The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	262662	353363	5530826	transposase,portal,terminase,holin,tail,head,capsid	Stx2-converting_phage(43.56%)	112	NA	NA
WP_000214712.1|262662_262866_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|262901_264362_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|264450_265734_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|265793_266108_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001480712.1|266104_266239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143804.1|266269_266911_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|266992_267622_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|267694_268270_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|268383_268653_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268849.1|268654_269968_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001230514.1|270032_270632_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_151142777.1|270699_273213_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.2	0.0e+00
WP_050439450.1|275119_275752_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|275697_276441_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001303180.1|276451_277150_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.4	2.9e-129
WP_000807954.1|277149_277491_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212925.1|277483_280726_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453698.1|280777_280987_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|281082_281457_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|281462_282179_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|282237_282582_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|282578_283025_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|283021_283372_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000125988.1|283381_283708_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|285748_285970_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000173065.1|286014_287952_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.4	0.0e+00
WP_001303179.1|288015_289677_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_000958392.1|289673_290237_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_032173279.1|290526_290892_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	4.9e-64
WP_000095736.1|290933_291161_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|291585_291771_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|291998_292145_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|292144_292714_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|292984_293518_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|293568_293913_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|293917_294124_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|294571_296422_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|296899_297331_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|297781_298495_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|298629_298827_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|299051_299606_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|299668_299974_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|299986_301036_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191871.1|301037_301310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000756596.1|301431_301776_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|301895_302108_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|302341_302899_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|302900_303119_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|303246_303558_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|303550_303778_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|303774_304056_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|304088_304805_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|304838_305261_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001356791.1|305292_306348_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.7	1.6e-83
WP_000693878.1|306416_306842_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001416688.1|307460_307799_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|308091_308244_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|308255_308894_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|308894_309104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|309668_309857_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|309853_310042_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|310134_311379_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|312017_312332_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|313294_313675_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|313671_314019_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|314068_315607_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|316189_316840_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_032166019.1|316824_317172_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	97.9	9.5e-49
WP_001131642.1|317550_318126_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|318239_318509_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268842.1|318510_319734_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|319798_320398_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|320465_320681_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_105626756.1|320683_323944_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001179509.1|324131_324569_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|324568_324910_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212818.1|324902_328145_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453746.1|328192_328402_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|328497_328872_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|328886_329603_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|329668_330013_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|330009_330456_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|330452_330803_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|330812_331139_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001356761.1|331141_333721_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.0	0.0e+00
WP_001063099.1|333666_333888_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|333932_335870_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001303187.1|335933_337595_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958360.1|337591_338155_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_000279796.1|338444_338810_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|338851_339079_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|339503_339689_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|339916_340063_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|340062_340632_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|340902_341436_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|341486_341831_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|341835_342042_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_064234946.1|342489_344340_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_001303509.1|344818_345247_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001302069.1|345730_345853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059381.1|345883_346573_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|346569_346929_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|346941_347991_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|347992_348271_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|348438_348651_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|348839_348944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|349059_349644_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|349700_350096_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|350906_351647_-	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|351653_352616_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|352638_353064_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|353060_353363_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 2
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	660301	718035	5530826	tRNA,tail,transposase,integrase	Enterobacteria_phage(60.71%)	61	660145:660160	718114:718129
660145:660160	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_000564730.1|660301_661273_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176762.1|661437_663867_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_001214277.1|663891_664992_-	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
WP_001302537.1|666138_666705_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025318.1|666920_668654_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|668830_669319_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|669438_669831_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|669830_671909_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|671901_673050_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|673251_673896_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|673906_674296_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|674310_675360_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|675362_676223_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|676241_677843_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|677888_679550_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|679692_680196_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|680216_682181_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|682185_683112_-	motility protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|683108_683996_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|684122_684701_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|684703_685054_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|685833_686262_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|686268_687693_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|687667_688468_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|688634_689621_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|689635_691150_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|691219_692209_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179461.1|693005_693509_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|693587_693839_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|693953_694040_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|694301_694625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|694795_695293_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|695329_695569_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|695760_696972_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|697033_697699_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|698055_699057_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|699062_699410_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|699439_700090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|700105_700510_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|700599_700737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|700808_701012_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000159448.1|701393_701672_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	6.2e-35
