The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	0	1632	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_139397017.1|255_1632_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	3.8e-32
>prophage 2
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	7208	10027	5059877		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_047740532.1|7208_8615_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.1	3.3e-39
WP_047740534.1|8860_10027_+	UDP-glucose 6-dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	55.2	2.8e-113
>prophage 3
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	16164	17904	5059877		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_047740543.1|16164_17904_+	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	32.6	1.4e-15
>prophage 4
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	23222	27843	5059877		Tupanvirus(33.33%)	4	NA	NA
WP_047740552.1|23222_24227_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.5	4.1e-36
WP_042896043.1|25172_25940_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_042896047.1|25939_26680_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	21.8	4.1e-09
WP_139397024.1|26691_27843_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.9	4.2e-77
>prophage 5
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	38888	39788	5059877		Cellulophaga_phage(100.0%)	1	NA	NA
WP_015365824.1|38888_39788_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.8e-11
>prophage 6
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	44210	49123	5059877		Streptococcus_phage(50.0%)	3	NA	NA
WP_047058362.1|44210_46313_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.8	5.2e-65
WP_032706256.1|46351_47776_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_020078367.1|47950_49123_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.7	1.5e-186
>prophage 7
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	92666	103602	5059877		Burkholderia_phage(28.57%)	11	NA	NA
WP_045360545.1|92666_93608_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	77.2	1.2e-133
WP_045360548.1|93607_93964_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	52.1	2.0e-25
WP_139397084.1|94938_96081_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.6	4.0e-120
WP_015705988.1|96629_96911_+	membrane protein	NA	NA	NA	NA	NA
WP_015365890.1|96954_97650_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	30.7	1.7e-09
WP_045365613.1|97707_99129_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	7.5e-100
WP_045387568.1|99112_99598_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.2e-33
WP_151084792.1|99572_100484_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_139397086.1|100667_101579_+	DUF808 family protein	NA	NA	NA	NA	NA
WP_015365895.1|101655_101835_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_151084794.1|101934_103602_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	31.6	5.4e-17
>prophage 8
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	110319	111072	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_015365905.1|110319_111072_+	L-cystine ABC transporter ATP-binding protein YecC	NA	W8CYL7	Bacillus_phage	36.6	1.0e-15
>prophage 9
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	126391	127906	5059877		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_046883139.1|126391_127906_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	3.1e-11
>prophage 10
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	134873	151484	5059877	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_015365977.1|134873_136607_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.9	1.5e-86
WP_015365978.1|136836_137406_+	VOC family protein	NA	NA	NA	NA	NA
WP_015365979.1|137485_138226_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_151084800.1|138354_139371_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_015365981.1|139367_140111_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	28.7	1.7e-23
WP_015365982.1|140150_140546_-	membrane protein	NA	NA	NA	NA	NA
WP_151084802.1|140599_141418_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.0	9.4e-55
WP_045365649.1|141414_141981_-	hydrolase	NA	NA	NA	NA	NA
WP_063444724.1|142247_144035_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.3	3.3e-12
WP_015365986.1|144036_144480_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_015365987.1|144529_145270_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015365988.1|145315_145837_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_015365989.1|145918_146530_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_015705957.1|146538_147549_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	1.2e-06
WP_015705956.1|147588_148374_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_015705955.1|148373_149126_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.4	3.0e-15
WP_042893478.1|149204_150149_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_015365994.1|150164_151484_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.0	2.6e-14
>prophage 11
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	155623	157099	5059877		Cyanophage(100.0%)	1	NA	NA
WP_015365999.1|155623_157099_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	4.9e-78
>prophage 12
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	164502	165472	5059877		Pseudoalteromonas_phage(50.0%)	2	NA	NA
WP_015366006.1|164502_165162_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	30.1	7.6e-15
WP_015366007.1|165241_165472_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	3.5e-15
>prophage 13
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	174629	175286	5059877		Enterobacteria_phage(100.0%)	1	NA	NA
WP_058675522.1|174629_175286_+	protein-serine/threonine phosphatase	NA	K7P6H8	Enterobacteria_phage	52.8	3.8e-59
>prophage 14
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	182765	184814	5059877		Moraxella_phage(100.0%)	1	NA	NA
WP_015705936.1|182765_184814_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	2.2e-84
>prophage 15
