The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	0	5340	4538615		Escherichia_phage(50.0%)	3	NA	NA
WP_000551132.1|1937_2561_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
WP_005031414.1|2740_4492_-	T3SS effector E3 ubiquitin-protein ligase IpaH2	NA	NA	NA	NA	NA
WP_001210039.1|5091_5340_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	4.1e-38
>prophage 2
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	11165	18228	4538615		Bacillus_virus(50.0%)	9	NA	NA
WP_000974712.1|11165_11687_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024930.1|11688_12291_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|12360_12426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580324.1|12564_13176_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568525.1|13184_14195_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.2	2.8e-08
WP_000571470.1|14341_15127_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202992.1|15123_15879_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	3.8e-18
WP_001342995.1|15957_16890_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|16905_18228_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 3
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	22225	23701	4538615		Cyanophage(100.0%)	1	NA	NA
WP_000301736.1|22225_23701_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 4
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	31758	36893	4538615	integrase	uncultured_Caudovirales_phage(50.0%)	6	31090:31103	37733:37746
31090:31103	attL	CAGTTTTAGCCGCT	NA	NA	NA	NA
WP_000944268.1|31758_32421_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	3.5e-07
WP_000916763.1|33202_33433_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|33571_33946_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000976476.1|34834_35176_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189099.1|36253_36646_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.8	2.0e-31
WP_005127484.1|36611_36893_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
37733:37746	attR	CAGTTTTAGCCGCT	NA	NA	NA	NA
>prophage 5
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	54616	55717	4538615		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768389.1|54616_55717_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.4	2.9e-136
>prophage 6
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	61902	63343	4538615		Escherichia_phage(50.0%)	2	NA	NA
WP_005050353.1|61902_62187_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	50.0	2.2e-19
WP_000845079.1|62332_63343_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	1.4e-23
>prophage 7
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	67637	71796	4538615		Planktothrix_phage(50.0%)	3	NA	NA
WP_000193541.1|67637_68612_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.1e-17
WP_000979625.1|68608_69505_-	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_005062918.1|70650_71796_-	diguanylate cyclase DosC	NA	A0A127AWB9	Bacillus_phage	41.9	1.9e-05
>prophage 8
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	77922	80442	4538615		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_001154659.1|77922_80442_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.8e-16
>prophage 9
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	100440	105524	4538615		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367164.1|100440_100809_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	40.4	3.8e-16
WP_000089364.1|100817_102305_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948872.1|102314_103061_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000907988.1|103035_104307_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144580.1|104303_105524_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.9	1.9e-91
>prophage 10
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	114588	115257	4538615		Escherichia_phage(100.0%)	1	NA	NA
WP_045177720.1|114588_115257_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.7e-22
>prophage 11
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	122177	133418	4538615	transposase	Orpheovirus(14.29%)	12	NA	NA
WP_000493947.1|122177_122819_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098906.1|122858_124007_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	7.2e-85
WP_001182361.1|124297_125509_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269495.1|125621_126554_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|126550_127576_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_032155892.1|127874_127964_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701054.1|128129_129299_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|129444_130026_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101178.1|130153_130981_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000108172.1|131315_131663_+	monothiol glutaredoxin 4	NA	NA	NA	NA	NA
WP_000604921.1|131701_132202_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	57.7	2.8e-41
WP_000826441.1|132209_133418_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1W6JP07	Morganella_phage	97.6	3.0e-206
>prophage 12
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	141374	142873	4538615		Indivirus(50.0%)	2	NA	NA
WP_000250631.1|141374_142271_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.0	6.1e-07
WP_005050299.1|142351_142873_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	6.0e-47
>prophage 13
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	148778	152395	4538615	tRNA,transposase	Shigella_phage(50.0%)	3	NA	NA
WP_094081542.1|148778_150006_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_001282319.1|150335_150992_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_001367866.1|151120_152395_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	6.7e-84
>prophage 14
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	173054	174758	4538615		Vaccinia_virus(100.0%)	1	NA	NA
WP_151090723.1|173054_174758_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.3	0.0e+00
>prophage 15
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	184494	185796	4538615		Bacillus_phage(100.0%)	1	NA	NA
WP_000732493.1|184494_185796_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 16
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	197638	242614	4538615	protease,integrase,transposase	Escherichia_phage(30.0%)	39	205274:205290	213071:213087
WP_001260855.1|197638_198460_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|198559_198643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743950.1|198735_199071_-	acid shock protein	NA	NA	NA	NA	NA
WP_112346200.1|200827_201766_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225287.1|201900_203121_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919213.1|203245_203941_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071829158.1|203893_205186_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
205274:205290	attL	AAACGTGACATTGTAAC	NA	NA	NA	NA
WP_000148710.1|205344_205959_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526473.1|206001_206856_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213020.1|206857_207475_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_024259245.1|209584_210694_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	46.6	2.2e-83
WP_005050206.1|210676_211714_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_094105069.1|211752_212950_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000113584.1|213919_214288_+	hypothetical protein	NA	NA	NA	NA	NA
213071:213087	attR	AAACGTGACATTGTAAC	NA	NA	NA	NA
WP_001091024.1|214718_215234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199921.1|215223_215724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000971490.1|216044_216536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000207512.1|216620_217610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005084471.1|219433_219754_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
WP_005050191.1|219952_220258_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|220365_221076_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000705197.1|221673_222015_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|222149_222476_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_005050183.1|222681_223896_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	2.4e-46
WP_085949497.1|223972_225119_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_094081542.1|225169_226398_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_001222721.1|227647_228640_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911160.1|228639_229668_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194865.1|229661_231197_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000154339.1|231445_232399_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113157.1|232477_233380_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_001191842.1|234822_235593_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558531.1|235616_235907_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286595.1|235946_236705_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_005050130.1|236708_237623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000957853.1|237823_238012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039057289.1|238021_239221_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000854633.1|239517_240969_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558037.1|241195_242614_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	1.1e-18
>prophage 17
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	248927	249311	4538615		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|248927_249311_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 18
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	252342	253499	4538615	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_094081550.1|252342_253499_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
>prophage 19
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	258508	269263	4538615	holin	Escherichia_phage(25.0%)	14	NA	NA
WP_000214712.1|258508_258712_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527804.1|258747_260208_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
WP_071818640.1|262530_262836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|262860_263100_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|263099_263387_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|263458_263614_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980987.1|263831_264083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265249.1|264429_265479_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.2e-108
WP_000904111.1|265491_265848_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762882.1|265862_266684_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_000871291.1|267992_268328_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|268587_268776_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001323614.1|268772_268934_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_000372594.1|269083_269263_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	91.5	4.1e-24
>prophage 20
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	281106	300645	4538615	tRNA	Staphylococcus_phage(11.11%)	18	NA	NA
WP_005050037.1|281106_282753_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	5.5e-30
WP_000069384.1|282809_285188_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_151090727.1|285519_286353_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082230.1|286509_287556_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	9.4e-84
WP_001270810.1|287687_287879_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_005050031.1|287882_289319_-	YdiU family protein	NA	NA	NA	NA	NA
WP_005062637.1|289382_290096_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209775.1|290342_290807_-	lipoprotein	NA	S5MM68	Bacillus_phage	36.9	1.6e-11
WP_000029466.1|290884_291634_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_000956532.1|292248_293229_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|293328_293628_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672419.1|293632_296020_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018591.1|296034_297018_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	2.4e-33
WP_001386830.1|297300_297345_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124854.1|297467_297824_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|297876_298074_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_032155788.1|298170_298713_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_001144202.1|298716_300645_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 21
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	315151	315979	4538615		Bacillus_virus(100.0%)	1	NA	NA
WP_000175045.1|315151_315979_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	1.0e-72
>prophage 22
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	332810	333464	4538615		Planktothrix_phage(100.0%)	1	NA	NA
WP_004972005.1|332810_333464_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	1.4e-13
>prophage 23
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	336593	342359	4538615	transposase	Shigella_phage(50.0%)	4	NA	NA
WP_094081542.1|336593_337822_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_077696380.1|337920_339114_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000756955.1|339230_340271_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_001235813.1|340397_342359_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	4.1e-40
>prophage 24
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	347285	351371	4538615		Tupanvirus(50.0%)	4	NA	NA
WP_001120538.1|347285_347927_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	3.8e-19
WP_005062509.1|348019_349378_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719101.1|349495_350254_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723702.1|350390_351371_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.8e-07
>prophage 25
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	360184	360946	4538615		Indivirus(100.0%)	1	NA	NA
WP_001186355.1|360184_360946_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.7	8.0e-08
>prophage 26
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	373570	374137	4538615		Pseudomonas_phage(100.0%)	1	NA	NA
WP_005098561.1|373570_374137_+	helix-turn-helix transcriptional regulator	NA	A0A076FRF7	Pseudomonas_phage	51.8	1.8e-09
>prophage 27
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	377366	456191	4538615	tail,transposase,tRNA,protease,integrase	Escherichia_phage(47.22%)	69	410885:410901	447368:447384
WP_005049882.1|377366_379052_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	6.9e-36
WP_000290582.1|379257_379839_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220997.1|379878_380574_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128851.1|380631_382542_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.7	3.8e-91
WP_001295493.1|382673_383018_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|383379_383739_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457325.1|383858_384038_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855039.1|384111_385473_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.7	6.4e-40
WP_000456710.1|385476_386055_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624314.1|386238_387603_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_005049862.1|387733_389332_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394974.1|389335_390886_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150543.1|391348_392320_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|392382_393183_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001331209.1|393195_394047_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156246.1|394101_394578_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001668667.1|395766_396333_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010128.1|396329_397139_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|397304_397514_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|397526_397670_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006860.1|398339_398627_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714550.1|398701_398845_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211010.1|399003_399243_+	membrane protein	NA	NA	NA	NA	NA
WP_001262181.1|399385_400177_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127218.1|400353_401727_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|401772_402654_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055799.1|402845_404894_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000431370.1|404913_405612_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043881.1|405708_406206_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207280.1|406335_407619_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
410885:410901	attL	GAAGGCGTGGTGCGTAA	NA	NA	NA	NA
WP_001295499.1|411844_412081_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_005049838.1|412185_412377_+	YebW family protein	NA	NA	NA	NA	NA
WP_094190776.1|412633_413790_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	1.7e-65
WP_128568580.1|415819_417535_+	T3SS effector E3 ubiquitin-protein ligase IpaH3	NA	NA	NA	NA	NA
WP_001039888.1|417535_417715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000930142.1|417714_418338_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	2.7e-78
WP_094108344.1|420946_422219_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_000560226.1|422296_422518_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000245528.1|422511_422688_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_005049830.1|422762_423038_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	4.4e-41
WP_005135630.1|425864_426125_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	88.1	2.8e-37
WP_001173294.1|426130_427228_+	AAA family ATPase	NA	I6PCV5	Cronobacter_phage	83.8	1.3e-181
WP_005049823.1|428559_428727_+	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.3e-27
WP_000443254.1|429702_430308_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.0	7.3e-113
WP_000555620.1|430739_431654_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983722.1|431653_432481_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|432477_433335_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968134.1|433331_434189_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_151090730.1|434389_435013_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	77.5	9.3e-79
WP_005098694.1|434963_436232_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	43.0	2.2e-74
WP_011069357.1|436823_437192_-	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	55.4	2.6e-20
WP_000082749.1|438866_439049_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000615491.1|441416_443021_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_045178261.1|443654_444161_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	73.2	1.9e-42
WP_094081550.1|444207_445364_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_005049799.1|445425_445611_-	hypothetical protein	NA	A0A291AWU3	Escherichia_phage	63.4	1.5e-05
WP_000640143.1|445751_446306_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	3.7e-71
WP_000228038.1|446302_446593_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000940329.1|446592_447192_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	94.5	1.4e-108
WP_000018421.1|448528_448741_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
447368:447384	attR	GAAGGCGTGGTGCGTAA	NA	NA	NA	NA
WP_000610655.1|449138_449504_-	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	53.7	6.1e-30
WP_000208062.1|449503_450169_-	hypothetical protein	NA	A0A076G611	Escherichia_phage	44.9	6.1e-36
WP_001229297.1|450165_450531_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	98.3	2.1e-67
WP_000256998.1|450532_450751_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
WP_005048249.1|450843_451200_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	5.1e-58
WP_001118168.1|451257_451680_-	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	75.9	1.1e-51
WP_000788996.1|451694_452441_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	89.2	2.1e-122
WP_094108344.1|453234_454507_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_151090731.1|455035_456191_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
>prophage 28
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	499643	505300	4538615		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|499643_500450_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968844.1|500517_500871_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|501238_502027_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_005049719.1|502170_503298_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000485028.1|503365_505300_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.7	5.3e-32
>prophage 29
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	513103	513694	4538615		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|513103_513694_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 30
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	518618	523910	4538615	protease	Tupanvirus(33.33%)	4	NA	NA
WP_005049701.1|518618_521216_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	9.2e-88
WP_001031530.1|521595_521847_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|521882_522932_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559292.1|523151_523910_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	2.0e-06
>prophage 31
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	528842	531800	4538615		Acinetobacter_phage(100.0%)	2	NA	NA
WP_151090732.1|528842_530438_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.9	3.2e-51
WP_000983893.1|530438_531800_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.9e-36
>prophage 32
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	539704	540834	4538615	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_094081548.1|539704_540834_-|transposase	IS3-like element ISSfl10 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	9.3e-61
>prophage 33
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	544696	546711	4538615		Planktothrix_phage(100.0%)	2	NA	NA
WP_000994905.1|544696_545701_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	35.6	8.0e-24
WP_000110954.1|545697_546711_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 34
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	557336	567227	4538615		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|557336_557954_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|558558_558972_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|559115_560024_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|560225_561239_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001295622.1|561330_562236_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_005105319.1|562348_562807_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|562856_563699_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160114.1|564304_564982_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571704.1|564981_565692_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702650.1|565688_567227_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 35
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	578358	584627	4538615		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