WP_000514287.1|701683_701926_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|701922_702036_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|702128_702545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|702568_702772_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|702768_703035_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|703031_703331_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000775057.1|703653_703884_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000599379.1|703956_704322_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|704328_707151_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|707227_708187_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|708191_708506_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|709711_710128_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|710171_710744_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|710900_711389_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|714191_714320_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|714355_714721_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|714775_715288_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000132765.1|716624_716948_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|716898_718035_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
718114:718129	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 3
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	775615	816911	5530826	transposase,portal,terminase,holin,tail,head,integrase	Escherichia_phage(35.71%)	54	810340:810354	822610:822624
WP_001023455.1|775615_775885_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000268850.1|775886_777200_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.3	5.3e-84
WP_001230514.1|777264_777864_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_151142787.1|777931_781411_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_123007081.1|781651_782281_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_000194801.1|782226_782970_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001301816.1|782980_783679_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|783678_784008_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082465.1|784004_786584_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.6	0.0e+00
WP_000533402.1|786564_786978_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|787004_787436_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|787449_788190_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|788171_788438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|788495_788843_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|788879_790385_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|790374_791967_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|791963_792170_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|794054_794564_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|794958_795183_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|795264_795579_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|796105_796291_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|796518_796650_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|796662_796845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|797000_797534_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|797584_797929_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|797933_798140_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|798459_799672_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|799754_801605_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|802082_802511_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001302069.1|802991_803114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059369.1|803144_803834_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|803830_804190_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|804202_805252_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|805253_805532_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001302544.1|805472_805658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|805699_805912_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|806098_806203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|806312_806876_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|807002_807314_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|807310_807463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|807495_807852_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|807848_808073_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|808094_808793_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|808827_809250_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262409.1|809281_810319_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
810340:810354	attL	AACTTTACCCTCGAA	NA	NA	NA	NA
WP_000693816.1|810387_810813_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|810809_811037_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|811134_811779_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|812053_812206_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|812686_812875_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|812871_813060_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034478.1|813155_815627_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|815685_815889_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|815888_816911_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
822610:822624	attR	AACTTTACCCTCGAA	NA	NA	NA	NA
>prophage 4
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	841295	916108	5530826	transposase,lysis,integrase,terminase,holin,tail,protease,head,capsid	Stx2-converting_phage(57.14%)	101	861794:861808	923251:923265
WP_000998048.1|841295_842834_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_071525094.1|843992_844175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000966626.1|844281_846429_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_061069249.1|846710_847565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203545.1|847561_848467_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102660.1|848463_849534_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775497.1|849669_850353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|850368_850779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234544.1|850999_851821_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860080.1|851902_852382_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	5.2e-13
WP_001186192.1|852396_852873_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|852935_853157_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|853230_853599_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|854057_854252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|854264_854378_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016346.1|854866_855049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|855149_855479_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001202488.1|855650_856709_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|856907_857381_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001303036.1|857499_858666_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001322268.1|859009_859141_-	hypothetical protein	NA	O64339	Escherichia_phage	59.5	1.5e-07
WP_001322269.1|859080_859275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012779375.1|859720_860005_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	100.0	1.2e-49
WP_001121226.1|859989_860640_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|860864_861740_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
861794:861808	attL	TAAACCTGTCTGAAC	NA	NA	NA	NA
WP_001023452.1|861880_862150_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000268993.1|862151_863465_-	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001230314.1|863529_864129_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000515107.1|864195_867675_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_129137391.1|867935_868568_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_024748453.1|868513_869251_-|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	98.4	5.0e-148
WP_001416667.1|869304_870228_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|870298_870472_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|870579_870900_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001179515.1|870916_871615_-|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_000807954.1|871614_871956_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_015994262.1|871948_875191_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_001453698.1|875242_875452_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|875547_875922_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|875927_876644_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|876702_877047_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|877043_877490_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|877486_877837_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|877846_878173_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063023.1|880699_880921_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000173037.1|880965_882903_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.4	0.0e+00
WP_001457603.1|882966_884628_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_000958396.1|884624_885188_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_134790854.1|885303_885510_-	hypothetical protein	NA	H6WZK7	Escherichia_phage	86.8	3.9e-26
WP_001303046.1|885478_885844_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|885885_886113_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|886575_886833_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|886829_887327_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|887529_887967_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|887963_888461_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|888460_888676_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|888752_889025_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|889065_889245_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143112.1|889381_891319_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.8	0.0e+00
WP_001303568.1|891562_891886_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|892182_892452_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|892463_893423_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|894072_894561_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|894551_895223_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|895219_895825_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|895824_896547_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000208500.1|896621_897386_-	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001254256.1|897660_897843_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|897839_898367_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|898363_898810_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|898766_899003_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|899013_899229_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001303053.1|899361_899583_-	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	1.1e-37
WP_000105280.1|899695_899911_-	hypothetical protein	NA	A0A0P0ZC82	Stx2-converting_phage	100.0	1.8e-34