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	190101	190311	5059877		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|190101_190311_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 16
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	197769	199329	5059877		Moraxella_phage(100.0%)	1	NA	NA
WP_015366041.1|197769_199329_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.9	8.6e-41
>prophage 17
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	203182	210551	5059877	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_047058131.1|203182_204538_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.9	2.3e-42
WP_015366046.1|204623_204809_+	YoaH family protein	NA	NA	NA	NA	NA
WP_015366047.1|204809_205154_-	RidA family protein	NA	NA	NA	NA	NA
WP_045390404.1|205285_207196_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.8	7.2e-90
WP_015705925.1|207341_208037_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_032714806.1|208075_208657_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_015705923.1|208865_210551_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	6.5e-34
>prophage 18
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	216009	223113	5059877		Klebsiella_phage(25.0%)	7	NA	NA
WP_047040826.1|216009_217068_+	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	40.2	1.8e-58
WP_052765782.1|217353_217590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047040829.1|217834_218041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047040831.1|218485_220174_-	hypothetical protein	NA	A0A289Z7B8	Serratia_phage	33.7	1.8e-84
WP_047739477.1|220393_221659_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.0	3.0e-201
WP_047040835.1|221660_222371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047040837.1|222444_223113_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.3	4.2e-77
>prophage 19
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	234769	235381	5059877		Geobacillus_virus(100.0%)	1	NA	NA
WP_015366071.1|234769_235381_+	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	37.9	8.7e-05
>prophage 20
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	246864	343469	5059877	integrase,tail,capsid,plate,portal,tRNA,head	Enterobacteria_phage(27.66%)	99	298856:298877	334788:334809
WP_015705832.1|246864_249159_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.2e-155
WP_015366083.1|249245_250610_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_139396981.1|250614_251301_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.2	4.7e-07
WP_048481433.1|251479_252049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015366086.1|252052_252298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103826130.1|252525_253245_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	28.9	4.1e-14
WP_042893456.1|253260_254217_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_072207418.1|254225_255221_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_042893460.1|255699_255978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032714779.1|255993_257337_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_151084818.1|257333_257999_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_139396975.1|257995_259678_+	OmpA family protein	NA	NA	NA	NA	NA
WP_151084820.1|259878_262257_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	1.4e-18
WP_015366096.1|262296_262554_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_151085569.1|262664_263711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042893467.1|263713_264472_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_139396973.1|264528_265092_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_042893470.1|265064_265307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042893471.1|265515_266088_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_047466698.1|266129_266564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032708430.1|266706_267279_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_032708429.1|267251_267701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015705817.1|267847_268417_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_151084822.1|268389_270828_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_020078511.1|274382_276143_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032714762.1|276106_277192_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_015705809.1|277169_277709_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_015366112.1|277803_279069_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.9	5.8e-197
WP_015705808.1|279071_279491_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.6	6.5e-36
WP_045389741.1|280145_282362_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	30.0	6.1e-48
WP_020078514.1|282374_283928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015366119.1|283924_284053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151084824.1|284063_288164_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	42.1	7.1e-34
WP_020078516.1|288114_288900_+	macro domain-containing protein	NA	A0A2L1IVW3	Streptomyces_phage	35.0	2.8e-16
WP_151084826.1|289011_289659_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	68.0	3.0e-24
WP_046883171.1|289673_290099_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_139397271.1|290443_291472_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.1	2.5e-12
WP_015705797.1|292172_292601_+	membrane protein	NA	NA	NA	NA	NA
WP_020078529.1|293053_294241_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_015366130.1|295161_296076_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	2.9e-73
WP_045411280.1|296167_296806_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_015366132.1|296920_297184_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_015366133.1|297231_297354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100279139.1|297487_297562_-	protein YoaJ	NA	NA	NA	NA	NA
WP_015705794.1|297561_297663_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_032708358.1|297710_298733_-	diguanylate cyclase	NA	A0A249XXD1	Clostridium_phage	29.0	8.5e-05
298856:298877	attL	AAAAAAAAGCCCCATCGGGGGC	NA	NA	NA	NA
WP_151084828.1|298960_299974_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.7	1.4e-156