WP_001146444.1|578358_578589_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_000063614.1|578858_579959_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170961.1|580363_580471_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000811065.1|580619_581474_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257042.1|581509_582319_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|582322_582715_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|582711_583545_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|583544_584627_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 36
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	587763	590515	4538615		Tupanvirus(50.0%)	2	NA	NA
WP_005049665.1|587763_588711_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033366.1|588835_590515_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 37
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	608394	609153	4538615		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173321.1|608394_609153_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	2.2e-13
>prophage 38
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	627190	628878	4538615		Salmonella_phage(50.0%)	2	NA	NA
WP_000457611.1|627190_628459_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	2.3e-209
WP_000897378.1|628458_628878_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 39
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	632296	678986	4538615	tail,head,transposase,terminase,tRNA,protease,portal,integrase	uncultured_Caudovirales_phage(50.0%)	54	621951:621966	682502:682517
621951:621966	attL	CGGCACTGGTTTCCAG	NA	NA	NA	NA
WP_085947598.1|632296_633459_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_094081542.1|634185_635413_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_005047937.1|636136_636832_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|636855_637668_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|637671_637938_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|638688_638808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014532223.1|638768_638954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|639054_639228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005047943.1|639289_639574_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000979977.1|639577_639913_+	YmgD family protein	NA	NA	NA	NA	NA
WP_011110579.1|639969_642291_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.5	3.2e-92
WP_005047951.1|642407_642617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246473.1|643367_644891_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000444487.1|645788_647039_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248670.1|647210_647864_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|647873_648335_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_005047976.1|648388_649495_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005047980.1|649530_650172_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423725.1|650175_651546_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.2e-108
WP_001265481.1|651714_652386_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735425.1|652385_653846_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_128568578.1|654292_654481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133415.1|654642_654924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151090734.1|654937_656599_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	2.9e-276
WP_029716858.1|656582_656909_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	79.6	9.2e-46
WP_000174068.1|656964_657147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145905.1|657130_657571_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000134107.1|657570_657867_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	62.2	2.2e-30
WP_001020662.1|657863_658202_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000267599.1|658198_659410_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	78.5	3.1e-187
WP_000504054.1|659411_659984_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_001132078.1|661481_661706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000126624.1|661847_662009_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001294167.1|662018_662324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557473.1|662320_662599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761802.1|662887_664636_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.5	7.3e-89
WP_000770157.1|664632_664932_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204964.1|664937_665171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005005155.1|665385_665607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226783.1|665596_665797_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000103622.1|665926_666106_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
WP_154074686.1|666230_666560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|666609_666798_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000085257.1|667172_668402_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001295435.1|668650_669772_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359445.1|669820_671047_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|671296_672433_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|672416_673274_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000580316.1|673270_674065_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759317.1|674061_675108_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952739.1|675263_676085_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	4.3e-23
WP_000291255.1|676100_677012_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251390.1|677040_678285_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033710.1|678284_678986_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.2e-34
682502:682517	attR	CTGGAAACCAGTGCCG	NA	NA	NA	NA
>prophage 40
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	686274	686487	4538615		Erwinia_phage(100.0%)	1	NA	NA
WP_000006497.1|686274_686487_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	3.5e-06
>prophage 41
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	698882	700525	4538615		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267940.1|698882_699887_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|699883_700525_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 42
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	703796	704978	4538615		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|703796_704033_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|704243_704978_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 43
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	717330	718272	4538615		Brevibacillus_phage(100.0%)	1	NA	NA
WP_005048129.1|717330_718272_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	30.6	8.1e-10
>prophage 44
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	734116	734362	4538615		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|734116_734362_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 45
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	739024	774652	4538615	transposase	Shigella_phage(37.5%)	27	NA	NA
WP_005062003.1|739024_739945_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
WP_000074158.1|740116_740314_+	multidrug transporter	NA	NA	NA	NA	NA
WP_094081550.1|741294_742451_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_094081542.1|744343_745572_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_000747032.1|746144_747313_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000818776.1|747382_747628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747032.1|749795_750963_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000124119.1|751937_752303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937577.1|752302_753490_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001295445.1|753905_756449_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_011069327.1|756441_757977_-	glucans biosynthesis protein MdoG	NA	NA	NA	NA	NA
WP_001070350.1|758370_759528_+	glucans biosynthesis protein MdoC	NA	NA	NA	NA	NA
WP_011069326.1|759535_761017_-	cardiolipin synthase ClsC	NA	NA	NA	NA	NA
WP_000857408.1|760958_761492_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
WP_000489563.1|761586_761898_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000992821.1|762018_762351_-	curli assembly protein CsgC	NA	NA	NA	NA	NA
WP_001144017.1|762409_762775_-	curlin major subunit CsgA	NA	NA	NA	NA	NA
WP_005047380.1|764050_764506_-	curlin minor subunit CsgB	NA	NA	NA	NA	NA
WP_151090737.1|765259_765910_+	transcriptional regulator CsgD	NA	NA	NA	NA	NA
WP_151090738.1|765914_766304_+	curli production assembly/transport protein CsgE	NA	NA	NA	NA	NA
WP_001264088.1|766328_766745_+	curli production assembly/transport protein CsgF	NA	NA	NA	NA	NA
WP_001297187.1|767610_768102_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001001915.1|768203_768758_-	molecular chaperone YcdY	NA	NA	NA	NA	NA
WP_000283673.1|768781_769519_-	zinc-binding phosphatase	NA	NA	NA	NA	NA
WP_000611853.1|771025_772012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151090739.1|772603_773753_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.6	5.2e-51
WP_005047400.1|773863_774652_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.7	8.6e-90
>prophage 46
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	784849	786882	4538615		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028096.1|784849_785344_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_005047413.1|785364_786693_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	3.4e-232
WP_001273654.1|786774_786882_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
>prophage 47
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	791187	792108	4538615		Klosneuvirus(100.0%)	1	NA	NA
WP_000420619.1|791187_792108_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 48
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	797677	798370	4538615		Bacillus_phage(100.0%)	1	NA	NA
WP_001120136.1|797677_798370_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	1.0e-17
>prophage 49
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	803955	804168	4538615		Morganella_phage(100.0%)	1	NA	NA
WP_024259211.1|803955_804168_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	70.0	1.7e-21
>prophage 50
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	824193	824853	4538615	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375134.1|824193_824853_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
>prophage 51
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	829086	831141	4538615		Bacillus_phage(100.0%)	1	NA	NA
WP_005047455.1|829086_831141_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 52
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	838164	985759	4538615	protease,tRNA,integrase,transposase	Stx2-converting_phage(16.67%)	108	918260:918319	949837:951430
WP_000156489.1|838164_839925_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_005047466.1|839993_840512_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_011110566.1|840581_840749_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759120.1|841004_841568_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445541.1|841564_843205_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|843209_844463_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053116.1|844592_846500_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	8.3e-54
WP_001086554.1|846511_848620_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224274.1|848863_849973_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_004991542.1|849969_850512_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001370288.1|850685_851696_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001111452.1|851806_852544_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919489.1|852509_853025_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_005083752.1|853670_854654_-	fimbrial protein	NA	NA	NA	NA	NA
WP_151090741.1|854644_857245_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001263929.1|859287_859863_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244319.1|859855_860815_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000055999.1|860811_861957_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235193.1|861968_862151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|862239_863467_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001090476.1|864092_864860_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	4.1e-28
WP_000193826.1|865066_867682_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001297200.1|867947_869150_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|869318_870719_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977934.1|871319_872408_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462669.1|872592_873783_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109487.1|874005_874653_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|874679_875228_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925982.1|875408_877256_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_171763943.1|877463_878810_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000572706.1|878954_883415_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295931.1|883414_884119_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|884099_885422_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_005047510.1|885418_886204_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899599.1|886339_887119_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|887095_887989_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011599.1|888142_888889_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|888885_889068_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056529.1|889119_890352_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570540.1|890388_891375_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551266.1|891371_893120_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000167336.1|895622_895907_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|896066_897740_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125013.1|897850_898534_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|898706_899471_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445222.1|901077_902361_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057149.1|902431_903520_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_005051051.1|904474_906235_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000642544.1|906640_907498_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292813.1|907552_909835_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	4.9e-162
WP_000111043.1|910026_910767_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_134797803.1|911175_912331_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	6.8e-67
WP_134797803.1|913192_914349_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	6.8e-67
WP_111779742.1|914802_915447_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000638232.1|916823_917012_-|transposase	transposase domain-containing protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	4.5e-05
918260:918319	attL	GTATTAATGATATCCAGTTGCTCTGAGATTGTTTCCCCCATTTCTTTCAGAACACCTCCA	NA	NA	NA	NA
WP_005048975.1|918749_919100_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_005051091.1|919096_919771_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	3.4e-10
WP_151090742.1|920339_921495_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_024219169.1|921596_922478_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001091542.1|922612_923896_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_000593940.1|924036_926217_-	hydratase	NA	NA	NA	NA	NA
WP_001036463.1|926399_927833_-	anion permease	NA	NA	NA	NA	NA
WP_000723652.1|927908_928961_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_000815445.1|930138_931134_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_005061694.1|931393_931525_-	hypothetical protein	NA	A0A0C4UR34	Shigella_phage	86.7	2.6e-07
WP_011110560.1|932014_933841_+	invasion protein	NA	NA	NA	NA	NA
WP_001039888.1|933841_934021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005061679.1|934020_934638_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.7e-81
WP_094081550.1|934703_935859_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_134796902.1|936872_938002_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	4.6e-60
WP_000935590.1|938515_939364_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	57.0	9.7e-55
WP_094081542.1|939911_941139_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_001005968.1|941381_941585_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	82.5	1.0e-10
WP_001091985.1|941586_941742_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.2e-07
WP_000787424.1|941944_942352_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_000912291.1|942428_942656_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000702036.1|942639_943062_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	3.8e-68
WP_001118167.1|944684_945107_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
WP_005048249.1|945164_945521_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	5.1e-58
WP_029716636.1|945689_946355_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000882657.1|946525_946738_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
WP_000747032.1|947020_948188_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_005063916.1|948728_950330_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.6	1.2e-146
WP_005048975.1|950326_950677_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_005051091.1|950673_951348_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	3.4e-10
WP_000109301.1|951660_952809_-	MFS transporter	NA	NA	NA	NA	NA
949837:951430	attR	GTATTAATGATATCCAGTTGCTCTGAGATTGTTTCCCCCATTTCTTTCAGAACACCTCCACAGGCCGGGCAACTGGTTTCAGCAGGCAGAAGGCGATGTGTCTCCCGGGGAAGTTCTGCCGGCAGCGGTTTTCGTGAAGATTTTCGTCCCGGGAATTCAGGCTTACTGGCGATCGGGTTTTCTGACGGGGGACTGGTGTCAGGTGAATCTGTGACTGACGATGCATCTTCCAGAAGATTTCTGGCTGTGTTCAGCCGGTTTTCCAGTTCCGACAGTCGTTTTTCTGCCTGTCGGATCTGATTTTCAAGCTTATGACGCTTTTTCTCTGAACTCTGGCCGAACAACATACGACGCAACCTGTCGAGTTGCGCTTTCAGCCGTTCAATTTCCTGCTCATAGCCCGCGACCTGACAGGCATACTGTCGAAGCCGACTCTGTTGCTTACGCAACATGGCTTTAAGCAGCTCAATATCATCGGGGAGTTCATTGTTCATTCCCTTGTTTTATCACGGGTTATATCCGGATGCCAGGCCGTTCTGTCCGTTTGGGATGTTGCCACGCGATCCCCTCCAGTAGCATGGATAACTGAGCTGGCGTCAGGTGCACTTTCCCTTCCCGGGTCACCGGCCAGACGTTTGGTGAACAGGCATAACCCGTCACGATCGGCCCACAGTATTTTCACCATTTTGCCACTGCGGCCCCGGAAGACGAAGATATGCCCGGAGAACGGGTCATCTTTCAGCGTGTTCTGCACCTTCGAAGCCAGGCCATTGAAGCCACAACGCATATCTGTGATGCCAGCGATGATCCAGATTTTGGTACCGGTCGGCAGCGTTATCATCGGATACCCCCTTTCATTTCGCGGATTAGCGCCCGTAACAGTTCCGGAGTGAGAGGGTCAGACAGTTTTACCACACCTGATTTAAGATGCAGCTCGCACCGTGGGACGTTTCCGGGAGCCCCCTCAGGGCGCTCATCATGCTTGTTACGCCAGAAGGGATTTGTAACTGGTCTGGTCGGCTCCGGCGTATCAGTCAGTGCCACCGGGACAGGCATGCATTCCTGTATGTCATCATCGCTCAGTAAGCCGTCCTCGTACTGGCTTTTCCATTTAAACAGCAGGTTATTATTGATATCGTGTTCTCTGGCGATCCGGGCAACAACAGCCCCAGGCTGTAATGCCTGCTTAGCCAGACGGACCTTAAATTCACGGCTATAGCTGGTTCGCCGTTCTTTTCGCCATGAGCCTTCTCTGATTTGAGGCTCTGTTAATTCCTTCTTTCTGTTGGCATAAAGGATGGCGTCAAGTTGAGCGAATGAAACTGAATCGGGCAATGGCCATGCGATACCGGATGCAAGAAATCGCTGAAAAAGCGTATGTATTGTGGAATGACTGAGACCCAGACGCTGAGCGATGGCCCGGATGGTCAGTTTATCTTCAAATCTTAAACGCAGGGCATCAGGCAAATAAGAACGGAAGCAGGGAATATCTTTTGTTGTCTGGGAATTCATCGTTCGTGTCCATCAATATAGATGGGCGCGATTGTTGCCAGACAGGACAATTTTCACAAGACGTCGCTGATGGGGCGCTTAC	NA	NA	NA	NA
WP_000165870.1|953123_953750_+	hydrolase	NA	NA	NA	NA	NA
WP_000534651.1|953785_954577_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|954578_955196_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000886683.1|957888_959181_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067746.1|959271_960615_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	4.3e-81
WP_001295343.1|960625_961237_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077083.1|961391_965420_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|965554_966049_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537402.1|966592_967558_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	3.2e-62
WP_001043574.1|967680_969447_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	4.6e-22
WP_001202220.1|969447_971169_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|971210_971915_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|972199_972418_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934033.1|973161_975438_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	4.3e-166
WP_000520781.1|975468_975789_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|976111_976336_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188161.1|976408_978355_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.6	5.5e-37
WP_000746446.1|978351_979467_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_005067329.1|979617_980574_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599806.1|980570_982229_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|983395_984091_+	aquaporin Z	NA	NA	NA	NA	NA
WP_088895425.1|984531_985759_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 53
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	989691	991410	4538615		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815381.1|989691_991410_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	1.8e-31
>prophage 54
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	994997	995828	4538615		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255158.1|994997_995828_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	3.3e-07
>prophage 55
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1003562	1047513	4538615	tail,capsid,terminase,plate,portal,integrase	Salmonella_phage(75.0%)	49	1004229:1004244	1054870:1054885
WP_001149748.1|1003562_1004690_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
1004229:1004244	attL	CGCCTTACGCAGTTGC	NA	NA	NA	NA
WP_000389260.1|1004730_1005219_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061675.1|1005278_1006124_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|1006120_1007074_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996021.1|1007083_1008217_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	2.5e-29
WP_000126079.1|1008311_1009424_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1009775_1010252_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684352.1|1010339_1011242_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	7.4e-37
WP_000189129.1|1011302_1012025_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201557.1|1012008_1012296_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|1012455_1012713_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|1012742_1013120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024865.1|1013389_1015075_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|1015310_1015529_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011793.1|1015619_1016720_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	7.6e-177
WP_000980400.1|1016716_1017202_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_102597148.1|1020267_1020387_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	4.8e-13
WP_001281009.1|1020401_1020704_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|1020758_1021274_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046120.1|1021283_1022456_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_102597147.1|1022598_1023165_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_151090743.1|1025049_1026129_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.2	5.8e-153