WP_001220560.1|900157_900769_-	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_001248388.1|900847_902224_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|902220_903042_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000442612.1|903222_903519_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|903660_903876_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|903950_904646_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|905147_905669_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|906237_906420_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|906397_906670_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_151142790.1|906728_907001_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.1e-42
WP_151142793.1|907026_908239_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.0	1.2e-167
WP_000065362.1|908475_908844_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|908916_909081_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|909049_909193_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|909267_909564_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|909569_910355_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186848.1|910351_911032_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682306.1|911028_911211_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548528.1|911183_911375_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001444000.1|911385_911667_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|911765_911987_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|911983_912931_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_122993658.1|913104_913368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000610373.1|913797_914148_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|914335_914680_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|914757_914949_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|914929_916108_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
923251:923265	attR	GTTCAGACAGGTTTA	NA	NA	NA	NA
>prophage 5
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	1000728	1037394	5530826	lysis,plate,portal,integrase,terminase,holin,tail,head,capsid	Escherichia_phage(65.12%)	49	1003628:1003655	1035587:1035614
WP_000137884.1|1000728_1001451_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|1001641_1001974_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1002121_1003483_+	U32 family peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
1003628:1003655	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|1003756_1003975_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882933.1|1004056_1005220_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000978913.1|1005219_1005699_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000069957.1|1005713_1008161_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001496926.1|1008153_1008273_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|1008305_1008581_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|1008637_1009156_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286706.1|1009168_1010359_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_000905094.1|1010418_1011012_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001145592.1|1011042_1011453_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_001008233.1|1011473_1011917_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|1011888_1012491_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001458782.1|1012490_1012949_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.0	2.8e-85
WP_001285352.1|1013805_1014417_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|1014409_1015318_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127154.1|1015322_1015670_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001093728.1|1015666_1016302_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001001810.1|1016368_1016821_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_000917144.1|1016813_1017281_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|1017243_1017417_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|1017388_1017814_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|1017801_1018227_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|1018241_1018739_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|1018738_1019020_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846406.1|1019023_1019227_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|1019226_1019736_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203418.1|1019835_1020579_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_001248594.1|1020582_1021656_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_001085952.1|1021714_1022569_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156848.1|1022742_1024515_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|1024514_1025549_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000844437.1|1025866_1027834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1027833_1028286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063136.1|1028332_1029556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268574.1|1029645_1031928_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|1031917_1032193_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|1032189_1032414_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|1032416_1032716_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|1032715_1032940_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|1033003_1033504_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001081582.1|1033681_1033957_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|1034078_1034378_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|1034493_1035507_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001303578.1|1035604_1035784_-	hypothetical protein	NA	NA	NA	NA	NA
1035587:1035614	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_001303579.1|1035771_1036089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|1036494_1037394_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 6
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	1063025	1138403	5530826	tRNA,transposase,portal,terminase,holin,tail,protease,integrase	Enterobacteria_phage(50.0%)	88	1088901:1088921	1135909:1135929
WP_001301615.1|1063025_1065059_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_085948178.1|1067735_1068948_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001453781.1|1070334_1071615_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|1071778_1073320_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|1073329_1076959_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|1077020_1077338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1078578_1079667_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|1079677_1081207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|1081225_1081957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|1081949_1083086_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|1083082_1085086_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|1085210_1085672_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1085713_1086184_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1086230_1086950_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|1086946_1088632_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1088901:1088921	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261937.1|1089146_1089395_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023381.1|1089762_1090032_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_000268979.1|1090033_1091347_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001228302.1|1091411_1092011_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000514991.1|1092078_1095552_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_123007081.1|1095792_1096422_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_000194801.1|1096367_1097111_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001301816.1|1097121_1097820_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|1097819_1098149_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_127835382.1|1098145_1100791_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.9	0.0e+00
WP_000438877.1|1100834_1101143_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000479043.1|1101169_1101592_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|1101605_1102358_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|1102365_1102764_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|1102776_1103400_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|1103402_1103684_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|1103676_1104003_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114426.1|1104090_1106115_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|1106059_1107562_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|1107561_1107774_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|1107770_1109894_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|1109890_1110367_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|1110884_1111070_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|1111297_1111444_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1111443_1112013_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087729.1|1112283_1112817_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_001072901.1|1112821_1113037_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290210.1|1113114_1113360_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_000143458.1|1113400_1113580_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_151142796.1|1113714_1115661_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_001356551.1|1116464_1116617_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_024165948.1|1116631_1116880_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.2e-34
WP_001204769.1|1116868_1117303_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|1117388_1117529_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|1117525_1117888_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|1117884_1118175_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|1118167_1118338_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054341.1|1118337_1118793_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_001303586.1|1118789_1118891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|1119007_1119805_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302427.1|1119814_1120366_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|1120830_1122357_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032102575.1|1122414_1122522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|1122613_1122946_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|1123013_1123316_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788810.1|1123312_1124014_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_001415640.1|1124010_1124940_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	3.6e-111