WP_116289301.1|300089_300389_-	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	68.7	2.5e-34
WP_151084830.1|300511_300787_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	86.7	6.8e-42
WP_151084832.1|300810_301029_+	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	9.6e-07
WP_151084834.1|301044_301275_+	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	68.6	2.0e-23
WP_032705922.1|301289_301562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032751868.1|301631_301859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151084836.1|301851_302397_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	26.5	2.4e-06
WP_064172672.1|302405_302633_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.6	1.4e-05
WP_151084838.1|302629_302824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151084840.1|302816_303770_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	54.6	4.3e-83
WP_151084842.1|303769_303976_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	76.1	9.0e-23
WP_151084844.1|303968_304196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032723896.1|304519_304897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151084846.1|304895_307523_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.8	1.9e-194
WP_151084848.1|307519_307960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151084850.1|308463_309873_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	27.0	1.3e-19
WP_032723905.1|310264_311299_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.9	3.1e-140
WP_032414439.1|311319_313041_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.3	1.3e-226
WP_049029214.1|313201_314035_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.8	5.5e-95
WP_151084852.1|314058_315108_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.2	6.1e-107
WP_032705909.1|316116_316614_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	69.7	2.2e-59
WP_151084854.1|316613_316814_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	6.7e-15
WP_151084856.1|316804_317086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117081754.1|317082_317634_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.9	2.6e-32
WP_117092853.1|317874_318174_+	peptidase	NA	NA	NA	NA	NA
WP_032723912.1|318170_318629_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.6	4.0e-31
WP_151084858.1|318625_319267_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.3	2.4e-45
WP_151084860.1|319266_319851_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	63.0	6.0e-64
WP_151084862.1|319847_320216_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	57.4	2.3e-29
WP_151084864.1|320202_321102_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.9	7.3e-93
WP_151084866.1|321094_321691_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	47.1	1.7e-42
WP_151084868.1|321695_325160_+	hypothetical protein	NA	A0A1V0E6N8	Klebsiella_phage	26.9	1.1e-88
WP_151084870.1|325161_326199_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	46.5	3.3e-36
WP_151084872.1|326296_326785_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.1	5.8e-52
WP_151085570.1|329511_329664_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	1.2e-11
WP_032723923.1|329684_329984_-|tail	tail protein	tail	B9A7B2	Serratia_phage	72.7	2.2e-30
WP_116691577.1|330035_330551_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	3.4e-63
WP_116289327.1|330551_331733_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.9	3.6e-156
WP_151084874.1|331884_333039_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	73.4	1.1e-162
WP_151084876.1|333084_333333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116289345.1|333442_333775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151084878.1|333779_334676_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_015366135.1|334957_335206_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
334788:334809	attR	AAAAAAAAGCCCCATCGGGGGC	NA	NA	NA	NA
WP_047037913.1|335216_335564_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_032711865.1|335704_336397_+	CTP synthase	NA	NA	NA	NA	NA
WP_046883175.1|336430_337612_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_015366139.1|337712_338504_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015366140.1|338487_338934_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_045360494.1|339074_339575_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_045360492.1|339635_341126_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	28.3	9.8e-10
WP_041165555.1|341331_341547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015366144.1|342185_343469_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	26.6	5.5e-09
>prophage 21
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	349999	352069	5059877		Tupanvirus(100.0%)	2	NA	NA
WP_015366150.1|349999_351256_-	glycoside hydrolase family 18 protein	NA	A0A2K9KZQ8	Tupanvirus	28.9	1.2e-24
WP_015366151.1|351427_352069_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.8	1.3e-19
>prophage 22
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	357944	359894	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_042892724.1|357944_359894_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	4.8e-41
>prophage 23
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	365996	366641	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_032708309.1|365996_366641_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.1	3.1e-13
>prophage 24
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	372702	373923	5059877		Klosneuvirus(100.0%)	1	NA	NA
WP_015705769.1|372702_373923_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.2e-28
>prophage 25
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	379369	380197	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_015366181.1|379369_380197_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	4.5e-73
>prophage 26
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	386446	388705	5059877		Tupanvirus(100.0%)	1	NA	NA
WP_151084890.1|386446_388705_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.2	2.2e-146