WP_001086836.1|1026125_1026731_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000268285.1|1026723_1027632_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_000177580.1|1027618_1027978_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000993777.1|1027974_1028553_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_006656620.1|1029593_1029956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829123.1|1029961_1030414_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.5	9.4e-57
WP_001039945.1|1030406_1030838_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_151090744.1|1030800_1031094_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	97.1	2.4e-29
WP_000742498.1|1031097_1032156_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_102597144.1|1032172_1033006_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	1.2e-121
WP_151090745.1|1033148_1034927_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_077897245.1|1034913_1035963_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	4.1e-172
WP_000885505.1|1036014_1036686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073464779.1|1037210_1039103_-	NTPase KAP	NA	NA	NA	NA	NA
WP_001217562.1|1039430_1039664_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|1039674_1039863_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_151090746.1|1040016_1042431_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
WP_151090747.1|1042427_1043285_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	97.5	4.6e-161
WP_000752613.1|1043281_1043509_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244209.1|1043508_1043742_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	2.4e-32
WP_000996717.1|1043809_1044151_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|1044268_1044565_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460893.1|1044572_1045082_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188450.1|1045146_1045350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024220196.1|1045495_1046065_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	4.2e-38
WP_000900883.1|1046080_1046272_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290937.1|1046460_1047513_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
1054870:1054885	attR	CGCCTTACGCAGTTGC	NA	NA	NA	NA
>prophage 56
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1053931	1055088	4538615	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_094081555.1|1053931_1055088_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
>prophage 57
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1067437	1069309	4538615		Planktothrix_phage(100.0%)	1	NA	NA
WP_001120569.1|1067437_1069309_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.3	3.6e-17
>prophage 58
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1072627	1080896	4538615		Synechococcus_phage(33.33%)	6	NA	NA
WP_000424888.1|1072627_1073290_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	2.2e-25
WP_000576964.1|1073420_1074320_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209313.1|1074325_1076758_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114270.1|1076903_1077719_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168813.1|1077870_1079136_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961469.1|1079303_1080896_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 59
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1085891	1091116	4538615		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1085891_1086407_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1086459_1086525_-	protein YliM	NA	NA	NA	NA	NA
WP_005048475.1|1086759_1087647_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1087945_1088449_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843867.1|1088852_1089599_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1089737_1090397_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569086.1|1090393_1091116_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	1.2e-34
>prophage 60
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1095642	1197623	4538615	tail,head,capsid,transposase,terminase,tRNA,holin	Enterobacteria_phage(32.73%)	100	NA	NA
WP_014532194.1|1095642_1096989_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000990151.1|1099086_1099764_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	3.4e-18
WP_000135439.1|1099837_1100104_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	4.0e-07
WP_000849301.1|1100368_1100629_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443521.1|1100857_1101943_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386531.1|1102083_1103046_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_005048497.1|1103073_1105224_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.6	3.1e-41
WP_001145124.1|1105343_1105826_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	1.3e-35
WP_001296991.1|1107448_1108120_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|1108122_1109118_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|1109110_1110847_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070107.1|1110839_1111973_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|1111983_1113090_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|1113051_1113462_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113348.1|1113594_1114356_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000045466.1|1115592_1116549_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446914.1|1116584_1117298_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373626.1|1117501_1118206_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852286.1|1118342_1118795_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598624.1|1118796_1119042_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|1119034_1119520_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084630.1|1119522_1120035_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_005048531.1|1120056_1121046_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_005048534.1|1121442_1122351_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042516.1|1122542_1124564_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044878.1|1125142_1125820_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246759.1|1125812_1126568_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118810.1|1126554_1127709_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951226.1|1127705_1128746_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_005048541.1|1128832_1130122_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000767391.1|1130180_1130657_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000801162.1|1131239_1133003_+	invasion plasmid antigen	NA	NA	NA	NA	NA
WP_000551132.1|1133182_1133806_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
WP_001230368.1|1135231_1135831_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	6.1e-104
WP_000515521.1|1135898_1139378_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
WP_000090877.1|1139438_1140041_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_000194740.1|1139977_1140721_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_001152490.1|1140725_1141424_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000447264.1|1141423_1141753_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
WP_000371983.1|1141752_1144794_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
WP_001161004.1|1144765_1145095_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
WP_000478927.1|1145103_1145490_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_000211126.1|1145548_1146289_-	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	96.7	1.5e-128
WP_001079407.1|1146299_1146701_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	94.0	1.1e-69
WP_000677140.1|1146697_1147282_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	87.6	6.0e-88
WP_000348593.1|1147268_1147646_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	57.3	2.5e-31
WP_000201488.1|1147657_1148044_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522647.1|1148095_1149124_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.8	1.8e-116
WP_000256794.1|1149181_1149529_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	8.3e-21
WP_001254019.1|1149565_1151071_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	4.3e-98
WP_000259004.1|1152650_1152854_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	57.4	8.6e-10
WP_005049594.1|1152854_1154765_-|terminase	phage terminase large subunit family protein	terminase	K7P6G6	Enterobacteria_phage	63.9	4.9e-248
WP_094081529.1|1155087_1156244_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_128567432.1|1156295_1156490_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	100.0	2.5e-27
WP_001274722.1|1156706_1157240_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	1.6e-100
WP_005083349.1|1157305_1157935_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	57.6	4.7e-30
WP_000839566.1|1157938_1158154_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	2.2e-32
WP_001204832.1|1158956_1159337_-	antitermination protein	NA	A0A088CD47	Shigella_phage	87.9	8.2e-62
WP_000111769.1|1159329_1159530_-	protein ninH	NA	A0A088CC23	Shigella_phage	74.2	1.1e-20
WP_001064799.1|1159624_1159882_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	93.8	1.1e-33
WP_000211324.1|1159878_1161270_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.7	3.6e-256
WP_000988183.1|1161266_1162145_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	95.6	3.0e-139
WP_000747032.1|1162173_1163342_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_128567431.1|1163424_1163616_+	hypothetical protein	NA	Q76H62	Enterobacteria_phage	98.4	1.3e-28
WP_011069285.1|1163748_1164261_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_001108106.1|1164455_1165220_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	55.4	7.0e-12
WP_000204761.1|1165170_1165854_+|terminase	PBSX family phage terminase large subunit	terminase	K4NXU1	Acinetobacter_phage	73.4	7.0e-96
WP_134796765.1|1165929_1167157_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.5e-176
WP_005098291.1|1167142_1167682_+	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	61.4	6.6e-49
WP_005020049.1|1167669_1167903_+	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	65.8	6.2e-20
WP_000113500.1|1167902_1169369_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.0	9.6e-260
WP_000184977.1|1169259_1170003_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
WP_000873153.1|1170006_1171227_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	85.6	2.5e-192
WP_005060669.1|1171230_1171587_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	87.4	4.7e-51
WP_000627468.1|1171731_1172673_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	85.6	2.3e-153
WP_011069283.1|1172669_1172945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094081558.1|1172956_1174113_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_077696331.1|1175783_1176029_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	63.2	6.1e-18
WP_000833599.1|1176191_1176701_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000955063.1|1177420_1178806_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_005049488.1|1179394_1179955_+	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_000034825.1|1180129_1180339_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939741.1|1180392_1180776_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_005049482.1|1180868_1181657_+	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_000503931.1|1181785_1181989_+	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_000042632.1|1182089_1183055_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_000378035.1|1183263_1184217_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000284045.1|1184475_1185117_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_000850550.1|1185217_1185481_-	YbeD family protein	NA	NA	NA	NA	NA
WP_001092085.1|1185591_1186803_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.2	7.5e-101
WP_001231405.1|1186941_1188030_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_000131719.1|1188040_1189153_-	peptidoglycan glycosyltransferase MrdB	NA	NA	NA	NA	NA
WP_000776197.1|1189155_1191057_-	peptidoglycan DD-transpeptidase MrdA	NA	NA	NA	NA	NA
WP_000776104.1|1191087_1191555_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_001161664.1|1191558_1191876_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_001241888.1|1192135_1192747_-	adenosylcobalamin/alpha-ribazole phosphatase	NA	NA	NA	NA	NA
WP_000838889.1|1192770_1193412_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_000620544.1|1193413_1194445_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001269672.1|1194444_1195026_-	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_001157892.1|1195040_1197623_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	1.4e-184
>prophage 61
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1207369	1208095	4538615		Planktothrix_phage(100.0%)	1	NA	NA
WP_000631382.1|1207369_1208095_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	1.7e-31
>prophage 62
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1213978	1215019	4538615		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1213978_1215019_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 63
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1219187	1220852	4538615		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337052.1|1219187_1220852_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	1.2e-85
>prophage 64
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1225618	1229432	4538615	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023095.1|1225618_1227565_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287126.1|1227767_1229432_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 65
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1233701	1234466	4538615		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|1233701_1234466_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 66
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1251214	1259010	4538615		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000390557.1|1251214_1254601_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	38.3	1.9e-29
WP_025715253.1|1254603_1254984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807562.1|1255038_1255326_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_001053303.1|1255454_1255964_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000207079.1|1255960_1257379_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	30.8	9.8e-60
WP_001032694.1|1257528_1259010_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 67
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1262388	1263180	4538615		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114016.1|1262388_1263180_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 68
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1298725	1302245	4538615		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|1298725_1299445_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951294.1|1299441_1300383_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	2.6e-24
WP_000784351.1|1300496_1300877_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109193.1|1301192_1302245_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 69
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1306608	1314680	4538615	integrase	Tupanvirus(25.0%)	9	1298542:1298554	1315044:1315056
1298542:1298554	attL	ATGGCCATGAATG	NA	NA	NA	NA
WP_001265430.1|1306608_1307625_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.7	6.8e-79
WP_000096899.1|1307885_1309358_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.8	5.5e-13
WP_001147439.1|1309425_1310214_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|1310342_1310492_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101994.1|1310658_1311432_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604036.1|1311431_1312121_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891695.1|1312123_1313182_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_005049371.1|1313182_1314001_-	bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase	NA	NA	NA	NA	NA
WP_072075109.1|1314236_1314680_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	49.3	9.9e-35
1315044:1315056	attR	ATGGCCATGAATG	NA	NA	NA	NA
>prophage 70
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1326019	1328134	4538615		Morganella_phage(50.0%)	2	NA	NA
WP_000276167.1|1326019_1326448_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.9e-19
WP_005052887.1|1326568_1328134_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	7.6e-45
>prophage 71
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1331540	1335105	4538615	transposase	Shigella_phage(100.0%)	2	NA	NA
WP_085949497.1|1331540_1332688_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_000747032.1|1333937_1335105_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
>prophage 72
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1350070	1356853	4538615		Klosneuvirus(50.0%)	2	NA	NA
WP_000140641.1|1350070_1350886_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000077740.1|1353007_1356853_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	9.8e-62
>prophage 73
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1365859	1366369	4538615	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_000042695.1|1365859_1366369_-|transposase	IS3 family transposase	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	4.1e-77
>prophage 74
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1372312	1375456	4538615		Leptospira_phage(100.0%)	1	NA	NA
WP_000573972.1|1372312_1375456_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	3.7e-59
>prophage 75
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1383050	1383734	4538615		Bacillus_phage(100.0%)	1	NA	NA
WP_000770949.1|1383050_1383734_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	6.7e-30
>prophage 76
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1396146	1399265	4538615	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729155.1|1396146_1397013_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1397014_1397227_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143523.1|1397334_1397844_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912360.1|1397879_1399265_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-44
>prophage 77
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1406970	1408752	4538615		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_005083112.1|1406970_1408752_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	7.8e-38
>prophage 78
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1415660	1416347	4538615		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|1415660_1416347_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 79
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1419482	1420160	4538615		Bacillus_virus(100.0%)	1	NA	NA
WP_001157548.1|1419482_1420160_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	5.2e-27
>prophage 80
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1424699	1427760	4538615		uncultured_virus(50.0%)	2	NA	NA
WP_000083887.1|1424699_1427204_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.9	3.8e-115
WP_005066557.1|1427418_1427760_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	3.0e-39
>prophage 81
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1438879	1444456	4538615		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_000678191.1|1438879_1440754_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.8e-117
WP_001195025.1|1440863_1441469_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1441468_1441798_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122039.1|1441850_1443776_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_005052987.1|1443904_1444456_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 82
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1451464	1454614	4538615		Leptospira_phage(100.0%)	1	NA	NA
WP_001132484.1|1451464_1454614_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.0	1.2e-54
>prophage 83
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1464889	1466671	4538615		Bacillus_phage(100.0%)	1	NA	NA
WP_151090758.1|1464889_1466671_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	3.7e-40
>prophage 84
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1471751	1472447	4538615		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|1471751_1472447_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 85
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1475575	1480622	4538615	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1475575_1475848_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_005053030.1|1476056_1478411_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.3	1.0e-223
WP_000130305.1|1478598_1479873_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1479998_1480622_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 86
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1485598	1565715	4538615	tRNA,tail,integrase,transposase	Shigella_phage(26.67%)	66	1544257:1544315	1554729:1554787
WP_001088287.1|1485598_1486273_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_000631708.1|1486269_1486617_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	9.2e-44
WP_001058445.1|1486636_1486771_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_000179819.1|1490085_1490700_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_000019869.1|1490699_1491029_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_000971346.1|1491040_1491931_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_005053053.1|1492114_1492426_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_005060796.1|1492560_1492959_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005060811.1|1493854_1496008_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_000645013.1|1496060_1497791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001138904.1|1497850_1498342_-	nucleotide binding protein YajQ	NA	NA	NA	NA	NA
WP_000705865.1|1498509_1499421_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_001276336.1|1499383_1499974_+	protein deglycase YajL	NA	NA	NA	NA	NA
WP_000668704.1|1500027_1501476_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_001124935.1|1501681_1501924_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000347234.1|1501923_1502823_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_000006825.1|1502847_1504710_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_001199828.1|1504764_1505682_+	1-deoxyxylulose-5-phosphate synthase YajO	NA	NA	NA	NA	NA
WP_000154147.1|1505792_1506311_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_000742108.1|1506288_1507266_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_000801125.1|1507342_1507762_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_001021161.1|1507781_1508252_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150448.1|1508340_1509444_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	9.1e-53
WP_000543539.1|1509447_1509897_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295328.1|1510883_1511768_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1511944_1512292_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046642.1|1512420_1513392_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	8.0e-45