WP_001182899.1|1125026_1125566_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067457.1|1125635_1125866_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_000858974.1|1125970_1126660_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000380252.1|1126740_1127802_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|1127779_1128157_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|1128637_1128844_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|1128919_1129216_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|1129221_1130007_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|1130003_1130681_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|1130680_1130863_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|1130835_1131027_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|1131037_1131319_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|1131417_1131639_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|1131635_1132583_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|1132584_1132761_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001113545.1|1132730_1133018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000207903.1|1133094_1133451_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|1133447_1133810_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|1133897_1134140_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556581.1|1134143_1134278_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_001193437.1|1134296_1134551_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|1134584_1135871_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|1135891_1136593_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1135909:1135929	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|1136652_1136760_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1136740_1137472_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|1137476_1138403_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 7
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	1353385	1452814	5530826	tRNA,transposase,lysis,portal,integrase,terminase,holin,tail,bacteriocin,capsid	Escherichia_phage(81.11%)	120	1374330:1374346	1449842:1449858
WP_001283590.1|1353385_1354198_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289184.1|1354197_1355211_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|1355276_1356413_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615801.1|1356511_1357507_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127753.1|1357503_1358682_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|1358956_1360177_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683769.1|1360335_1362342_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|1362462_1362741_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|1362774_1363323_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|1363322_1364132_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043834.1|1364131_1364956_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|1364959_1366045_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|1366079_1367012_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|1367177_1367729_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|1367899_1368742_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|1368743_1369265_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001301662.1|1369497_1369671_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001301662.1|1369903_1370077_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001415277.1|1370073_1370502_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|1370540_1371041_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182852.1|1371051_1371810_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112847.1|1371832_1373431_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|1373512_1374076_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
1374330:1374346	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_001195817.1|1374721_1375207_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426146.1|1375409_1377554_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531969.1|1377553_1378864_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|1379043_1379328_-	DUF406 family protein	NA	NA	NA	NA	NA
WP_001301981.1|1379699_1381040_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|1381404_1382436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301650.1|1382509_1382626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|1382830_1383586_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|1383879_1384812_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331692.1|1385033_1393415_-	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	100.0	0.0e+00
WP_127520602.1|1393504_1394749_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	99.5	5.9e-194
WP_000540391.1|1394759_1395011_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|1395020_1395467_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|1395469_1396126_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|1396219_1396621_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|1396677_1396818_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_024175551.1|1396874_1397120_+	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	98.8	1.6e-39
WP_000835362.1|1397050_1397785_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0N7C1B9	Escherichia_phage	100.0	4.4e-136
WP_001301884.1|1397875_1398493_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455635.1|1398498_1398777_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|1398791_1400060_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146324.1|1400056_1401682_-	hypothetical protein	NA	A0A0N7C0A7	Escherichia_phage	100.0	0.0e+00
WP_001303606.1|1401976_1402165_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|1402304_1402574_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|1402575_1404513_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207926.1|1404509_1405160_-	hypothetical protein	NA	A0A0N6WEJ5	Escherichia_phage	100.0	4.6e-121
WP_000829200.1|1405159_1405723_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|1405706_1406168_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|1406217_1406607_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_151142800.1|1406662_1407877_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	99.8	8.3e-233
WP_000345010.1|1407900_1408908_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|1409065_1411210_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|1411209_1412916_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086073.1|1412896_1413703_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_001301714.1|1413758_1413962_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|1414111_1414405_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|1414436_1414901_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|1414908_1415058_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_000989259.1|1415057_1415621_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	2.6e-104
WP_085948178.1|1415674_1416887_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001453789.1|1416853_1416982_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	86.2	1.2e-06
WP_000087729.1|1417214_1417748_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_001072901.1|1417752_1417968_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290210.1|1418045_1418291_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_000143458.1|1418331_1418511_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874428.1|1418645_1420583_-	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	100.0	0.0e+00
WP_000738068.1|1421068_1421338_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|1421349_1422309_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|1422691_1422844_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_024165517.1|1422858_1423104_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.1e-35
WP_001204844.1|1423092_1423527_-	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_000144764.1|1423519_1423714_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001187434.1|1423710_1424274_-	bacteriophage lambda NinG family protein	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000402093.1|1424281_1424731_-	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	100.0	1.3e-82
WP_001193567.1|1424730_1425702_-	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000913119.1|1425691_1427212_-	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001271433.1|1427205_1427583_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001302923.1|1427749_1427944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|1428114_1428318_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|1428413_1429127_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|1429221_1430691_+	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|1430687_1431641_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000201269.1|1432501_1433149_+	Rha family transcriptional regulator	NA	A0A2R2Z320	Escherichia_phage	100.0	1.5e-119
WP_000917253.1|1433219_1433432_+	hypothetical protein	NA	A0A2R2Z321	Escherichia_phage	100.0	3.4e-33
WP_024175068.1|1433503_1433725_+	hypothetical protein	NA	A0A2R2Z322	Escherichia_phage	100.0	6.4e-35
WP_000995346.1|1433745_1434027_+	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	100.0	1.7e-48
WP_000459724.1|1434045_1434996_+	recombinase RecT	NA	A0A2R2Z324	Escherichia_phage	100.0	1.4e-179
WP_000187066.1|1434992_1435682_+	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	100.0	2.7e-135
WP_000344634.1|1435681_1436269_+	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
WP_000077905.1|1436344_1436692_+	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|1436755_1437577_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159716.1|1437653_1438097_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	100.0	1.7e-79
WP_001453790.1|1438204_1439083_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_000157000.1|1439079_1439283_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000476217.1|1439275_1439515_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	100.0	2.1e-39
WP_001303141.1|1439511_1440459_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
WP_001301469.1|1440460_1440967_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001301947.1|1440926_1441142_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001142590.1|1441143_1441362_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|1441363_1441651_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_000206752.1|1441654_1442278_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_001451754.1|1442539_1443109_+	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_001302866.1|1443151_1443457_-	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451755.1|1443545_1443743_-	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001260980.1|1443871_1444129_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	8.6e-39
WP_000211992.1|1444453_1445131_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_000809302.1|1445186_1445618_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163444.1|1445614_1446241_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_001291844.1|1446200_1446413_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994803.1|1446448_1446826_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_000453637.1|1446904_1447087_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|1447070_1448240_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000958700.1|1448671_1449829_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|1450003_1451140_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
1449842:1449858	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|1451149_1451830_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|1451816_1452284_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|1452283_1452814_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 8
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	1693219	1746819	5530826	tRNA,tail,transposase,holin	Enterobacteria_phage(28.57%)	56	NA	NA
