_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	1.5e-47
WP_001180318.1|2983879_2984107_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|2984185_2984893_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|2984953_2985295_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221211.1|2985362_2985824_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|2985817_2986864_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000198445.1|2987520_2987904_+	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000167595.1|2987962_2988433_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001198861.1|2988623_2988788_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|2988756_2988900_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_015983550.1|2988854_2989007_+	hypothetical protein	NA	Q08J51	Stx2-converting_phage	100.0	1.2e-21
WP_000995439.1|2988975_2989272_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|2989277_2990063_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_151098649.1|2990059_2990740_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	99.6	4.6e-132
WP_000682304.1|2990736_2990919_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000548528.1|2990891_2991083_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001447688.1|2991093_2991375_+	hypothetical protein	NA	Q08J56	Stx2-converting_phage	100.0	6.5e-48
WP_000763383.1|2991473_2991695_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289935.1|2991691_2992465_+	ead/Ea22-like family protein	NA	Q08J58	Stx2-converting_phage	100.0	1.0e-143
WP_000797281.1|2992616_2992805_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951706.1|2992806_2993016_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000203836.1|2994483_2995107_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000669287.1|2995149_2995317_+	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_000268107.1|2995316_2995547_+	hypothetical protein	NA	Q08J65	Stx2-converting_phage	100.0	1.9e-37
WP_000163445.1|2995543_2996176_+	adenine methylase	NA	Q08J66	Stx2-converting_phage	100.0	3.3e-124
WP_106898674.1|2996184_2996343_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	98.1	1.1e-20
WP_000994801.1|2996378_2996747_+	DUF1627 domain-containing protein	NA	A0A0P0ZCA9	Stx2-converting_phage	100.0	8.8e-53
WP_000453637.1|2996825_2997008_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_085948178.1|2997494_2998708_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000958700.1|2999905_3001063_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3001237_3002374_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3001076:3001092	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3002383_3003064_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3003050_3003518_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|3003517_3004048_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 12
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	3244450	3298018	5557507	tRNA,tail,holin,transposase	Enterobacteria_phage(28.57%)	56	NA	NA
WP_000997403.1|3244450_3245488_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3245694_3246114_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3246182_3246881_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|3246912_3249573_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3249686_3251042_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|3251087_3251411_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3251407_3252706_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3258479_3261053_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3261182_3261914_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|3261910_3262891_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3263025_3263763_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3264033_3264375_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3264478_3264526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|3264624_3265785_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3265827_3266949_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3266959_3268030_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3268239_3268605_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3268754_3269273_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969012.1|3269262_3270489_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589827.1|3270504_3270987_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3271063_3271411_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3271452_3272220_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3272250_3272799_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3272817_3273066_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3273202_3274564_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3274730_3275522_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626964.1|3275543_3276830_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3276884_3277478_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3277600_3278479_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|3278564_3280226_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3280374_3280716_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3280777_3281068_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3281057_3281534_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3281665_3282148_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3282993_3283242_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001302510.1|3283637_3283757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132157.1|3283743_3284334_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3284516_3285167_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3285245_3286304_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3286433_3286856_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3287016_3287286_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000165061.1|3287503_3287830_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001299612.1|3287826_3288717_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000998000.1|3288523_3289168_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_000612591.1|3289217_3289565_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3289561_3289942_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3290298_3290643_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3290647_3290863_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|3291012_3292866_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|3293273_3293441_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|3293526_3294270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3294522_3295146_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3295142_3295808_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3295804_3296416_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3296390_3296957_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|3297262_3298018_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP044145	Escherichia coli O157 strain AR-0428 chromosome, complete genome	5557507	5466343	5540277	5557507	tRNA,plate,protease,transposase	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_001295561.1|5466343_5467696_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|5467725_5470158_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|5470278_5470764_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|5470767_5471793_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|5471897_5472353_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565963.1|5472356_5473145_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139661.1|5473144_5474293_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|5474289_5474886_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294771.1|5474922_5478405_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	3.7e-209
WP_000055741.1|5478417_5479377_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|5479475_5481617_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|5481673_5482063_+	VOC family protein	NA	NA	NA	NA	NA
WP_000062312.1|5483474_5483735_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|5483721_5483922_-	YaeP family protein	NA	NA	NA	NA	NA