WP_000934822.1|1513402_1515250_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1515277_1515610_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_151090759.1|1515632_1516760_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_001266503.1|1516814_1517885_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000979361.1|1518555_1520373_-	maltodextrin glucosidase	NA	NA	NA	NA	NA
WP_000444173.1|1520528_1521902_-	proline-specific permease ProY	NA	NA	NA	NA	NA
WP_000149647.1|1521977_1523297_-	branched-chain amino acid transporter carrier protein BrnQ	NA	NA	NA	NA	NA
WP_000893611.1|1523703_1524999_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
WP_000113938.1|1525056_1525746_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.5	1.5e-37
WP_001221306.1|1525935_1527138_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	31.5	2.4e-06
WP_000698943.1|1527134_1530278_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_005053102.1|1530403_1531585_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219335.1|1531727_1532636_-	fructokinase	NA	NA	NA	NA	NA
WP_005053105.1|1532760_1533672_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.3	4.6e-103
WP_000194195.1|1533749_1534205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000941942.1|1534691_1534976_-	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001276420.1|1535047_1535725_-	AroM family protein	NA	NA	NA	NA	NA
WP_001142439.1|1535982_1536174_-	protein YaiA	NA	NA	NA	NA	NA
WP_000193385.1|1536223_1536748_-	shikimate kinase AroL	NA	NA	NA	NA	NA
WP_000158164.1|1536930_1537389_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_001295331.1|1537508_1538318_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_005053118.1|1538334_1539450_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
WP_094092420.1|1540793_1541991_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.4e-67
WP_005060548.1|1542118_1542742_+	hypothetical protein	NA	A0A088CQ58	Enterobacteria_phage	76.3	2.9e-72
WP_000551008.1|1542795_1543968_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	99.5	1.1e-210
1544257:1544315	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
WP_000051894.1|1544316_1545480_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.5	4.5e-228
WP_094081493.1|1545665_1546821_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000554647.1|1546874_1547525_+	hypothetical protein	NA	S5FKM2	Shigella_phage	100.0	1.2e-116
WP_001223322.1|1547496_1547931_+|tail	tail fiber assembly protein	tail	S5FXM8	Shigella_phage	100.0	1.9e-78
WP_000282635.1|1548703_1549753_-	acyltransferase family protein	NA	S5FNR8	Shigella_phage	99.4	4.1e-196
WP_000703655.1|1553238_1554168_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	99.7	2.3e-174
WP_000915845.1|1554164_1554527_-	GtrA family protein	NA	U5P0S6	Shigella_phage	99.2	2.3e-58
WP_151090760.1|1555190_1556347_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
1554729:1554787	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
WP_000563002.1|1557702_1558062_+	hypothetical protein	NA	U5P092	Shigella_phage	99.0	1.7e-53
WP_000206732.1|1558061_1558367_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_094081493.1|1559375_1560531_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000893267.1|1561227_1562481_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285281.1|1562492_1563596_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	4.1e-61
WP_000749864.1|1564659_1565715_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	3.5e-118
>prophage 87
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1570458	1571502	4538615		Mycobacterium_phage(100.0%)	1	NA	NA
WP_005053205.1|1570458_1571502_-	RNA ligase RtcB family protein	NA	A0A059VHB8	Mycobacterium_phage	30.0	6.8e-26
>prophage 88
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1576767	1699408	4538615	transposase,terminase,plate,tRNA,protease,portal,coat	Escherichia_phage(20.69%)	104	NA	NA
WP_000006251.1|1576767_1577265_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001225676.1|1578345_1579086_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333379.1|1579056_1579824_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1580029_1580608_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973114.1|1580847_1583292_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532697.1|1583334_1583808_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001139559.1|1583961_1584732_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000343515.1|1585139_1585460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128567422.1|1585477_1585681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005053234.1|1585780_1586770_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.7	6.5e-26
WP_000568701.1|1586766_1589055_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_005053237.1|1589051_1589459_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000011500.1|1589947_1592161_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_000667623.1|1592185_1592572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102097.1|1594354_1595074_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023933.1|1595084_1596512_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370403.1|1596504_1597200_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000003122.1|1597442_1598111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077696319.1|1599019_1599214_+	regulator	NA	NA	NA	NA	NA
WP_045177322.1|1599480_1600407_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000939367.1|1600419_1601187_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
WP_000114607.1|1601183_1602011_+	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000004031.1|1602007_1602859_+	taurine dioxygenase	NA	NA	NA	NA	NA
WP_001295337.1|1602964_1603939_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_094081542.1|1605699_1606927_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_094081495.1|1607704_1608860_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000953938.1|1610581_1611085_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151090761.1|1611085_1612243_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	21.7	1.1e-05
WP_001342332.1|1612594_1613815_+	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_000092054.1|1613827_1614922_+	surface-exposed outer membrane lipoprotein YaiW	NA	NA	NA	NA	NA
WP_000763148.1|1614980_1615289_-	DUF2755 family protein	NA	NA	NA	NA	NA
WP_001599861.1|1615548_1615761_+	DUF2754 domain-containing protein	NA	NA	NA	NA	NA
WP_000413677.1|1615784_1616879_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_023517632.1|1616956_1617160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000792969.1|1617341_1617602_+	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_005053287.1|1617702_1619118_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_005053289.1|1619236_1619557_+	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_005053293.1|1620942_1622673_-	lytic transglycosylase domain-containing protein	NA	A0A088CQ71	Enterobacteria_phage	97.9	6.8e-281
WP_000246949.1|1622673_1624005_-	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	99.8	3.1e-217
WP_000964877.1|1624014_1624707_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.1e-111
WP_000627639.1|1624709_1625165_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	8.8e-87
WP_000785540.1|1625164_1626013_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	98.6	2.1e-102
WP_001122382.1|1626012_1627431_-	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.7	1.2e-272
WP_001054834.1|1627430_1627931_-	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_005053303.1|1627908_1628139_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	69.3	1.2e-23
WP_151090762.1|1628183_1629479_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.1	3.4e-240
WP_000373012.1|1629478_1630390_-	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.0	2.0e-159
WP_000752837.1|1630403_1632569_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.2	0.0e+00
WP_014532150.1|1632569_1633625_-|terminase	terminase	terminase	I1TEI5	Salmonella_phage	99.7	1.2e-211
WP_094081496.1|1633618_1634787_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000343116.1|1634864_1635152_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	1.8e-29
WP_094081497.1|1635208_1636482_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_000183806.1|1637435_1638068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109273791.1|1638068_1638266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276640.1|1638262_1638757_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371478.1|1638772_1640656_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000402248.1|1641224_1642271_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001366128.1|1642610_1643342_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|1643406_1643874_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_005060310.1|1643870_1644593_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052754.1|1644626_1645382_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644679.1|1645453_1646800_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	3.7e-08
WP_000211683.1|1646847_1647618_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1647695_1648496_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_151090763.1|1648736_1649651_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005086990.1|1649700_1651047_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000997046.1|1651085_1651889_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	9.2e-39
WP_001140187.1|1657647_1658223_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593997.1|1658410_1659442_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294596.1|1659434_1660088_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|1660127_1660943_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202325.1|1661060_1661465_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094030.1|1661461_1662169_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|1662278_1663997_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005053355.1|1664049_1664874_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239155.1|1665028_1665739_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635538.1|1665752_1666175_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|1666171_1666717_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|1666882_1667083_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|1667069_1667330_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176576.1|1667378_1668677_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|1668741_1669131_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020991.1|1669187_1671329_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|1671427_1672387_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294740.1|1672399_1675882_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569431.1|1675918_1676515_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.8e-26
WP_151090764.1|1676511_1677660_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|1677659_1678448_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1678451_1678907_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|1679011_1680037_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|1680040_1680526_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|1680647_1683080_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_005053372.1|1683109_1684462_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_000922446.1|1684473_1685331_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000811938.1|1686289_1687486_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000622418.1|1687577_1688135_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000224573.1|1688426_1689152_-	UMP kinase	NA	NA	NA	NA	NA
WP_000818114.1|1689298_1690150_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_000246888.1|1690407_1691133_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_001018194.1|1691500_1692295_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_001094600.1|1692356_1695029_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001186650.1|1695059_1695884_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_000272188.1|1696197_1696584_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_000742443.1|1697983_1699408_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	6.5e-27
>prophage 89
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1703337	1703682	4538615		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1703337_1703682_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 90
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1709593	1710391	4538615		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158930.1|1709593_1710391_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 91
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1715634	1722440	4538615	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_005059933.1|1715634_1718064_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	9.6e-39
WP_001294698.1|1718137_1718668_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396044.1|1718682_1719387_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|1719564_1720020_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937421.1|1720056_1720983_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174644.1|1721021_1722440_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 92
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1725985	1726888	4538615		Sodalis_phage(100.0%)	1	NA	NA
WP_000339937.1|1725985_1726888_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	51.1	2.5e-61
>prophage 93
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1730150	1736618	4538615		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150612.1|1730150_1731077_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	2.0e-21
WP_000651599.1|1731185_1731848_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|1731888_1732425_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_005053495.1|1732630_1735021_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189592.1|1735067_1736618_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 94
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1744363	1745788	4538615		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1744363_1745788_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 95
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1754403	1754955	4538615		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923711.1|1754403_1754955_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 96
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1758962	1760006	4538615		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217323.1|1758962_1760006_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.7	2.0e-102
>prophage 97
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1786755	1788480	4538615		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425636.1|1786755_1788480_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.6	8.3e-37
>prophage 98
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1801179	1801878	4538615		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916288.1|1801179_1801878_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 99
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1808241	1813664	4538615		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035612.1|1808241_1810593_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.6	3.5e-38
WP_001117023.1|1810757_1813664_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 100
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1821408	1822808	4538615		Microcystis_phage(50.0%)	2	NA	NA
WP_000257186.1|1821408_1822251_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|1822328_1822808_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 101
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1830587	1836248	4538615		Vibrio_phage(50.0%)	4	NA	NA
WP_000787092.1|1830587_1832102_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.4	9.3e-08
WP_000347117.1|1832132_1833275_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349932.1|1833403_1834621_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_005053636.1|1834694_1836248_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.6e-34
>prophage 102
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1841719	1842868	4538615		Halovirus(100.0%)	1	NA	NA
WP_005086795.1|1841719_1842868_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 103
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1847273	1850090	4538615	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_151090766.1|1847273_1850090_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	1.6e-77
>prophage 104
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1854129	1863198	4538615		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681363.1|1854129_1855296_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	4.9e-89
WP_000935262.1|1855824_1856034_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118475.1|1856137_1857268_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.3	7.9e-28
WP_000516121.1|1857356_1859273_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	9.0e-149
WP_000843568.1|1859649_1860054_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102351.1|1860079_1860793_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|1860941_1861508_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001295414.1|1861542_1862130_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|1862244_1863198_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 105
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1874964	1877078	4538615		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219565.1|1874964_1876389_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188678.1|1876388_1877078_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	3.0e-30
>prophage 106
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1880360	1885716	4538615		Bacillus_phage(33.33%)	4	NA	NA
WP_000409446.1|1880360_1882298_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|1882508_1884176_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000007444.1|1884282_1884450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093812.1|1884483_1885716_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 107
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1892435	1893758	4538615		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477815.1|1892435_1893758_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	1.7e-77
>prophage 108
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1899485	1902351	4538615		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|1899485_1899647_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295410.1|1899763_1900369_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175932.1|1900761_1902351_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	1.8e-30
>prophage 109
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1910817	1912097	4538615		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|1910817_1911357_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|1911359_1912097_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 110
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1919008	1920673	4538615		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919529.1|1919008_1920673_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.8	1.4e-12
>prophage 111
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1938348	1946127	4538615	transposase	Acinetobacter_phage(66.67%)	5	NA	NA
WP_000819022.1|1938348_1940781_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	24.6	1.0e-08
WP_001387312.1|1940847_1942317_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
WP_000110073.1|1942316_1943978_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000132640.1|1944198_1944540_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_086020934.1|1944971_1946127_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
>prophage 112
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1960924	1977734	4538615	protease,tRNA	Ralstonia_phage(16.67%)	15	NA	NA
WP_000943980.1|1960924_1962088_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.4e-80
WP_000101680.1|1962090_1962729_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_105322386.1|1962738_1963002_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_001293282.1|1963792_1964524_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076311.1|1964703_1967145_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	2.9e-67
WP_001177639.1|1967183_1967609_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_151090770.1|1967813_1969112_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	1.1e-65
WP_001089295.1|1969215_1969413_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_151090771.1|1969494_1970499_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312485.1|1970501_1971761_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460351.1|1971846_1973127_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|1973202_1973511_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280367.1|1973596_1974547_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122490.1|1974539_1976387_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990309.1|1976396_1977734_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	5.2e-18
>prophage 113
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1981770	1982316	4538615		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_005053889.1|1981770_1982316_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 114
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1990465	1991443	4538615		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|1990465_1991443_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 115
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	1996363	1996897	4538615		Morganella_phage(100.0%)	1	NA	NA
WP_001238362.1|1996363_1996897_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.1e-47
>prophage 116
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2002181	2004165	4538615		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2002181_2003828_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2003871_2004165_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 117
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2039088	2093453	4538615	protease,tRNA,integrase,transposase	Klosneuvirus(11.76%)	41	2067514:2067573	2085053:2085821
WP_000055068.1|2039088_2039619_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	1.0e-54
WP_000205829.1|2041024_2042527_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_005054006.1|2042540_2043563_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005083739.1|2044631_2045978_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000853753.1|2046015_2047014_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219814.1|2047189_2048563_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166281.1|2048645_2049197_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162182.1|2049290_2050643_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001106222.1|2051252_2051717_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_000187770.1|2051874_2054013_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.3	7.7e-266