>prophage 27
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	402714	405672	5059877		Acinetobacter_phage(100.0%)	2	NA	NA
WP_045360440.1|402714_404073_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_032708282.1|404076_405672_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.4	2.0e-45
>prophage 28
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	421016	421778	5059877		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_015366220.1|421016_421778_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	2.7e-08
>prophage 29
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	431203	431794	5059877		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015366227.1|431203_431794_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 30
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	437353	439288	5059877		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_015705733.1|437353_439288_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	31.9	2.5e-05
>prophage 31
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	443967	445771	5059877		Bacillus_virus(50.0%)	2	NA	NA
WP_015366242.1|443967_444777_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.0	6.1e-14
WP_015366243.1|444778_445771_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.1	1.6e-08
>prophage 32
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	474710	475577	5059877		Staphylococcus_phage(100.0%)	1	NA	NA
WP_063410694.1|474710_475577_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	8.7e-51
>prophage 33
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	498046	500798	5059877		Escherichia_phage(50.0%)	2	NA	NA
WP_015366305.1|498046_498793_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.8	5.4e-17
WP_042894560.1|498980_500798_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.0e-16
>prophage 34
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	510380	515736	5059877	tRNA	Escherichia_phage(50.0%)	6	NA	NA
WP_048229293.1|510380_511754_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	5.1e-53
WP_032711785.1|511801_512737_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_032711784.1|513088_513424_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	76.8	2.4e-41
WP_042894575.1|513481_513778_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	77.9	4.0e-40
WP_015705624.1|514014_514440_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.0e-28
WP_042894578.1|514593_515736_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.5	6.2e-113
>prophage 35
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	521112	522102	5059877		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_087876942.1|521112_522102_-	2-hydroxyacid dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	42.5	1.1e-68
>prophage 36
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	547394	552019	5059877		Klosneuvirus(50.0%)	2	NA	NA
WP_058676192.1|547394_551297_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.2	1.4e-52
WP_072206440.1|551344_552019_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	2.7e-31
>prophage 37
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	558581	559787	5059877		Klosneuvirus(100.0%)	1	NA	NA
WP_015366354.1|558581_559787_+	acetylornithine/succinylornithine family transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	1.6e-23
>prophage 38
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	571303	578937	5059877		Bacillus_phage(33.33%)	7	NA	NA
WP_015705588.1|571303_573415_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.2	2.9e-39
WP_015366366.1|573683_574586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015366367.1|574728_575256_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.5e-18
WP_015366368.1|575540_576923_+	4-hydroxyphenylacetate permease	NA	NA	NA	NA	NA
WP_015366369.1|576942_577416_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015366370.1|577519_577795_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_015366371.1|577818_578937_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.5	3.3e-34
>prophage 39
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	586514	588023	5059877		Megavirus(100.0%)	1	NA	NA
WP_015366380.1|586514_588023_+	carboxylesterase/lipase family protein	NA	L7Y5U6	Megavirus	34.8	2.3e-30
>prophage 40
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	593345	594434	5059877		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_015366385.1|593345_594434_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	6.0e-25
>prophage 41
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	607480	609442	5059877		Phage_TP(100.0%)	1	NA	NA
WP_151084920.1|607480_609442_+	U32 family peptidase	NA	Q6DW11	Phage_TP	27.0	1.3e-22
>prophage 42
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	616242	617256	5059877		Mycoplasma_phage(100.0%)	1	NA	NA
WP_108684248.1|616242_617256_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	4.8e-24
>prophage 43
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	630589	632686	5059877		Salmonella_phage(100.0%)	1	NA	NA
WP_074167333.1|630589_632686_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.8	5.6e-136
>prophage 44
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	643020	643797	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_015366435.1|643020_643797_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.6	3.5e-19
>prophage 45
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	651509	653054	5059877		Escherichia_phage(100.0%)	1	NA	NA
WP_151084928.1|651509_653054_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 46
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	659117	660608	5059877		Mycobacterium_phage(100.0%)	1	NA	NA
WP_020078692.1|659117_660608_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.8	1.8e-32
>prophage 47
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	667093	667867	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_032711712.1|667093_667867_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 48
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	681025	681742	5059877		Staphylococcus_phage(100.0%)	1	NA	NA