WP_000635546.1|5484629_5485040_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|5485053_5485764_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|5485963_5486788_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|5486840_5488559_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|5488669_5489377_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|5489373_5489778_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|5489895_5490711_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|5490750_5491404_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|5491396_5492428_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|5492615_5493191_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|5498948_5499752_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|5499748_5500663_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|5500903_5501704_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|5501781_5502552_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|5502599_5503958_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|5504029_5504785_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|5504818_5505541_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|5505537_5506005_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|5506069_5506801_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|5507338_5508139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000583960.1|5508323_5508620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|5508616_5509066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|5509068_5509665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|5509743_5509965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|5509985_5510465_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|5510430_5511840_-	membrane protein	NA	NA	NA	NA	NA
WP_001303798.1|5511850_5515285_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000088854.1|5516837_5517581_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614374.1|5517577_5520349_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	3.6e-82
WP_000343292.1|5520357_5521119_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|5521123_5522455_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|5522457_5522982_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|5522978_5524259_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|5524283_5525366_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|5525329_5527180_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|5527183_5527597_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|5527687_5529079_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|5529129_5529354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|5529388_5529889_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|5530585_5531104_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103107.1|5531313_5533455_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	7.0e-25
WP_000509132.1|5533530_5537745_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_127835399.1|5537813_5538395_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_001303801.1|5538742_5539033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420837.1|5539140_5540277_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP044146	Escherichia coli O157 strain AR-0428 plasmid pAR-0428-1, complete sequence	92722	0	33161	92722	integrase,protease	Enterobacterial_phage(50.0%)	24	NA	NA
WP_000217739.1|1364_4361_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|4362_4878_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000971918.1|6768_7170_-	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000096786.1|7261_8095_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_001004187.1|8152_8665_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_071525076.1|8651_9824_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000776550.1|9862_10840_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_000082782.1|10836_11436_-	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000173396.1|11432_11780_-	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082929.1|11794_12349_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_001231211.1|12345_12780_-	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_001173152.1|12810_14034_-	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_000092338.1|14035_15541_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001449993.1|15540_17451_-	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_001302175.1|17508_18384_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001358886.1|18470_21167_-|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302198.1|21229_21445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302181.1|22055_23054_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|23127_24849_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|24938_26045_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|26044_26866_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_071525077.1|27467_27647_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001034100.1|29043_32946_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_085950648.1|33065_33161_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.8e-07
>prophage 2
NZ_CP044146	Escherichia coli O157 strain AR-0428 plasmid pAR-0428-1, complete sequence	92722	42574	45954	92722		Moraxella_phage(33.33%)	5	NA	NA
WP_001233853.1|42574_43036_-	endonuclease	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302189.1|43280_43493_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840472.1|43625_44186_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704522.1|44288_45149_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000205762.1|45207_45954_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
>prophage 3
NZ_CP044146	Escherichia coli O157 strain AR-0428 plasmid pAR-0428-1, complete sequence	92722	63792	67971	92722		Emiliania_huxleyi_virus(33.33%)	6	NA	NA
WP_000117168.1|63792_65751_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000005995.1|65816_66050_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290823.1|66106_66559_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000547965.1|66584_66791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304227.1|66860_67322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302171.1|67407_67971_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
>prophage 4
NZ_CP044146	Escherichia coli O157 strain AR-0428 plasmid pAR-0428-1, complete sequence	92722	73648	89380	92722	integrase,transposase	Macacine_betaherpesvirus(50.0%)	21	86789:86800	89428:89439
WP_000085945.1|73648_74332_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_072157613.1|74288_74468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010891292.1|74408_74714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|74717_75620_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000138832.1|75696_77421_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
WP_001336590.1|77683_77980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001349526.1|78063_78336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817031.1|78720_79692_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|79691_80858_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_071525396.1|81445_81784_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_085948178.1|81745_82958_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_077631973.1|82924_83005_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_000016989.1|83681_84488_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_001159868.1|84488_84794_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|84795_85014_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_010891291.1|85472_86156_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001248529.1|86152_86773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|86769_86970_+	hypothetical protein	NA	NA	NA	NA	NA
86789:86800	attL	CTGACCTGAACG	NA	NA	NA	NA
WP_127460642.1|86876_87098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361615.1|87377_88355_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_001066920.1|88639_89380_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
89428:89439	attR	CTGACCTGAACG	NA	NA	NA	NA
>prophage 1
NZ_CP044147	Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2	46899	17434	33266	46899	tail,integrase	Enterobacteria_phage(31.25%)	17	11864:11876	34622:34634
11864:11876	attL	AATTTATATTATG	NA	NA	NA	NA
WP_000749881.1|17434_18490_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|18777_19881_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|19892_21146_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|22215_22461_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000708838.1|22700_23090_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001274756.1|23217_23931_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|24031_24232_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|24350_24644_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|25595_25907_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096948.1|25906_26617_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	86.6	1.3e-65
WP_000344820.1|26637_27081_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|27052_27646_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001115574.1|27645_28140_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000904979.1|28169_28724_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|28781_29555_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|30378_31122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|32084_33266_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
34622:34634	attR	CATAATATAAATT	NA	NA	NA	NA