WP_001344094.1|2054406_2056062_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|2056111_2057533_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181311.1|2057651_2058599_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|2058783_2058837_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_151090772.1|2058977_2061674_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	1.2e-45
WP_000047539.1|2061879_2062266_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148585.1|2062338_2062800_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|2062812_2063748_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_011069607.1|2063751_2063886_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230280.1|2064166_2064562_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500714.1|2064693_2065407_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256684.1|2065477_2066071_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583469.1|2066215_2066668_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000516533.1|2066790_2067519_+	hypothetical protein	NA	NA	NA	NA	NA
2067514:2067573	attL	GGGTAATGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGT	NA	NA	NA	NA
WP_000012908.1|2068298_2069312_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|2069473_2069890_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059407.1|2069935_2070439_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079652.1|2070631_2071828_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416415.1|2071881_2074737_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_005054057.1|2074736_2075180_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397161.1|2075313_2076825_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.4	8.6e-46
WP_000584114.1|2077091_2078192_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_005054063.1|2078191_2079274_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_005054065.1|2079392_2080895_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.1e-82
WP_001299662.1|2081023_2082043_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_001218324.1|2082521_2083733_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.3	2.0e-77
WP_000747032.1|2083707_2084876_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_071843962.1|2086036_2086273_+	DUF2686 family protein	NA	NA	NA	NA	NA
2085053:2085821	attR	GGGTAATGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGTGACTTCCGTACCAGCCTTGCCAGATGTTGTCTCAGATTCAGATTATGTCGCTCAATGCGCTGAGTGTAACGCTTGCTGATAACGTGCAGCTTTCCCTTCAGGCGTGATTCATACAGCGGCCAGCCATCCGTCATCCATACCACGACCTCAAAGGCCGACAGCAGGCTCAGAAGACGCTCCAGTGTGGCCAGAGTGCGTTCACCGAAGACGTGCGCCACAACCGTCCTCCGTATCCTGTCATACGCGTAAAACAGCCAGCGCTGACGTGATTTAGCACCGACGTAGCCCCAATGTTCGTCCATTTCAGCGCAGACAATCACATCACTGCCCGGTTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAGTGACGTAAAACCGTGTTGAGGCCAACGCCCATAATGCGTGCACTGGCGCGACATCCGACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGCTGAGAGGCGGTGTAAGTGAACTGTAGTTGCCATGTTTTACGGCAATGAGAGCAGAGATAGCGCTGATGTCCGGCAGTGCTTTTGCCGTTACGCACCACGCCTTCAGTAGCGGAGCAGGAAGGACATCTGATGGAAATGGAAGCCACGCAAGCACCTTAAAATCACCATCATACACTAAATCAGTAAGTTGGCAGCATTACC	NA	NA	NA	NA
WP_094081518.1|2087199_2088356_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_001352368.1|2091333_2092542_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_151090773.1|2092520_2093453_-	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	55.8	2.4e-94
>prophage 118
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2097893	2098490	4538615		Escherichia_phage(100.0%)	1	NA	NA
WP_000044711.1|2097893_2098490_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 119
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2109541	2111002	4538615		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208167.1|2109541_2111002_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	2.1e-49
>prophage 120
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2118245	2123138	4538615	transposase	Stx2-converting_phage(60.0%)	5	NA	NA
WP_011069602.1|2118245_2118932_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	1.1e-37
WP_167389526.1|2119130_2120359_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	6.5e-177
WP_001088287.1|2120518_2121193_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_005048975.1|2121189_2121540_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_005048978.1|2121536_2123138_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.5e-146
>prophage 121
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2138166	2139282	4538615		Mycoplasma_phage(100.0%)	1	NA	NA
WP_005050616.1|2138166_2139282_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	32.2	1.1e-18
>prophage 122
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2148406	2149015	4538615		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2148406_2149015_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 123
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2155605	2158153	4538615		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|2155605_2157021_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|2157073_2158153_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 124
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2162342	2165955	4538615		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|2162342_2165165_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|2165418_2165955_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 125
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2172128	2173541	4538615		Escherichia_phage(100.0%)	1	NA	NA
WP_000063456.1|2172128_2173541_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.8	6.0e-17
>prophage 126
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2190632	2191982	4538615		Moraxella_phage(100.0%)	1	NA	NA
WP_000106875.1|2190632_2191982_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	4.0e-159
>prophage 127
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2197931	2198720	4538615		Planktothrix_phage(100.0%)	1	NA	NA
WP_001193423.1|2197931_2198720_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.4e-26
>prophage 128
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2203558	2205061	4538615		Burkholderia_virus(100.0%)	1	NA	NA
WP_000919720.1|2203558_2205061_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 129
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2225134	2226362	4538615	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_171768098.1|2225134_2226362_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.1e-176
>prophage 130
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2236597	2240281	4538615		Dickeya_phage(100.0%)	1	NA	NA
WP_000096021.1|2236597_2240281_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 131
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2256168	2257758	4538615		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|2256168_2257758_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 132
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2263126	2264890	4538615		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2263126_2263399_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940102.1|2263585_2264176_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362374.1|2264218_2264890_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.2	2.8e-20
>prophage 133
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2273334	2281663	4538615		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2273334_2277558_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2277634_2281663_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 134
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2285779	2288832	4538615		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2285779_2286964_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023083.1|2287881_2288832_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
>prophage 135
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2297165	2299010	4538615		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591336.1|2297165_2299010_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.6	1.6e-09
>prophage 136
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2306528	2307743	4538615		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690938.1|2306528_2307743_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.5	5.9e-45
>prophage 137
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2321300	2327873	4538615		Serratia_phage(50.0%)	5	NA	NA
WP_000184806.1|2321300_2323598_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	6.0e-06
WP_000161265.1|2323648_2323969_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004442.1|2323983_2325063_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001185158.1|2325371_2326475_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_167547304.1|2326475_2327873_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	2.2e-11
>prophage 138
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2345834	2350338	4538615		Erwinia_phage(50.0%)	5	NA	NA
WP_001293341.1|2345834_2347166_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_005050436.1|2347232_2348159_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2348251_2348737_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2348821_2349067_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084265.1|2349492_2350338_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	2.6e-15
>prophage 139
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2362004	2368201	4538615	transposase	Feldmannia_irregularis_virus(25.0%)	6	NA	NA
WP_001033722.1|2362004_2362703_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580436.1|2362699_2364073_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270270.1|2364178_2364853_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_134797556.1|2365079_2366307_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_001166063.1|2366337_2367321_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2367580_2368201_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 140
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2381415	2384466	4538615		Escherichia_phage(100.0%)	1	NA	NA
WP_005106021.1|2381415_2384466_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.4e-07
>prophage 141
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2394548	2397328	4538615		Escherichia_phage(50.0%)	3	NA	NA
WP_000059682.1|2394548_2395334_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	1.8e-23
WP_000621632.1|2395367_2396264_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718893.1|2396431_2397328_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 142
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2404907	2406116	4538615	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|2404907_2406116_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 143
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2414957	2417428	4538615		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|2414957_2416007_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_005052855.1|2416018_2417428_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 144
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2421544	2424331	4538615		uncultured_virus(100.0%)	1	NA	NA
WP_000250035.1|2421544_2424331_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.2	3.4e-72
>prophage 145
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2438018	2438633	4538615		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2438018_2438633_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 146
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2447423	2450710	4538615		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_151090782.1|2447423_2448200_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.5	4.6e-27
WP_000459594.1|2448202_2448718_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|2448721_2448991_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|2449069_2450710_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 147
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2463240	2465070	4538615		Catovirus(100.0%)	1	NA	NA
WP_005052866.1|2463240_2465070_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 148
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2472224	2476083	4538615		Bacillus_phage(100.0%)	3	NA	NA
WP_000383393.1|2472224_2474387_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	3.5e-117
WP_001213584.1|2474470_2475187_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130686.1|2475186_2476083_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
>prophage 149
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2479210	2479516	4538615		Salmonella_phage(100.0%)	1	NA	NA
WP_000463014.1|2479210_2479516_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.4	1.1e-27
>prophage 150
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2489888	2491161	4538615	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_094081511.1|2489888_2491161_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.4e-176
>prophage 151
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2499247	2505391	4538615		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612053.1|2499247_2500378_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145202.1|2500382_2501057_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2501034_2501916_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226608.1|2501934_2503002_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
WP_000006621.1|2503001_2504264_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_005051947.1|2504260_2505391_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.4	3.3e-26
>prophage 152
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2509433	2514845	4538615		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2509433_2509763_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|2509893_2511159_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_000535982.1|2511292_2512777_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_005051954.1|2512823_2514845_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
>prophage 153
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2522441	2524088	4538615		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012613.1|2522441_2524088_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	9.7e-67
>prophage 154
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2541248	2544067	4538615		Bacillus_virus(50.0%)	3	NA	NA
WP_000387787.1|2541248_2541605_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.2	5.0e-05
WP_000715936.1|2541612_2542032_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102309.1|2542198_2544067_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.4	3.9e-64
>prophage 155
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2548672	2549665	4538615		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_073828139.1|2548672_2549665_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	3.4e-51
>prophage 156
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2561617	2564979	4538615		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933743.1|2561617_2562988_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334086.1|2563149_2564979_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
>prophage 157
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2568057	2576447	4538615	transposase	Shigella_phage(33.33%)	7	NA	NA
WP_094081542.1|2568057_2569286_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_000665246.1|2570464_2571421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094081493.1|2571461_2572618_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000805504.1|2572872_2573166_+	transporter	NA	NA	NA	NA	NA
WP_001288549.1|2573206_2574397_-	purine ribonucleoside efflux pump NepI	NA	NA	NA	NA	NA
WP_005051995.1|2574607_2575060_-	DUF1198 domain-containing protein	NA	NA	NA	NA	NA
WP_001362489.1|2575112_2576447_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	36.9	8.6e-66
>prophage 158
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2583752	2587763	4538615		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000168493.1|2583752_2585441_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.5	3.0e-55
WP_001312198.1|2585546_2585645_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|2586209_2586299_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|2586578_2587763_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
>prophage 159
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2591009	2592725	4538615		Aeromonas_phage(100.0%)	1	NA	NA
WP_001087134.1|2591009_2592725_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.4	1.9e-41
>prophage 160
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2599075	2600029	4538615		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|2599075_2599504_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2599615_2600029_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 161
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2610363	2617732	4538615		Bacillus_virus(25.0%)	8	NA	NA
WP_000072067.1|2610363_2612778_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060115.1|2612806_2613880_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673462.1|2613879_2614980_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	6.9e-53
WP_000059107.1|2614984_2616388_-	chromosomal replication initiator protein DnaA	NA	A0A0K2CYY7	Paenibacillus_phage	28.9	5.2e-05
WP_120795392.1|2616684_2616765_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|2616994_2617135_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2617151_2617511_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2617474_2617732_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 162
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2629447	2633289	4538615		Planktothrix_phage(50.0%)	4	NA	NA
WP_000063125.1|2629447_2630221_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.6	1.3e-18
WP_001251991.1|2630312_2631203_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2631202_2632162_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2632248_2633289_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 163
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2638065	2639293	4538615	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_134797556.1|2638065_2639293_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
>prophage 164
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2653957	2655185	4538615	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_134797556.1|2653957_2655185_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
>prophage 165
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2661760	2662972	4538615	integrase	Enterobacteria_phage(100.0%)	1	2645831:2645845	2668729:2668743
2645831:2645845	attL	TTGCAGACGATCGGC	NA	NA	NA	NA
WP_001088899.1|2661760_2662972_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.3	4.2e-160
WP_001088899.1|2661760_2662972_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.3	4.2e-160
2668729:2668743	attR	TTGCAGACGATCGGC	NA	NA	NA	NA
>prophage 166
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2669223	2670615	4538615		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2669223_2670615_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 167
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2674916	2681666	4538615		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|2674916_2677025_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135056.1|2677043_2677319_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|2677373_2677997_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_005093444.1|2678254_2679937_+	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.4	2.2e-21
WP_000924289.1|2679933_2680551_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_005052162.1|2680841_2681666_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.6	1.2e-94
>prophage 168
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2685039	2689602	4538615		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976081.1|2685039_2685498_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	58.8	1.1e-47
WP_000050139.1|2685475_2686696_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001297375.1|2686867_2687536_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|2687752_2687989_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|2688009_2688177_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|2688274_2689084_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|2689122_2689602_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 169
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2702309	2712913	4538615		Synechococcus_phage(20.0%)	9	NA	NA
WP_000587750.1|2702309_2703242_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_000842816.1|2703544_2704402_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|2704676_2705873_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|2705882_2706908_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000483856.1|2708043_2709003_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_005090310.1|2709006_2710290_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_005065328.1|2710299_2711844_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_005052206.1|2712088_2712520_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024391.1|2712661_2712913_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	4.5e-16
>prophage 170
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2735540	2737385	4538615		Tupanvirus(100.0%)	1	NA	NA
WP_151090785.1|2735540_2737385_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 171
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2754293	2755835	4538615		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146516.1|2754293_2755835_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 172
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2761152	2762148	4538615		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|2761152_2762148_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 173
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2776588	2778584	4538615	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
WP_094081563.1|2776588_2777930_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.2e-112
WP_001135734.1|2778032_2778185_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|2778371_2778584_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 174
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2782239	2784573	4538615		Escherichia_phage(100.0%)	1	NA	NA
WP_000013943.1|2782239_2784573_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	1.4e-71
>prophage 175
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2794618	2796603	4538615		Planktothrix_phage(100.0%)	2	NA	NA
WP_001196486.1|2794618_2795602_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107041.1|2795598_2796603_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G9BWD6	Planktothrix_phage	33.2	7.0e-20
>prophage 176
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2839979	2842111	4538615		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_024259314.1|2839979_2840330_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	5.6e-25
WP_000922639.1|2840383_2841673_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|2841685_2842111_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 177
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2846345	2848388	4538615		Indivirus(100.0%)	1	NA	NA
WP_005065284.1|2846345_2848388_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	3.1e-46
>prophage 178
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2861314	2862543	4538615	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_134796765.1|2861314_2862543_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.5e-176