WP_042897308.1|681025_681742_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	2.1e-10
>prophage 49
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	690276	694240	5059877		Tupanvirus(50.0%)	3	NA	NA
WP_015366486.1|690276_691287_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	26.5	4.6e-27
WP_015705505.1|691468_692479_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048228777.1|692524_694240_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.4	2.3e-34
>prophage 50
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	705215	706160	5059877		Mollivirus(100.0%)	1	NA	NA
WP_015366501.1|705215_706160_+	Dyp-type peroxidase	NA	A0A0M5KAH8	Mollivirus	28.0	4.9e-23
>prophage 51
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	718757	721490	5059877		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_015366513.1|718757_721490_+	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.3	7.2e-43
>prophage 52
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	740525	748826	5059877		Bacillus_phage(33.33%)	7	NA	NA
WP_126027391.1|740525_741878_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.0	8.3e-08
WP_047058731.1|741966_743157_+	cytochrome c biogenesis protein DipZ	NA	NA	NA	NA	NA
WP_015366535.1|743224_744697_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_015366536.1|744715_746101_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.7e-27
WP_042897371.1|746408_747338_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020078740.1|747366_748107_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_126027393.1|748103_748826_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.6	1.3e-12
>prophage 53
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	772950	773904	5059877		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_151084951.1|772950_773904_+	hypothetical protein	NA	A0A2H4JEI9	uncultured_Caudovirales_phage	28.8	4.2e-30
>prophage 54
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	783191	790494	5059877		Enterobacteria_phage(33.33%)	5	NA	NA
WP_151084955.1|783191_785804_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.0	8.4e-81
WP_047042623.1|785828_787253_+	serine/threonine protein kinase	NA	M1HV07	Acanthocystis_turfacea_Chlorella_virus	28.1	4.8e-14
WP_047042626.1|787347_787737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032708080.1|787733_788108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047042628.1|788232_790494_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.3	7.8e-43
>prophage 55
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	824359	825097	5059877		Planktothrix_phage(100.0%)	1	NA	NA
WP_015705410.1|824359_825097_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	5.3e-33
>prophage 56
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	848475	849345	5059877		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_151084977.1|848475_849345_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	33.7	7.5e-18
>prophage 57
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	861675	864824	5059877		Lactococcus_phage(50.0%)	3	NA	NA
WP_015705358.1|861675_863046_+	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JHY1	Lactococcus_phage	36.7	8.6e-45
WP_015705356.1|864239_864404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015366670.1|864419_864824_-	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	32.6	1.6e-10
>prophage 58
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	870721	873081	5059877		Mycobacterium_phage(50.0%)	4	NA	NA
WP_032705768.1|870721_870937_-	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	50.0	1.6e-06
WP_015366681.1|870963_871464_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004143718.1|871552_871738_-	general stress protein	NA	NA	NA	NA	NA
WP_139396810.1|872196_873081_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.3	1.1e-80
>prophage 59
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	880553	881345	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_072255020.1|880553_881345_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.5	1.5e-20
>prophage 60
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	885324	886653	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_086557318.1|885324_886653_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.6	1.2e-11
>prophage 61
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	891537	894426	5059877		Escherichia_phage(100.0%)	3	NA	NA
WP_047042763.1|891537_892311_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	52.5	1.9e-65
WP_059476304.1|892531_893800_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	55.1	2.7e-117
WP_047042768.1|893796_894426_+	aldolase	NA	A0A077SK32	Escherichia_phage	62.1	3.3e-68
>prophage 62
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	900580	901951	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_072206453.1|900580_901951_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.7	8.1e-19
>prophage 63
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	905871	906633	5059877		Escherichia_phage(100.0%)	1	NA	NA
WP_015366720.1|905871_906633_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	37.0	2.7e-32
>prophage 64
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	912564	913731	5059877		Klosneuvirus(100.0%)	1	NA	NA
WP_045387766.1|912564_913731_+	glycosyl hydrolase	NA	A0A1V0SK03	Klosneuvirus	23.0	9.4e-08
>prophage 65
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	918590	918974	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_015366733.1|918590_918974_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.4e-08
>prophage 66
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	922152	923256	5059877		uncultured_virus(100.0%)	1	NA	NA
WP_042897583.1|922152_923256_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.4	2.8e-102
>prophage 67
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	928782	954829	5059877		Escherichia_phage(46.15%)	23	NA	NA
WP_151084989.1|928782_929847_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	46.7	1.6e-70
WP_151084991.1|930055_933163_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.3	0.0e+00