WP_000997403.1|1693219_1694257_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1694463_1694883_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|1694951_1695650_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|1695681_1698342_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1698455_1699811_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|1699856_1700180_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|1700176_1701475_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|1707250_1709824_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|1709953_1710685_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|1710681_1711662_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1711796_1712534_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1712804_1713146_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|1713249_1713297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|1713395_1714556_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|1714598_1715720_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|1715730_1716801_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|1717010_1717376_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|1717525_1718044_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969012.1|1718033_1719260_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589827.1|1719275_1719758_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1719834_1720182_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1720223_1720991_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1721021_1721570_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1721588_1721837_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1721973_1723335_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1723501_1724293_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|1724314_1725601_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301442.1|1725655_1726249_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|1726371_1727250_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|1727335_1728997_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1729145_1729487_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|1729548_1729839_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|1729828_1730305_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1730436_1730919_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|1731764_1732013_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001302510.1|1732408_1732528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132152.1|1732514_1733105_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|1733287_1733938_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_055154525.1|1734016_1735075_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|1735204_1735627_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|1735787_1736057_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000165061.1|1736274_1736601_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001299612.1|1736597_1737488_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000998000.1|1737294_1737939_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_000612591.1|1737988_1738336_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1738332_1738713_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|1739069_1739414_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|1739418_1739634_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|1739783_1741637_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|1742044_1742212_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|1742297_1743041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|1743293_1743917_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|1743913_1744579_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|1744575_1745187_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|1745161_1745728_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|1746063_1746819_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	3348084	3362749	5530826	tRNA,tail,integrase	Enterobacteria_phage(37.5%)	19	3349365:3349380	3366893:3366908
WP_000956557.1|3348084_3348618_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|3349035_3349317_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
3349365:3349380	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|3349661_3349859_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001449563.1|3350005_3350185_-	hypothetical protein	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
WP_000145668.1|3350194_3350479_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|3350475_3350826_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|3350816_3351353_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|3352674_3353274_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268962.1|3353338_3354652_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023355.1|3354653_3354923_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|3355034_3355607_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|3355679_3356309_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|3356390_3357032_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|3357192_3357441_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|3357502_3358600_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|3358688_3359726_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|3359859_3360102_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|3360267_3361251_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|3361333_3362749_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
3366893:3366908	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 10
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	3499627	3558638	5530826	protease,transposase	Pectobacterium_phage(12.5%)	60	NA	NA
WP_000312488.1|3499627_3500887_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3500889_3501894_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3501975_3502173_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3502276_3503575_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3503779_3504205_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|3504243_3506685_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|3506865_3507597_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|3507723_3508125_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|3508143_3508842_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|3508892_3509552_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|3509569_3509968_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|3509977_3510616_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|3510618_3511782_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|3511865_3513491_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|3513607_3513883_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|3514031_3514361_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|3514542_3515292_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|3515288_3516044_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|3516151_3517216_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001301921.1|3517570_3518968_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|3518983_3519289_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|3519298_3519763_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|3519776_3520427_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949515.1|3520436_3521291_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|3521290_3521977_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|3522105_3522381_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|3522707_3523103_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|3523109_3523424_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|3523428_3523656_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|3523697_3524147_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|3524217_3525012_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|3525634_3526066_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|3526073_3527282_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|3527416_3528055_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|3528272_3528893_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|3529201_3530614_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|3530658_3531321_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|3531428_3532394_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|3532501_3533362_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|3533450_3533831_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|3533948_3535892_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|3536081_3536822_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937659.1|3537033_3537972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|3538034_3538589_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|3538913_3539120_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|3539198_3540542_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|3540864_3541503_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|3541708_3543442_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060931.1|3543438_3547218_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|3547220_3547562_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|3547773_3548025_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|3548018_3548369_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|3548448_3548979_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|3549288_3550245_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001301928.1|3551900_3552923_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|3552909_3553905_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|3553937_3554936_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|3555111_3556485_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|3556640_3557192_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|3557285_3558638_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 11
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	3957760	4022010	5530826	tRNA,transposase,plate	uncultured_Caudovirales_phage(33.33%)	53	NA	NA
WP_000176538.1|3957760_3959056_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3959108_3959369_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3959355_3959556_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|3959721_3960267_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|3960263_3960674_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|3960687_3961398_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|3961597_3962422_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|3962474_3964193_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|3964303_3965011_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|3965007_3965412_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|3965529_3966345_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|3966384_3967038_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|3967030_3968062_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|3968249_3968825_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|3974584_3975388_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|3975384_3976299_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3976539_3977340_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|3977417_3978188_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|3978235_3979594_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|3979665_3980421_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|3980454_3981177_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3981173_3981641_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|3981705_3982437_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|3982974_3983775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000583960.1|3983959_3984256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|3984252_3984702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|3984704_3985301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|3985379_3985601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|3985621_3986101_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|3986066_3987476_-	membrane protein	NA	NA	NA	NA	NA