>prophage 179
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2873172	2879055	4538615		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000149170.1|2873172_2875908_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001216257.1|2875907_2877032_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001259384.1|2877090_2877366_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	3.2e-15
WP_000593555.1|2877362_2877722_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|2877841_2878243_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173660.1|2878248_2879055_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.7	2.9e-16
>prophage 180
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2886950	2891082	4538615		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|2886950_2887616_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|2887836_2888082_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106529.1|2888183_2890382_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_000964718.1|2890455_2891082_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 181
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2894088	2896907	4538615		Planktothrix_phage(50.0%)	3	NA	NA
WP_000617723.1|2894088_2894757_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.0	6.1e-28
WP_001042003.1|2894749_2895808_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130216.1|2896052_2896907_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	1.6e-44
>prophage 182
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2902638	2904121	4538615		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|2902638_2903406_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|2903407_2904121_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 183
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2908649	2909393	4538615		Enterococcus_phage(100.0%)	1	NA	NA
WP_000073595.1|2908649_2909393_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	4.9e-10
>prophage 184
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2926801	2929249	4538615		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|2926801_2929249_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 185
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2936733	2937960	4538615		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105459.1|2936733_2937960_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.5	1.4e-131
>prophage 186
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2942339	2944733	4538615		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081930.1|2942339_2944733_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	3.3e-15
>prophage 187
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2951416	2953608	4538615	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_094081542.1|2951416_2952645_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_000039077.1|2952720_2953608_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 188
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2960171	2963938	4538615		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|2960171_2960891_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|2960887_2962240_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265668.1|2962315_2963938_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 189
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	2980948	2981785	4538615		Vibrio_phage(100.0%)	1	NA	NA
WP_000742151.1|2980948_2981785_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.2e-67
>prophage 190
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3006030	3015571	4538615		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601855.1|3006030_3006594_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.7	7.1e-62
WP_000963807.1|3006679_3007900_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005052777.1|3007966_3010057_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|3010107_3010740_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3011041_3011446_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|3011500_3012370_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3012423_3012642_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057406.1|3012635_3013658_-	hydrolase	NA	NA	NA	NA	NA
WP_000634826.1|3013657_3015571_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.3	2.8e-73
>prophage 191
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3021073	3026647	4538615		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209706.1|3021073_3021460_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	7.4e-18
WP_000820723.1|3021459_3021819_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903372.1|3021826_3022114_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3022239_3022614_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3022710_3023181_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124706.1|3023277_3025392_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	3.1e-57
WP_000031783.1|3025462_3026647_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 192
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3042530	3049535	4538615	tRNA,transposase	Stx2-converting_phage(60.0%)	7	NA	NA
WP_005048978.1|3042530_3044132_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.5e-146
WP_005048975.1|3044128_3044479_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_001088287.1|3044475_3045150_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_000691382.1|3045330_3046707_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_005050632.1|3046728_3048018_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_000004428.1|3048063_3049011_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.7	1.9e-06
WP_000114986.1|3049025_3049535_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 193
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3059903	3060662	4538615		Planktothrix_phage(100.0%)	1	NA	NA
WP_151090792.1|3059903_3060662_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.7	9.7e-30
>prophage 194
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3063796	3066917	4538615		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_000738594.1|3063796_3064822_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.2	9.9e-70
WP_024259309.1|3065748_3065949_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001258883.1|3066032_3066917_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	2.4e-24
>prophage 195
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3077482	3078526	4538615		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3077482_3078526_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 196
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3095021	3096089	4538615		uncultured_archaeal_virus(100.0%)	1	NA	NA
WP_000497724.1|3095021_3096089_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 197
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3101492	3101990	4538615	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3101492_3101990_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 198
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3106471	3107962	4538615		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|3106471_3107962_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 199
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3118889	3133669	4538615		Staphylococcus_phage(28.57%)	15	NA	NA
WP_005050728.1|3118889_3119819_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|3119914_3122251_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001300411.1|3122480_3123134_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000620405.1|3123854_3124487_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3124699_3124972_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3124968_3125823_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|3125868_3126360_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3126477_3126765_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809059.1|3126787_3128221_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3128268_3128994_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3129000_3129558_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3129526_3130102_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|3130098_3130665_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000922884.1|3131684_3132650_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438248.1|3132859_3133669_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 200
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3137737	3139214	4538615		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3137737_3138016_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|3138242_3139214_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 201
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3145987	3148860	4538615	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3145987_3147922_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3148011_3148860_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 202
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3152943	3159558	4538615		Dickeya_phage(50.0%)	4	NA	NA
WP_000207682.1|3152943_3154287_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3154917_3155370_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|3155397_3156885_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133055.1|3156909_3159558_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 203
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3165039	3166929	4538615		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3165039_3166929_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 204
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3172631	3180425	4538615		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|3172631_3172934_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449030.1|3172984_3173428_+	YhbP family protein	NA	NA	NA	NA	NA
WP_005050810.1|3173407_3173926_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	26.4	1.7e-09
WP_001343556.1|3174053_3174689_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147624.1|3174761_3175802_+	permease	NA	NA	NA	NA	NA
WP_000646043.1|3175915_3176491_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|3176500_3177091_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246827.1|3177110_3177506_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249126.1|3177463_3179500_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809275.1|3179564_3180425_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	3.6e-49
>prophage 205
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3203217	3204363	4538615		Streptococcus_phage(100.0%)	1	NA	NA
WP_005050911.1|3203217_3204363_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 206
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3213333	3215628	4538615		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861753.1|3213333_3215628_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	5.7e-158
>prophage 207
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3239937	3240903	4538615		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|3239937_3240903_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 208
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3253559	3259782	4538615		Herpes_simplex_virus(50.0%)	3	NA	NA
WP_001082921.1|3253559_3256646_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	1.4e-154
WP_000212445.1|3256828_3257812_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_005051020.1|3258402_3259782_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	7.6e-33
>prophage 209
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3265794	3271153	4538615	tRNA	Vibrio_phage(33.33%)	4	NA	NA
WP_000437371.1|3265794_3267636_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|3267830_3269576_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|3269686_3269902_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|3270139_3271153_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 210
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3277467	3278706	4538615	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708530.1|3277467_3278706_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	6.5e-92
>prophage 211
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3283843	3285277	4538615		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869173.1|3283843_3285277_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	2.3e-40
>prophage 212
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3290025	3303069	4538615	transposase	Shigella_phage(16.67%)	13	NA	NA
WP_166739279.1|3290025_3291200_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.9	2.5e-165
WP_001076997.1|3292118_3292772_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_005051906.1|3293260_3294034_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_005051905.1|3294176_3294965_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442868.1|3295002_3296163_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	1.0e-86
WP_000831543.1|3296168_3296840_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735285.1|3296987_3298469_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3298673_3299303_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3299303_3299726_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_171768099.1|3299750_3300188_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_171768100.1|3300180_3300567_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3300566_3301148_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195299.1|3301176_3303069_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 213
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3306821	3317645	4538615		Stx_converting_phage(25.0%)	9	NA	NA
WP_005051900.1|3306821_3307214_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	47.2	4.7e-20
WP_000183483.1|3307266_3307749_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_001281881.1|3308294_3310553_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|3310786_3311524_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|3311598_3313011_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_151090801.1|3313121_3315341_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.0	1.7e-103
WP_000848528.1|3315383_3315641_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691640.1|3315691_3316618_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013151.1|3316817_3317645_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	3.2e-63
>prophage 214
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3323721	3324606	4538615		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018747.1|3323721_3324606_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.8	2.2e-65
>prophage 215
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3365889	3416238	4538615	protease,integrase,transposase	Acinetobacter_phage(30.0%)	30	3368349:3368365	3416442:3416458
WP_094081514.1|3365889_3367052_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	6.8e-51
WP_000875412.1|3367454_3367700_-	hypothetical protein	NA	NA	NA	NA	NA
3368349:3368365	attL	CCGGACTCGGAATCGAA	NA	NA	NA	NA
WP_001290187.1|3368475_3369318_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772029.1|3369402_3369600_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761715.1|3369619_3370108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094430.1|3370104_3370482_-	toxin	NA	NA	NA	NA	NA
WP_001285620.1|3370528_3370906_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692350.1|3370985_3371207_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000855059.1|3371784_3372258_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001177758.1|3372599_3373418_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_005051844.1|3373828_3374284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005093816.1|3374359_3376876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000820367.1|3376996_3380119_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_097342240.1|3380452_3381046_-	GTPase family protein	NA	NA	NA	NA	NA
WP_094081518.1|3381124_3382280_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_005051842.1|3382888_3383908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094081550.1|3384224_3385381_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000261147.1|3386457_3386742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005093820.1|3386743_3387316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095918.1|3387401_3387608_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_011069510.1|3387993_3388785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134796765.1|3389466_3390695_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.5e-176
WP_001195464.1|3391411_3392011_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000271035.1|3392383_3392767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013320.1|3392763_3393189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|3394883_3396392_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000291751.1|3404051_3404633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034110.1|3404679_3408537_-|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_000344102.1|3411007_3414523_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001218804.1|3414975_3416238_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
3416442:3416458	attR	CCGGACTCGGAATCGAA	NA	NA	NA	NA
>prophage 216
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3442810	3443965	4538615		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3442810_3443965_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 217
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3452314	3453223	4538615		Yersinia_phage(100.0%)	1	NA	NA
WP_000646937.1|3452314_3453223_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	1.2e-53
>prophage 218
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3457828	3458506	4538615		Bacillus_virus(100.0%)	1	NA	NA
WP_000956870.1|3457828_3458506_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	3.8e-09
>prophage 219
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3476343	3477576	4538615		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3476343_3477576_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 220
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3486103	3491477	4538615		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195082.1|3486103_3488977_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	1.1e-262
WP_000951957.1|3489243_3489987_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005051722.1|3490043_3491477_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.4	2.6e-31
>prophage 221
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3495400	3505799	4538615	transposase,tRNA	Brevibacillus_phage(16.67%)	10	NA	NA
WP_000806987.1|3495400_3496297_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715213.1|3496321_3497032_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813187.1|3497037_3498771_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	8.3e-61
WP_001701073.1|3498861_3499959_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|3499969_3501487_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192802.1|3501529_3502078_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_128567310.1|3502132_3502204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010156.1|3502200_3502326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005105789.1|3502327_3503776_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.3	3.1e-24
WP_167389526.1|3504571_3505799_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	6.5e-177
>prophage 222
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3510498	3515467	4538615	integrase	Clostridium_phage(33.33%)	3	3511390:3511406	3517753:3517769
WP_005051685.1|3510498_3511254_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
3511390:3511406	attL	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_000920423.1|3511540_3513151_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.4	2.3e-12
WP_000082598.1|3514720_3515467_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	38.9	4.7e-13
3517753:3517769	attR	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
>prophage 223
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3518567	3519730	4538615	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_094081514.1|3518567_3519730_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	6.8e-51
>prophage 224
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3524169	3526664	4538615		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603535.1|3524169_3524931_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	5.9e-19
WP_000256435.1|3525245_3526664_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.3e-24
>prophage 225
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3536295	3543068	4538615		Moraxella_phage(33.33%)	6	NA	NA
WP_000895627.1|3536295_3537009_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.0e-45
WP_000082199.1|3537077_3537767_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|3538451_3538982_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957903.1|3538994_3541241_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|3541391_3542267_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816233.1|3542273_3543068_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.5	9.9e-118
>prophage 226
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3548571	3564009	4538615	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_001138152.1|3548571_3551460_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	26.0	2.4e-68
WP_001285974.1|3551452_3554995_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.2e-08
WP_000775983.1|3554994_3556821_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.5	2.3e-24
WP_000237959.1|3556882_3558214_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_005051625.1|3558445_3559699_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_111779692.1|3560168_3561266_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117724.1|3561503_3562310_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	1.7e-16
WP_000184250.1|3562360_3562804_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_005051618.1|3562803_3564009_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	6.6e-73
>prophage 227
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3575534	3576290	4538615		Bacillus_phage(100.0%)	1	NA	NA
WP_005051589.1|3575534_3576290_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 228
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3582584	3583433	4538615		Vibrio_phage(100.0%)	1	NA	NA
WP_000100422.1|3582584_3583433_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	4.7e-41
>prophage 229
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3590966	3595081	4538615		Hokovirus(50.0%)	2	NA	NA
WP_000186422.1|3590966_3593723_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	2.2e-55
WP_000046798.1|3593779_3595081_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
>prophage 230
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3598477	3604134	4538615		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_000210878.1|3598477_3600115_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|3600202_3601501_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001288227.1|3603183_3603324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199973.1|3603462_3604134_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 231