WP_015705302.1|933204_934470_+	MFS transporter	NA	NA	NA	NA	NA
WP_032711571.1|934474_935590_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	83.6	8.3e-179
WP_015705301.1|935614_935875_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	83.1	3.9e-31
WP_139397411.1|936225_938265_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.3	3.7e-15
WP_015366753.1|938437_939187_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_015366754.1|939280_939967_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139397409.1|940012_940444_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.9e-21
WP_151084993.1|940693_942157_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.8	1.1e-42
WP_151084995.1|942364_943747_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_015705297.1|943789_944809_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015705296.1|944819_946034_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	9.0e-46
WP_151084997.1|946176_947460_-	MFS transporter	NA	NA	NA	NA	NA
WP_015366762.1|947592_947919_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	4.9e-23
WP_015366763.1|948067_948409_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_015366764.1|948466_949027_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_032714418.1|949020_949731_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_015366766.1|949834_950107_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_108684312.1|950255_952691_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.6e-214
WP_015705293.1|952701_953319_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	1.7e-72
WP_015705292.1|953320_954178_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	32.1	1.2e-20
WP_151084999.1|954220_954829_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.2	4.9e-24
>prophage 68
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	964914	967071	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_049033311.1|964914_967071_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	31.8	2.1e-13
>prophage 69
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	974130	975090	5059877		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|974130_975090_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 70
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	984138	986916	5059877		Lactobacillus_phage(100.0%)	1	NA	NA
WP_126027443.1|984138_986916_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	2.8e-66
>prophage 71
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1005466	1005982	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_015366816.1|1005466_1005982_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	55.4	7.0e-24
>prophage 72
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1017156	1018458	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_151085013.1|1017156_1018458_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	25.2	4.5e-19
>prophage 73
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1029790	1029994	5059877		Salmonella_phage(100.0%)	1	NA	NA
WP_015705242.1|1029790_1029994_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	68.7	1.6e-19
>prophage 74
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1034530	1039029	5059877		Enterobacteria_phage(50.0%)	5	NA	NA
WP_059444060.1|1034530_1034926_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	36.2	1.3e-14
WP_045388336.1|1035161_1036166_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_139397553.1|1036199_1037240_-	oxidoreductase	NA	NA	NA	NA	NA
WP_015366847.1|1037410_1037548_+	division septum protein Blr	NA	NA	NA	NA	NA
WP_116327496.1|1037658_1039029_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	34.3	8.6e-69
>prophage 75
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1050161	1051436	5059877	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_015366861.1|1050161_1051436_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.6	3.2e-86
>prophage 76
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1054767	1056126	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_020078996.1|1054767_1056126_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	2.1e-19
>prophage 77
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1059936	1061425	5059877		Salmonella_phage(50.0%)	2	NA	NA
WP_015366871.1|1059936_1060458_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	1.8e-51
WP_015366872.1|1060528_1061425_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	8.0e-07
>prophage 78
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1067379	1077339	5059877		Bacillus_thuringiensis_phage(20.0%)	10	NA	NA
WP_020079002.1|1067379_1067961_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.2e-42
WP_020079003.1|1068011_1069178_-	MFS transporter	NA	NA	NA	NA	NA
WP_032705726.1|1069337_1069427_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_015366884.1|1069722_1070748_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	3.1e-31
WP_015366885.1|1070767_1071679_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032711519.1|1071791_1072976_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_042892326.1|1073274_1074423_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.9	1.7e-86
WP_047052704.1|1074474_1075110_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.5e-23
WP_015366890.1|1075340_1076714_+	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_015366891.1|1076769_1077339_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	37.0	4.0e-20
>prophage 79
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1103197	1112188	5059877		Escherichia_phage(40.0%)	6	NA	NA
WP_015366914.1|1103197_1104667_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.5	2.1e-25
WP_015366915.1|1104670_1104799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624896.1|1104810_1106958_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.6	5.3e-33
WP_015366918.1|1107410_1107869_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	38.5	3.3e-17
WP_151085023.1|1107912_1111128_-	molybdopterin-dependent oxidoreductase	NA	A0A0P0IVM8	Acinetobacter_phage	25.4	1.0e-11
WP_032711501.1|1111417_1112188_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	1.5e-14