WP_001356738.1|3987486_3990921_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|3991057_3992470_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|3992474_3993218_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614380.1|3993214_3995986_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	3.6e-82
WP_000343292.1|3995994_3996756_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|3996760_3998092_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|3998094_3998619_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000348794.1|3999919_4001002_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|4000965_4002816_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|4002819_4003233_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|4003323_4004715_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|4004765_4004990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|4005024_4005525_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|4006221_4006740_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|4006949_4009091_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_151142831.1|4009166_4013399_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_071526866.1|4013604_4014255_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001452927.1|4016012_4016546_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|4017292_4018429_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001145876.1|4018431_4020192_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000247943.1|4020393_4020657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|4020571_4020757_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|4020837_4022010_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	4040796	4052774	5530826		Enterobacteria_phage(30.0%)	10	NA	NA
WP_000749881.1|4040796_4041852_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|4042139_4043243_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|4043254_4044508_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|4045577_4045823_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_001274756.1|4046586_4047300_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|4047400_4047601_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|4047719_4048013_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|4048964_4049276_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000904979.1|4051388_4051943_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|4052000_4052774_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
>prophage 13
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	4635503	4673604	5530826	lysis,portal,terminase,holin,tail,protease,integrase	Enterobacteria_phage(48.84%)	53	4624945:4624959	4657239:4657253
4624945:4624959	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|4635503_4636574_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|4636551_4636770_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|4636809_4636977_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_071525073.1|4636909_4637095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120056.1|4637219_4637822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|4638032_4638254_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|4638352_4638634_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|4638644_4638836_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|4638808_4638991_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|4638987_4639668_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|4640365_4640548_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|4640544_4640715_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|4640707_4641328_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|4641324_4641990_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|4642201_4643161_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|4643498_4643621_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|4643635_4644325_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|4644508_4645252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|4645337_4645496_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|4645576_4645975_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|4646117_4646333_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075097.1|4646332_4646830_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	2.7e-89
WP_000092302.1|4646826_4647294_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|4647281_4647434_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_001303851.1|4647840_4648119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349509.1|4648108_4648600_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_151142839.1|4648599_4650702_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.4	0.0e+00
WP_001072975.1|4650698_4650911_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|4650838_4651963_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|4652084_4652420_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|4652364_4654392_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|4654478_4654802_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4654794_4655070_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|4655081_4655660_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|4655656_4656058_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|4656068_4656812_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|4656872_4657259_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
4657239:4657253	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|4657267_4657597_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|4657568_4660634_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|4660633_4660963_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|4660972_4661671_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|4661676_4662420_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|4662356_4662965_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|4663025_4666439_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|4666509_4667109_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741889.1|4667168_4668485_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001024022.1|4668486_4668756_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|4668932_4669913_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|4669946_4670966_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|4671462_4671624_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951025.1|4671793_4672675_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_096976694.1|4672649_4672853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247925.1|4672905_4673604_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 14
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	4913648	4969121	5530826	transposase,portal,holin,tail,protease,head	Escherichia_phage(26.67%)	71	NA	NA
WP_000375128.1|4913648_4914308_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_000273151.1|4915699_4915942_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|4916009_4918481_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|4918574_4918766_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|4918762_4918951_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001303875.1|4919217_4919523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|4919524_4919710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|4919896_4920286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|4920427_4920583_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_071525099.1|4920640_4920859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|4920860_4921148_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|4921147_4921339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|4921366_4921768_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|4921876_4922149_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|4922132_4922558_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|4922764_4923220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|4923298_4924390_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788745.1|4924396_4925143_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_000450992.1|4925164_4925935_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|4925950_4926364_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|4926715_4927489_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_097561939.1|4927500_4927692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000955173.1|4927854_4927992_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|4928036_4928249_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|4928416_4928695_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|4928696_4929746_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|4929758_4930130_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|4930119_4930491_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|4930642_4931461_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|4931747_4931987_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|4932081_4932795_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042853491.1|4933241_4933445_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000874392.1|4933562_4935413_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|4935588_4936801_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|4937006_4937321_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|4937848_4938034_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|4938255_4938369_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|4938589_4939123_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_001303879.1|4939155_4939350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|4939282_4939555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303880.1|4939503_4939848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|4939810_4940017_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|4940767_4941043_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|4941118_4941499_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612598.1|4941495_4941843_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_000998048.1|4941892_4943431_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|4943480_4943723_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|4945607_4945814_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|4945810_4947403_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|4947392_4948898_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|4948934_4949282_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|4949339_4949606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|4949587_4950328_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|4950341_4950773_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|4950799_4951213_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082464.1|4951193_4953773_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.2	0.0e+00
WP_000847298.1|4953769_4954099_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|4954098_4954797_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_050946666.1|4954807_4955551_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	8.6e-148