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3620208	3622241	4538615		Hokovirus(50.0%)	2	NA	NA
WP_001098971.1|3620208_3621636_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173678.1|3621635_3622241_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	1.9e-28
>prophage 232
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3625353	3646002	4538615	transposase	Pseudomonas_phage(27.27%)	15	NA	NA
WP_011069490.1|3625353_3626115_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	3.2e-57
WP_001272592.1|3626872_3628012_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081553.1|3628074_3629067_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001208075.1|3629186_3629594_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000767718.1|3629740_3630334_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_001224024.1|3631553_3632117_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	55.8	1.1e-35
WP_001249841.1|3632281_3632533_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	53.0	1.1e-17
WP_001192434.1|3632534_3634631_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	48.7	1.2e-173
WP_151090807.1|3634863_3636020_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.0	4.4e-66
WP_167389528.1|3636081_3637193_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.9	1.2e-65
WP_005051483.1|3638578_3639346_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.8e-69
WP_001272883.1|3640153_3642715_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_000611930.1|3642790_3642985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015498.1|3643779_3644133_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_000747032.1|3644833_3646002_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
>prophage 233
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3657250	3658261	4538615		Enterobacteria_phage(100.0%)	1	NA	NA
WP_005051459.1|3657250_3658261_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.0	2.3e-26
>prophage 234
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3665736	3666702	4538615		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287442.1|3665736_3666702_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 235
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3672166	3677726	4538615	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|3672166_3672664_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|3672743_3673805_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|3674047_3674548_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047164.1|3674675_3677306_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|3677540_3677726_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 236
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3690272	3695568	4538615		Bacillus_virus(20.0%)	5	NA	NA
WP_000985596.1|3690272_3691475_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777973.1|3691829_3692789_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	7.7e-133
WP_000246518.1|3692798_3694943_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.3	3.2e-195
WP_000080947.1|3694915_3695326_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_088376893.1|3695322_3695568_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 237
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3699268	3701289	4538615	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_094081542.1|3699268_3700496_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_000508176.1|3700597_3700756_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|3700839_3701289_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 238
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3712065	3716749	4538615	integrase,transposase	Acinetobacter_phage(33.33%)	3	3701383:3701396	3717059:3717072
3701383:3701396	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_094081520.1|3712065_3713228_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.2e-50
WP_000113817.1|3714243_3715485_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.3	9.4e-99
WP_000162574.1|3716266_3716749_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3717059:3717072	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 239
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3730382	3731453	4538615		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_000548559.1|3730382_3731453_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	2.6e-89
>prophage 240
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3736074	3738648	4538615		Enterobacteria_phage(100.0%)	1	NA	NA
WP_005051270.1|3736074_3738648_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.0e-127
>prophage 241
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3748588	3749887	4538615		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|3748588_3749887_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 242
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3755180	3761265	4538615	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|3755180_3755600_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997396.1|3755806_3756844_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262715.1|3756891_3757581_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	5.5e-56
WP_000627802.1|3757885_3758269_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000187873.1|3758324_3758912_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_005051239.1|3759014_3759896_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|3759930_3761265_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 243
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3767036	3770778	4538615		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|3767036_3768836_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|3768851_3769826_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|3770097_3770778_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 244
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3773988	3774249	4538615		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000054752.1|3773988_3774249_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
>prophage 245
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3778299	3784027	4538615	tail,transposase	Enterobacteria_phage(33.33%)	6	NA	NA
WP_001181756.1|3778299_3778905_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.8	1.2e-30
WP_167389526.1|3779802_3781031_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	6.5e-177
WP_011069472.1|3781094_3781613_+	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	53.0	3.5e-39
WP_000902877.1|3781615_3782161_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.1	2.5e-72
WP_061440257.1|3782184_3783474_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	42.6	6.4e-74
WP_000551130.1|3783403_3784027_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	77.0	1.1e-79
>prophage 246
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3791483	3802772	4538615		Bacillus_phage(50.0%)	7	NA	NA
WP_000970142.1|3791483_3795371_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.6	2.2e-130
WP_005047325.1|3795928_3797356_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_001215861.1|3797520_3798234_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_005047323.1|3798223_3799558_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|3799618_3799957_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883129.1|3800001_3801192_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|3801518_3802772_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 247
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3808663	3810175	4538615		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493489.1|3808663_3810175_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	8.7e-14
>prophage 248
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3821790	3831659	4538615	tRNA	Indivirus(16.67%)	12	NA	NA
WP_005047302.1|3821790_3822645_-	alpha/beta hydrolase	NA	A0A1V0SD13	Indivirus	28.6	2.0e-15
WP_000553449.1|3822789_3823593_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000940019.1|3823711_3824452_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_001241357.1|3824721_3825210_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_001295373.1|3825321_3826536_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|3826563_3826950_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|3826966_3827290_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384405.1|3827385_3827901_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196601.1|3827917_3829768_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	7.2e-103
WP_001124469.1|3829769_3830105_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|3830116_3830317_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133598.1|3830375_3831659_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	1.7e-34
>prophage 249
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3837568	3838000	4538615		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|3837568_3838000_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 250
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3846831	3855831	4538615	transposase	Escherichia_phage(57.14%)	8	NA	NA
WP_000937883.1|3846831_3848202_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	4.4e-41
WP_001299507.1|3848362_3849829_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138258.1|3849897_3851475_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755178.1|3851569_3852109_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000975306.1|3852124_3852643_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000076001.1|3852953_3853145_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|3853162_3853315_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_094081509.1|3854674_3855831_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
>prophage 251
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3860828	3864829	4538615		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|3860828_3861467_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|3861466_3862504_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|3862827_3863454_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005130140.1|3863539_3864829_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.7	6.6e-63
>prophage 252
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3886152	3886866	4538615		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3886152_3886866_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 253
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3910722	3911416	4538615	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085950185.1|3910722_3911416_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	96.1	3.7e-129
>prophage 254
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3922671	3926247	4538615		Deep-sea_thermophilic_phage(50.0%)	5	NA	NA
WP_000102891.1|3922671_3923541_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|3923754_3924180_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001399260.1|3924166_3924616_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838955.1|3924676_3925252_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_005047153.1|3925347_3926247_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.2	1.0e-25
>prophage 255
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3929901	3930693	4538615		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517441.1|3929901_3930693_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.2e-17
>prophage 256
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3933710	3946367	4538615		Streptococcus_phage(40.0%)	11	NA	NA
WP_000021053.1|3933710_3934808_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_005063508.1|3934941_3935853_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	1.3e-57
WP_000719924.1|3936812_3937187_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|3937291_3938143_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|3938184_3938694_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|3938734_3940462_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|3940506_3940764_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034406.1|3941147_3942119_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.2e-74
WP_000254830.1|3942303_3943065_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_005047119.1|3943294_3944281_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443652.1|3944351_3946367_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.3	1.9e-149
>prophage 257
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3967865	3968600	4538615		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3967865_3968600_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 258
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3972206	3973127	4538615		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|3972206_3973127_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 259
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3976810	3978505	4538615		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001283471.1|3976810_3978505_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	8.0e-24
>prophage 260
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	3991025	3995034	4538615	integrase,transposase	Bacillus_phage(33.33%)	3	3988558:3988574	3998250:3998266
3988558:3988574	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194508.1|3991025_3992459_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	5.9e-28
WP_151090813.1|3993360_3994528_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_167389530.1|3994503_3995034_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	G5DA82	Enterobacteria_phage	97.1	6.9e-91
3998250:3998266	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 261
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4014904	4015990	4538615		Pandoravirus(100.0%)	1	NA	NA
WP_000918467.1|4014904_4015990_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	1.2e-89
>prophage 262
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4024537	4025674	4538615		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699105.1|4024537_4025674_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	9.1e-24
>prophage 263
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4032150	4033668	4538615		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4032150_4033668_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 264
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4037879	4039740	4538615		Planktothrix_phage(50.0%)	2	NA	NA
WP_001293612.1|4037879_4038653_+	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	38.1	2.4e-23
WP_000156161.1|4038849_4039740_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.6	7.5e-66
>prophage 265
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4052929	4053529	4538615		Salmonella_phage(100.0%)	1	NA	NA
WP_000813851.1|4052929_4053529_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 266
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4089732	4092754	4538615		Cronobacter_phage(33.33%)	3	NA	NA
WP_000461651.1|4089732_4090701_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_001379974.1|4090704_4091844_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_005098986.1|4092151_4092754_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	7.5e-09
>prophage 267
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4095892	4181334	4538615	protease,integrase,transposase	Vibrio_phage(14.29%)	66	4126516:4126531	4173866:4173881
WP_000140529.1|4095892_4096843_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.6	1.5e-67
WP_001000362.1|4097035_4098226_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209897.1|4098222_4099482_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|4099471_4101100_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948723.1|4101372_4102731_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000768975.1|4102735_4103812_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301054.1|4104274_4104925_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135039.1|4104978_4105233_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
WP_000332036.1|4105232_4106363_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075180.1|4106596_4108882_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_171763954.1|4109752_4110981_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_072075175.1|4111044_4112700_+	autotransporter	NA	NA	NA	NA	NA
WP_072075176.1|4112709_4114644_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	25.9	3.6e-20
WP_000990752.1|4114771_4115494_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|4115640_4118268_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_001215763.1|4120101_4120725_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_151090813.1|4123073_4124241_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_005046836.1|4125794_4125953_+	hypothetical protein	NA	NA	NA	NA	NA
4126516:4126531	attL	AGTGAACTGGCGCAGA	NA	NA	NA	NA
WP_001104543.1|4126516_4128166_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225855.1|4128170_4128947_+	YfaP family protein	NA	NA	NA	NA	NA
WP_000875997.1|4129221_4132071_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001061917.1|4132270_4132921_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_001249092.1|4132937_4135610_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865562.1|4136346_4137468_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.2e-116
WP_000406130.1|4137579_4138635_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786374.1|4138708_4139773_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000884947.1|4139772_4140423_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_151090818.1|4140498_4142142_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	2.1e-13
WP_005046816.1|4142952_4143984_+	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005046814.1|4144105_4144594_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000686713.1|4145001_4145496_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|4145485_4145749_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778072.1|4145745_4148232_+	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000091291.1|4148238_4148934_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013513.1|4148920_4149784_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835174.1|4149780_4150230_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528367.1|4150239_4150842_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000971730.1|4151473_4152136_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001295447.1|4152177_4152915_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|4152911_4153121_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026418.1|4153117_4153597_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982459.1|4153593_4155537_+	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_000824439.1|4155533_4156091_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211575.1|4156087_4157140_+	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_005046798.1|4157350_4157998_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_014532300.1|4158317_4160909_+	autotransporter YejO	NA	NA	NA	NA	NA
WP_151090838.1|4161402_4161687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151090819.1|4162406_4164323_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	S5M7Q8	Escherichia_phage	56.9	4.0e-213
WP_032214699.1|4164319_4164514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151090820.1|4164856_4165279_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000197279.1|4165275_4165527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097408931.1|4165728_4167144_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	57.9	1.3e-112
WP_151090821.1|4167140_4167440_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_151090822.1|4167445_4167679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151090823.1|4167671_4167911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447941.1|4169173_4169380_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_151090826.1|4169894_4171136_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.3	1.6e-98
WP_000256188.1|4171496_4173257_-	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001135673.1|4173276_4173504_-	YejL family protein	NA	NA	NA	NA	NA
WP_000050789.1|4173685_4174693_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
4173866:4173881	attR	AGTGAACTGGCGCAGA	NA	NA	NA	NA
WP_000494183.1|4174831_4175116_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578069.1|4175240_4177001_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.2e-99
WP_001234850.1|4177150_4177846_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213401.1|4177873_4179064_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.3	1.7e-20
WP_000202798.1|4179396_4179741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194922.1|4179744_4181334_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 268
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4187088	4191389	4538615		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4187088_4187655_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_005046782.1|4188066_4188780_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|4188818_4189805_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000848228.1|4189922_4191389_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	6.6e-43
>prophage 269
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4206659	4207517	4538615		Catovirus(100.0%)	1	NA	NA
WP_000873892.1|4206659_4207517_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.1e-24
>prophage 270
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4214701	4215370	4538615		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139613.1|4214701_4215370_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 271
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4218983	4220504	4538615		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|4218983_4220504_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 272
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4240663	4248019	4538615	tail	Enterobacteria_phage(60.0%)	7	NA	NA
WP_000569352.1|4240663_4241590_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	34.6	9.7e-24
WP_000783112.1|4241594_4242326_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4242306_4242414_-	protein YohO	NA	NA	NA	NA	NA
WP_047200136.1|4244206_4244488_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	96.2	3.6e-38
WP_011069443.1|4245618_4246032_+	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	47.8	3.5e-26
WP_000902877.1|4246034_4246580_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.1	2.5e-72
WP_061456161.1|4246603_4248019_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	53.8	1.3e-75
>prophage 273
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4251456	4255726	4538615	tail	Enterobacteria_phage(100.0%)	3	NA	NA
WP_000937511.1|4251456_4251726_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
WP_001261936.1|4251841_4252090_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	97.6	4.1e-38
WP_001295431.1|4254040_4255726_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
>prophage 274
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4260164	4263750	4538615	tRNA,transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_094081509.1|4260164_4261321_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_005049047.1|4261716_4263750_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	1.0e-54
>prophage 275
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4275163	4275985	4538615		Paenibacillus_phage(100.0%)	1	NA	NA
