The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044164	Campylobacter coli strain AR-0417 chromosome, complete genome	1730910	1014924	1061808	1730910	tRNA,integrase,tail,transposase,plate,terminase	Campylobacter_phage(55.17%)	61	1030630:1030650	1062264:1062284
WP_002798038.1|1014924_1016349_-	catalase	NA	A0A2K9L0T1	Tupanvirus	38.0	1.2e-92
WP_002777843.1|1016535_1016853_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_002783868.1|1016852_1017548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002777839.1|1017547_1018039_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_019109136.1|1018846_1019200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019109137.1|1019203_1019518_-	hypothetical protein	NA	J9SP73	Campylobacter_phage	98.1	8.3e-52
WP_044260196.1|1019514_1020498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151014812.1|1020848_1021478_+	S24 family peptidase	NA	A7YG70	Campylobacter_phage	96.5	1.1e-58
WP_002865000.1|1021558_1021879_+	hypothetical protein	NA	A7YGI4	Campylobacter_phage	100.0	1.3e-52
WP_002843339.1|1021888_1022083_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	100.0	1.8e-28
WP_002865289.1|1022162_1022450_+	hypothetical protein	NA	A7YGG4	Campylobacter_phage	100.0	1.9e-47
WP_002872726.1|1022477_1023293_-	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	99.6	2.4e-151
WP_107701867.1|1023397_1023886_-	virion morphogenesis protein	NA	A7YG96	Campylobacter_phage	99.4	7.7e-89
WP_151014815.1|1023889_1026223_-|tail	phage tail tape measure protein	tail	A7YGE8	Campylobacter_phage	89.6	0.0e+00
WP_002791365.1|1026264_1026570_+	hypothetical protein	NA	A7YG88	Campylobacter_phage	90.1	1.9e-32
WP_002791367.1|1026681_1026921_-|tail	phage tail assembly protein	tail	A7YG75	Campylobacter_phage	89.9	1.5e-08
WP_002794205.1|1027024_1027534_-|tail	tail protein	tail	A7YGZ4	Campylobacter_phage	99.4	5.6e-90
WP_002784660.1|1027557_1028751_-|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	99.5	8.2e-201
WP_002784662.1|1028761_1029775_-	hypothetical protein	NA	A7YGY4	Campylobacter_phage	98.2	6.1e-189
WP_002784664.1|1029771_1030158_-	DUF1353 domain-containing protein	NA	A7YGM3	Campylobacter_phage	87.6	4.6e-60
WP_002784666.1|1030150_1031908_-	radical SAM protein	NA	NA	NA	NA	NA
1030630:1030650	attL	TTAAAAAATTATCTTTTAAAT	NA	NA	NA	NA
WP_002784668.1|1031907_1032543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151014818.1|1032552_1033575_-|tail	phage tail protein	tail	A7YGA7	Campylobacter_phage	88.8	2.6e-78
WP_002784479.1|1033574_1034195_-|tail	phage tail protein I	tail	A7YGG0	Campylobacter_phage	94.0	2.2e-56
WP_057037189.1|1034191_1035358_-|plate	baseplate assembly protein	plate	Q8H9N3	Vibrio_phage	24.1	2.0e-13
WP_057037190.1|1035354_1035645_-|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	39.0	6.1e-09
WP_038840900.1|1035641_1035854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057037191.1|1035853_1036351_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.8	4.3e-10
WP_038840904.1|1036350_1036665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057037192.1|1036776_1037010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057037193.1|1037006_1037342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057037194.1|1037351_1037741_-	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	49.6	1.2e-23
WP_057037195.1|1037890_1038325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057037196.1|1038328_1039153_+	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	45.9	3.0e-24
WP_057037290.1|1039154_1039652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057037199.1|1039655_1040633_+	hypothetical protein	NA	R9TRN2	Rhizobium_phage	23.9	6.2e-05
WP_002784509.1|1040747_1041206_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_057037200.1|1041198_1041681_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_057037201.1|1041680_1043351_+|terminase	phage terminase large subunit	terminase	A0A0A1IW02	Pseudomonas_phage	41.5	2.0e-91
WP_057037202.1|1043360_1044731_+	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.1	1.3e-16
WP_057037203.1|1044732_1045974_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	29.3	7.4e-19
WP_057037204.1|1046105_1046480_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002791401.1|1046472_1046664_+|tail	tail protein	tail	NA	NA	NA	NA
WP_057037206.1|1047611_1048148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032685771.1|1048140_1048371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032592001.1|1048537_1048822_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_151014821.1|1049268_1049718_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_002784531.1|1050405_1050675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057037207.1|1050671_1051634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038840058.1|1051694_1052180_-	host-nuclease inhibitor protein Gam	NA	A0A2K9VGT9	Faecalibacterium_phage	33.3	2.7e-17
WP_057037208.1|1052180_1052378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057037209.1|1052374_1052713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784541.1|1052914_1053100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793918.1|1053096_1053288_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_057037210.1|1053291_1054215_-	AAA family ATPase	NA	A0A2H4JAW1	uncultured_Caudovirales_phage	24.8	7.9e-10
WP_057037211.1|1054297_1056370_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002784549.1|1056370_1056571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784551.1|1056722_1057370_+	transcriptional regulator	NA	M5A9D2	Nitratiruptor_phage	45.2	2.0e-23
WP_057037212.1|1057385_1058093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151014825.1|1058151_1058751_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002777832.1|1060485_1061808_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
1062264:1062284	attR	TTAAAAAATTATCTTTTAAAT	NA	NA	NA	NA