WP_050546863.1|4955496_4956129_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001303882.1|4956082_4956289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649829.1|4956319_4956847_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515111.1|4956980_4960454_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_001230444.1|4960521_4961121_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268962.1|4961185_4962499_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|4962500_4962770_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001303884.1|4964102_4964285_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_151142842.1|4964902_4966021_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|4966017_4967811_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|4967829_4968537_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|4968533_4969121_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 15
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	5229573	5350132	5530826	tRNA,transposase,lysis,portal,integrase,terminase,holin,tail,protease,head,capsid	Enterobacteria_phage(38.89%)	157	5294180:5294195	5323746:5323761
WP_000952736.1|5229573_5230395_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|5230550_5231597_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|5231593_5232388_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|5232554_5233673_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|5233641_5233911_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|5233972_5234362_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|5234494_5235010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|5235124_5235277_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|5235592_5236069_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|5236193_5236517_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|5236500_5236926_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|5236994_5238032_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_001301518.1|5238063_5238486_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000451012.1|5238519_5239236_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|5239232_5239550_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|5239546_5239849_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|5239838_5240156_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|5240109_5240427_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|5240413_5240851_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|5240852_5241044_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|5241046_5241634_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|5241749_5241854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|5242042_5242255_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|5242422_5242701_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|5242702_5243752_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|5243764_5244139_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|5244135_5244957_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|5245553_5245721_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|5246035_5247973_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|5248120_5248303_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|5248340_5248610_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|5248685_5248901_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|5248905_5249250_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|5249300_5249834_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|5250104_5250674_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5250673_5250820_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|5251047_5251254_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|5251318_5251543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|5251899_5252040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|5252169_5252355_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|5252396_5252762_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001477518.1|5252724_5252859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958416.1|5253050_5253614_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|5253610_5255272_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|5255335_5257273_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|5257317_5257539_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001356670.1|5257484_5259986_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	98.8	0.0e+00
WP_000126019.1|5260065_5260392_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|5260401_5260752_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|5260748_5261195_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|5261191_5261536_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|5261601_5262318_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|5262332_5262707_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|5262802_5263012_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212850.1|5263064_5266307_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_000807954.1|5266299_5266641_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072617013.1|5266640_5267339_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	2.4e-131
WP_000170104.1|5267355_5267610_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|5267719_5267830_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|5268132_5269011_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|5269064_5269802_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|5269747_5269984_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|5269996_5270086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|5270105_5272454_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|5273044_5276446_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|5278549_5278675_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|5278754_5279030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|5279090_5280452_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303923.1|5280572_5280785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000799385.1|5280815_5281679_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|5281662_5282799_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|5283048_5284275_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|5284323_5285445_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085256.1|5285693_5286923_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|5287287_5287476_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|5287525_5287852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|5288280_5288478_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|5288470_5288683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|5288672_5289137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|5289129_5289363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|5289368_5289668_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|5289664_5291065_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|5291265_5291517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|5291513_5291924_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|5291934_5292207_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301569.1|5292163_5292292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|5292333_5292558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|5292809_5293016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|5293015_5294071_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|5294083_5294419_+|head	head decoration protein	head	NA	NA	NA	NA
5294180:5294195	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|5294431_5294845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|5295050_5295593_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|5295848_5296130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|5296730_5298191_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|5298190_5298862_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|5299030_5300401_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|5300404_5301046_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|5301081_5302188_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|5302241_5302703_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|5302712_5303366_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|5303537_5304788_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|5304901_5306044_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|5306033_5306270_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|5306373_5307198_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|5307194_5307896_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|5307892_5308195_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|5308262_5308595_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|5308659_5308782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071525067.1|5310484_5310676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053040.1|5310866_5311322_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|5311321_5311492_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|5311484_5311775_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|5311771_5312134_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|5312130_5312271_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|5312267_5312957_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|5313278_5313584_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|5313570_5314047_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|5314263_5314446_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|5314536_5314830_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_085948178.1|5315032_5316245_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000079504.1|5316434_5316845_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|5317130_5317337_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|5317501_5317696_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|5318084_5318630_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|5318604_5320530_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|5320526_5320733_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|5320729_5322331_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|5322311_5323631_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|5323640_5323973_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
5323746:5323761	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|5324028_5325054_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|5325095_5325494_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|5325505_5325859_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|5325870_5326449_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|5326445_5326841_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|5326848_5327589_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|5327604_5328027_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|5328008_5328443_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|5328435_5330985_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|5330981_5331311_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|5331310_5332009_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|5332014_5332758_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|5332694_5333327_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|5333387_5336786_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|5336852_5337452_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|5337516_5340432_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|5340431_5341013_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|5341132_5342023_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|5342041_5342548_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|5342584_5343085_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|5343163_5343346_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|5343843_5344512_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|5344568_5344817_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|5344892_5345273_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|5345269_5345617_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|5345666_5347205_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|5347507_5348992_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|5349178_5350132_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 16