WP_005049077.1|4275163_4275985_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	36.2	1.4e-21
>prophage 276
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4287224	4293342	4538615	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000807346.1|4287224_4288124_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	9.8e-13
WP_001295425.1|4288529_4288847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005049106.1|4289188_4290550_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	7.1e-217
WP_000929408.1|4290696_4291029_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137862.1|4291219_4291942_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	3.7e-31
WP_000675144.1|4291938_4293342_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 277
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4302442	4312079	4538615		Catovirus(25.0%)	8	NA	NA
WP_001295424.1|4302442_4303084_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|4303175_4303757_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252355.1|4303778_4305632_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_005049154.1|4306083_4307667_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_162855178.1|4307867_4308017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978092.1|4308325_4309465_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482887.1|4309470_4309914_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137200.1|4309916_4312079_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
>prophage 278
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4316992	4323786	4538615		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|4316992_4318114_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043580.1|4318116_4319085_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	1.1e-86
WP_000479838.1|4319084_4319564_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699711.1|4319560_4320784_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079297.1|4320786_4322223_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	4.8e-46
WP_005049180.1|4322415_4323786_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
>prophage 279
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4329402	4335709	4538615		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001116126.1|4329402_4330797_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.9	1.8e-18
WP_000183041.1|4330971_4331865_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_000699404.1|4332237_4333323_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_001023623.1|4333322_4334222_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	4.4e-29
WP_000857518.1|4334280_4335159_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.9e-106
WP_001100804.1|4335163_4335709_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
>prophage 280
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4339970	4344641	4538615		Shigella_phage(50.0%)	5	NA	NA
WP_011069435.1|4339970_4340345_+	bactoprenol-linked glucose translocase	NA	U5P0S6	Shigella_phage	46.0	4.6e-17
WP_005049202.1|4341552_4342116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171765781.1|4342261_4342741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011110604.1|4342766_4343126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043429.1|4343234_4344641_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
>prophage 281
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4353453	4354353	4538615		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131772.1|4353453_4354353_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 282
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4362734	4392742	4538615	integrase,transposase	Stx2-converting_phage(55.56%)	21	4358461:4358473	4363935:4363947
4358461:4358473	attL	AGCTGGTTCGCCG	NA	NA	NA	NA
WP_001007949.1|4362734_4363574_+|integrase	integrase family protein	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.6	1.3e-160
WP_004967157.1|4363652_4364327_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
4363935:4363947	attR	CGGCGAACCAGCT	NA	NA	NA	NA
WP_005049241.1|4364323_4364674_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
WP_094081542.1|4365665_4366893_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_045177795.1|4370505_4372107_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.3	3.2e-147
WP_004967157.1|4373759_4374434_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_005088730.1|4374503_4374803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|4374974_4375304_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016348.1|4375404_4375587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094081532.1|4377616_4378772_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000261572.1|4378784_4379294_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_005049317.1|4379290_4380034_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001165576.1|4380045_4381125_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986341.1|4381186_4382122_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011445.1|4382580_4383498_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001010988.1|4383599_4384550_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532920.1|4386926_4387643_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060217.1|4387985_4389440_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_094081533.1|4389791_4390948_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_005063096.1|4391009_4391513_-	MFS transporter	NA	NA	NA	NA	NA
WP_094081534.1|4391574_4392742_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	8.9e-184
>prophage 283
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4396673	4453835	4538615	tail,transposase,holin	Enterobacteria_phage(29.17%)	53	NA	NA
WP_005069274.1|4396673_4397090_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.0	1.5e-24
WP_000935258.1|4397684_4397897_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_001302544.1|4397938_4398124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011069426.1|4398064_4398343_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.0	4.5e-09
WP_001265248.1|4398344_4399403_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	2.6e-89
WP_000140020.1|4399403_4399769_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.1	7.1e-39
WP_005049343.1|4399765_4400449_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
WP_000839572.1|4401249_4401465_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_004967157.1|4401563_4402238_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_005049241.1|4402234_4402585_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
WP_094105050.1|4403459_4404615_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_000497744.1|4405009_4405171_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	76.6	9.2e-15
WP_000155744.1|4405167_4406664_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8W623	Enterobacteria_phage	97.4	5.9e-273
WP_001062338.1|4406663_4407020_+|tail	phage tail tube protein	tail	Q8W622	Enterobacteria_phage	98.3	5.3e-63
WP_001251340.1|4407019_4407355_+|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	97.2	9.8e-51
WP_000785377.1|4407439_4409389_+|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	98.2	0.0e+00
WP_000594909.1|4409456_4409939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050197833.1|4412343_4413987_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_000239881.1|4414302_4414971_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937511.1|4415027_4415297_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
WP_001007781.1|4416374_4417025_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240061.1|4417282_4417918_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000920127.1|4419031_4419445_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001347103.1|4419577_4420249_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000218218.1|4421713_4422565_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_111778310.1|4424208_4425436_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	9.8e-173
WP_094081536.1|4426275_4427422_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.5e-146
WP_032155863.1|4427423_4427681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157215.1|4428327_4429746_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000228688.1|4429726_4430197_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	7.6e-33
WP_151090832.1|4430185_4431106_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922688.1|4431278_4432196_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009302.1|4432274_4432457_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_005048789.1|4435431_4435659_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867216.1|4435821_4436010_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103994.1|4436053_4436677_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983188.1|4436961_4437747_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|4437755_4438025_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253318.1|4438034_4438772_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001298519.1|4438771_4439137_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282086.1|4439139_4439553_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_005048779.1|4439549_4440554_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|4440558_4441023_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620124.1|4441127_4442255_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_151090833.1|4442614_4443988_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282677.1|4443987_4444674_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067956.1|4444666_4445662_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001274301.1|4447527_4447842_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|4448186_4448519_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001313946.1|4448687_4449239_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000737286.1|4450534_4451617_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	79.8	7.8e-166
WP_005127797.1|4452626_4452800_+	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	77.2	1.4e-16
WP_157849614.1|4453064_4453835_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1W6JP07	Morganella_phage	96.9	1.4e-129
>prophage 284
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4466549	4467302	4538615		Planktothrix_phage(100.0%)	1	NA	NA
WP_001272995.1|4466549_4467302_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	6.0e-32
>prophage 285
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4479156	4480671	4538615		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187792.1|4479156_4480671_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	1.6e-12
>prophage 286
NZ_CP044152	Shigella flexneri strain AR-0425 chromosome, complete genome	4538615	4489189	4537940	4538615	tRNA,tail,transposase	Enterobacteria_phage(41.38%)	44	NA	NA
WP_000610392.1|4489189_4490851_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.5	1.1e-09
WP_000483183.1|4490896_4492498_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	4.4e-16
WP_000204331.1|4492516_4493377_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_151090836.1|4493379_4494429_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|4494443_4494833_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983598.1|4494843_4495488_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_011069416.1|4495575_4495980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103659.1|4497199_4497595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747032.1|4497735_4498903_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000455174.1|4498838_4499297_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_001259572.1|4502749_4503088_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_005063152.1|4504554_4505043_-	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001025297.1|4505219_4506953_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_005048653.1|4507168_4507735_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185741.1|4507748_4508495_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001352368.1|4509468_4510677_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001229400.1|4511344_4513774_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564755.1|4513938_4514910_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|4514906_4515650_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_005048647.1|4515690_4516086_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000905997.1|4516138_4516489_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_000747032.1|4516718_4517886_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000528720.1|4517861_4518059_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.2	3.7e-26
WP_001030133.1|4518067_4518214_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	1.4e-22
WP_000457719.1|4518217_4518460_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	85.0	6.2e-31
WP_000586688.1|4518583_4519153_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	6.8e-28
WP_001099210.1|4519149_4519899_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	96.0	1.7e-135
WP_000755956.1|4519942_4520770_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	94.5	2.3e-125
WP_000248820.1|4522490_4522628_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	100.0	1.9e-16
WP_001215517.1|4522627_4522987_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.1	8.3e-40
WP_001064885.1|4522983_4523673_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.4	2.9e-57
WP_005049126.1|4524858_4526055_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001074423.1|4526318_4526720_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	66.2	3.3e-37
WP_000753026.1|4526731_4527103_+|tail	tail attachment protein	tail	NA	NA	NA	NA
WP_000677116.1|4527089_4527680_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	78.2	7.4e-78
WP_001079406.1|4527676_4528078_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	97.7	1.6e-71
WP_000211126.1|4528088_4528829_+	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	96.7	1.5e-128
WP_000478927.1|4528887_4529274_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_001161004.1|4529282_4529612_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
WP_000371983.1|4529583_4532625_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
WP_000447264.1|4532624_4532954_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
WP_001152490.1|4532953_4533652_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000090877.1|4534335_4534938_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_171768104.1|4537682_4537940_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	97.5	2.5e-38
>prophage 1
NZ_CP044154	Shigella flexneri strain AR-0425 plasmid pAR-0425-2, complete sequence	222114	0	110532	222114	tRNA,transposase,protease	Escherichia_phage(33.33%)	57	NA	NA
WP_005085088.1|875_2072_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005038443.1|2322_2796_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094085526.1|2884_3749_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	6.7e-19
WP_151090841.1|5089_6502_+	type 3 secretion system effector OspC1	NA	NA	NA	NA	NA
WP_024259347.1|6830_8528_+	type III secretion system effector OspD3	NA	NA	NA	NA	NA
WP_000019158.1|8930_9203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072056208.1|10766_11465_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.1	7.3e-125
WP_010921638.1|17700_19425_-	T3SS effector E3 ubiquitin-protein ligase IpaH4.5	NA	NA	NA	NA	NA
WP_151090842.1|19852_21550_-	T3SS effector E3 ubiquitin-protein ligase IpaH7.8	NA	NA	NA	NA	NA
WP_004998488.1|22958_23990_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_047201489.1|26332_26521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000701108.1|34566_36021_+	type 3 secretion system effector OspC2	NA	NA	NA	NA	NA
WP_000198552.1|36469_37678_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019158.1|37658_37931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010921625.1|38202_38505_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000405245.1|38495_38978_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005116773.1|46552_47341_+	AraC family invasion system transcriptional regulator VirF	NA	NA	NA	NA	NA
WP_072075159.1|47282_47705_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	98.1	7.7e-53
WP_000947175.1|48630_49830_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957853.1|49839_50028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072075197.1|52446_53625_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.4	2.6e-29
WP_000431558.1|54654_55635_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	58.2	5.0e-95
WP_000200287.1|55634_56834_-	AAA family ATPase	NA	Q71TL9	Escherichia_phage	75.1	2.0e-175
WP_011114728.1|57560_58343_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	8.5e-138
WP_151090843.1|58774_59968_+|transposase	IS4-like element ISSfl1 family transposase	transposase	S5FM71	Shigella_phage	62.5	2.6e-138
WP_000901798.1|62538_63105_-	type III secretion effector IpgB2	NA	NA	NA	NA	NA
WP_011114726.1|63386_63701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000622998.1|67778_68126_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	74.8	9.8e-46
WP_011587243.1|68569_69916_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001082155.1|70241_70529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868563.1|71880_72459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121867.1|73490_74210_+	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_005061014.1|74641_76351_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_000261567.1|77689_78040_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.0	2.8e-08
WP_000850662.1|80673_81414_-	PAP2 family phosphatase PhoN2	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.4	7.5e-11
WP_151090849.1|84098_85100_-|protease	omptin family outer membrane protease IcsP	protease	NA	NA	NA	NA
WP_011378983.1|86061_86199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094081528.1|87608_88882_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
WP_011114782.1|90926_91079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957716.1|91726_91993_+	type 3 secretion system effector OspE1	NA	NA	NA	NA	NA
WP_151090845.1|92384_94112_+	T3SS effector E3 ubiquitin-protein ligase IpaH1.4	NA	NA	NA	NA	NA
WP_000957853.1|94442_94631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094081575.1|94640_95835_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000829592.1|96065_96257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130973.1|96957_97815_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|97807_97882_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083819.1|98105_98366_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766818.1|98605_99196_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001299729.1|99234_99444_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_094081574.1|99778_100934_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_004971339.1|101461_101674_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139368.1|101804_102365_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205722.1|102419_103166_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	32.0	5.4e-09
WP_171721158.1|108032_108437_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_000450531.1|108518_108746_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911311.1|108745_109144_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_094081572.1|109376_110532_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
>prophage 2
NZ_CP044154	Shigella flexneri strain AR-0425 plasmid pAR-0425-2, complete sequence	222114	120840	170564	222114	transposase,protease	Stx2-converting_phage(55.56%)	31	NA	NA
WP_064753708.1|120840_122160_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000705601.1|122845_123436_-	type III secretion system effector protein kinase OspG	NA	NA	NA	NA	NA
WP_151090846.1|124164_125802_-	T3SS effector E3 ubiquitin-protein ligase IpaH9.8	NA	NA	NA	NA	NA
WP_023592908.1|126063_126171_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_001159860.1|126194_126500_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813626.1|126501_126720_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000421262.1|129187_129463_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011114774.1|129462_129747_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_119213516.1|131182_132784_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.3	5.4e-147
WP_000631708.1|132803_133151_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	9.2e-44
WP_004967157.1|133147_133822_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_000607008.1|135415_136054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004967157.1|136881_137556_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_000631708.1|137552_137900_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	9.2e-44
WP_094081569.1|138528_139684_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_151090847.1|141854_142625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104887.1|143115_143337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086135.1|143337_144021_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	2.3e-30
WP_011114770.1|144084_144396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015683198.1|144392_145295_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921952.1|145734_146694_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	40.9	1.4e-62
WP_000445929.1|146693_147089_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_005015412.1|147271_147652_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_094081568.1|147697_148541_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	2.2e-22
WP_000828661.1|148711_149461_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000612525.1|151758_153411_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_001195004.1|159431_160634_+|protease	alpha-tubulin-specific protease	protease	NA	NA	NA	NA
WP_000124083.1|163021_163387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011114760.1|166954_167671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011114759.1|168222_168627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151090848.1|169364_170564_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP044154	Shigella flexneri strain AR-0425 plasmid pAR-0425-2, complete sequence	222114	205831	206836	222114	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000255980.1|205831_206836_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	97.8	2.0e-184
>prophage 4
NZ_CP044154	Shigella flexneri strain AR-0425 plasmid pAR-0425-2, complete sequence	222114	213822	221538	222114	transposase	Stx2-converting_phage(60.0%)	8	NA	NA
WP_004967157.1|213822_214497_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_005048975.1|214493_214844_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_005063916.1|214840_216442_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.6	1.2e-146
WP_001346193.1|216695_216860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011114751.1|217761_218046_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000501974.1|218033_218519_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_094085527.1|219039_220195_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_171763954.1|220310_221538_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