NZ_CP044148	Escherichia coli O157 strain AR-0427 chromosome, complete genome	5530826	5447389	5496552	5530826	lysis,capsid,portal,terminase,holin,tail,head,integrase	Escherichia_phage(35.42%)	62	5447226:5447253	5506506:5506533
5447226:5447253	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|5447389_5448520_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|5448497_5448746_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|5448810_5451282_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090196.1|5451374_5451566_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|5451562_5451751_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|5452148_5452316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|5452309_5452543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|5452520_5452928_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|5452950_5453169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|5453241_5453541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|5453804_5454212_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|5454288_5454516_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|5454499_5455051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|5455022_5456063_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|5456094_5456517_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|5456703_5457285_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|5457281_5457446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|5458144_5458903_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|5459181_5459394_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|5459614_5459872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|5459941_5460220_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|5460221_5461268_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|5461280_5461640_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|5461648_5462179_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|5462420_5462618_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_064761991.1|5464317_5464503_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000143067.1|5464622_5466476_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|5466625_5466841_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|5466845_5467190_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|5467240_5467774_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|5468044_5468614_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5468613_5468760_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_127821358.1|5468767_5469235_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	91.6	8.2e-72
WP_001302717.1|5469698_5470013_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|5470094_5470319_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|5470334_5470592_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867498.1|5470705_5471251_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|5471225_5473151_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|5473147_5473354_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|5473350_5474952_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|5474932_5476252_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|5476261_5476594_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|5476649_5477675_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|5477716_5478115_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|5478126_5478480_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|5478494_5479028_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|5479024_5479420_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|5479427_5480180_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|5480193_5480616_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|5480642_5481056_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_072643101.1|5481036_5483649_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	94.5	0.0e+00
WP_000847298.1|5483645_5483975_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|5483974_5484673_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_151142846.1|5485372_5486002_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	6.0e-102
WP_072643102.1|5486242_5489068_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.0	0.0e+00
WP_001228304.1|5489135_5489735_+	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216534.1|5489886_5491191_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|5491192_5491462_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|5492488_5493814_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_024262009.1|5494081_5494270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106409364.1|5495411_5495534_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|5495640_5496552_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
5506506:5506533	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
>prophage 1
NZ_CP044149	Escherichia coli O157 strain AR-0427 plasmid pAR-0427-1	74819	1029	10334	74819	transposase	Escherichia_phage(37.5%)	13	NA	NA
WP_000959884.1|1029_1992_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_001414994.1|1994_2345_+	plasmid stability family protein	NA	NA	NA	NA	NA
WP_024181414.1|2453_2873_+	hypothetical protein	NA	E5AGG6	Erwinia_phage	50.0	1.6e-18
WP_000005461.1|2807_3689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4161_4866_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000144779.1|4902_5559_-	hypothetical protein	NA	A0A2H4P756	Pseudomonas_phage	43.7	7.0e-45
WP_000571065.1|5555_6065_-	trimethoprim-resistant dihydrofolate reductase DfrA8	NA	A0A1Y0SUI9	Pseudomonas_phage	38.8	6.5e-14
WP_001067855.1|6160_6865_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|7155_8016_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001415369.1|8202_8532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251694.1|8766_8988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131876.1|8978_9182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|9518_10334_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
>prophage 1
NZ_CP044150	Escherichia coli O157 strain AR-0427 plasmid pAR-0427-2	85887	521	70826	85887	transposase,integrase,protease	Escherichia_phage(25.0%)	60	NA	NA
WP_085948178.1|521_1734_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000704522.1|2219_3080_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000205762.1|3138_3885_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_151142793.1|17291_18504_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.0	1.2e-167
WP_001453090.1|18725_19157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302184.1|21378_21537_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001276250.1|21768_22530_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845908.1|22526_22961_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117168.1|23015_24974_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000005995.1|25039_25273_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290823.1|25329_25782_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000547965.1|25807_26014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032338770.1|26083_26557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302171.1|26642_27206_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_000199442.1|27251_28613_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|28664_28895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001367298.1|29157_29415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|29382_29772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|29890_30082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271685.1|30078_30501_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|30547_30850_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001310284.1|30945_31518_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_001358893.1|32212_32767_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104869.1|32660_32882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|32882_33566_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_010891292.1|33642_33948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|33951_34854_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_001349526.1|34891_35164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817031.1|35548_36520_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|36519_37686_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_151142859.1|37641_37857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|38688_39901_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_077631973.1|39867_39948_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_000016989.1|40624_41431_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_001159868.1|41431_41737_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|41738_41957_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_010891291.1|42415_43099_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001248529.1|43095_43716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|43712_43913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127460642.1|43819_44041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361615.1|44319_45297_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_001066920.1|45581_46322_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_010891288.1|46442_46673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302186.1|46643_46841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303402.1|47154_47349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000987091.1|48856_50977_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_000217733.1|51026_54023_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|54024_54540_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_151142862.1|56399_56831_-	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000096786.1|56922_57756_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_001004187.1|57813_58326_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_071525076.1|58312_59485_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000776550.1|59523_60501_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_000082782.1|60497_61097_-	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000173396.1|61093_61441_-	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082929.1|61455_62010_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_001173152.1|62470_63694_-	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_000092338.1|63695_65201_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001302175.1|67167_68043_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001358886.1|68129_70826_-|protease	metalloprotease StcE	protease	NA	NA	NA	NA