>prophage 80
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1117178	1119124	5059877		Planktothrix_phage(50.0%)	2	NA	NA
WP_063402552.1|1117178_1118159_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.1e-14
WP_015366927.1|1118155_1119124_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	26.4	7.0e-09
>prophage 81
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1130352	1131225	5059877		Lactobacillus_phage(100.0%)	1	NA	NA
WP_015366939.1|1130352_1131225_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	3.3e-05
>prophage 82
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1142420	1143491	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_032707866.1|1142420_1143491_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.4e-26
>prophage 83
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1170675	1172182	5059877		Streptococcus_phage(50.0%)	2	NA	NA
WP_047058175.1|1170675_1171365_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.0	2.8e-12
WP_015705162.1|1171435_1172182_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	30.7	6.6e-07
>prophage 84
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1177670	1178060	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_080945096.1|1177670_1178060_+	helix-turn-helix transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	33.1	1.1e-08
>prophage 85
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1187788	1188610	5059877		Planktothrix_phage(100.0%)	1	NA	NA
WP_015705152.1|1187788_1188610_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	4.3e-15
>prophage 86
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1191631	1192408	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_020079069.1|1191631_1192408_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.3	3.4e-30
>prophage 87
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1205394	1206144	5059877		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_101743791.1|1205394_1206144_+	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	33.6	4.8e-05
>prophage 88
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1216074	1219284	5059877		Tupanvirus(50.0%)	3	NA	NA
WP_047052734.1|1216074_1217295_-	cysteine desulfurase SufS	NA	A0A2K9L2Y3	Tupanvirus	37.3	5.3e-78
WP_139397449.1|1217291_1218563_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_015367012.1|1218537_1219284_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.6	1.5e-06
>prophage 89
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1229869	1237842	5059877		Hokovirus(25.0%)	8	NA	NA
WP_015367026.1|1229869_1232248_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.9	1.6e-171
WP_072201375.1|1232324_1232435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015367027.1|1232578_1233412_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_032709933.1|1233566_1234613_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.9	4.7e-83
WP_015367029.1|1234714_1234963_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_126028787.1|1234991_1236434_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.8	5.9e-60
WP_015367031.1|1236546_1237011_-	endopeptidase	NA	NA	NA	NA	NA
WP_139397445.1|1237092_1237842_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A285PWH2	Cedratvirus	28.6	5.1e-07
>prophage 90
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1244912	1255481	5059877	tRNA,lysis	Tupanvirus(33.33%)	12	NA	NA
WP_015367042.1|1244912_1245212_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_108684348.1|1245216_1247604_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_015367044.1|1247619_1248603_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	3.8e-34
WP_122985265.1|1248614_1248782_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004102963.1|1248909_1249266_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1249316_1249514_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004189469.1|1249604_1250147_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_015367045.1|1250150_1252079_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.2e-129
WP_072255037.1|1252397_1252604_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.6	2.3e-18
WP_045367434.1|1252933_1253359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047739865.1|1253372_1253789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047739866.1|1255256_1255481_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	87.8	4.4e-31
>prophage 91
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1270905	1273803	5059877		Lactobacillus_phage(33.33%)	3	NA	NA
WP_139397435.1|1270905_1271742_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	38.8	8.8e-08
WP_015367066.1|1271788_1272793_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	6.8e-15
WP_015705106.1|1272789_1273803_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.6e-14
>prophage 92
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1282112	1288375	5059877		Citrobacter_phage(33.33%)	7	NA	NA
WP_015705104.1|1282112_1282733_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.7	2.3e-53
WP_004103116.1|1283283_1283691_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_015367076.1|1283816_1284719_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.3	3.1e-59
WP_020079113.1|1284916_1285930_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_015367078.1|1286019_1286919_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_042893958.1|1287029_1287488_+	YchJ family protein	NA	NA	NA	NA	NA
WP_015705100.1|1287532_1288375_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	2.4e-13
>prophage 93
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1291864	1293400	5059877		Escherichia_phage(100.0%)	1	NA	NA
WP_015367085.1|1291864_1293400_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
>prophage 94
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1309850	1310639	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_015367094.1|1309850_1310639_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	4.1e-31
>prophage 95
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1315971	1321679	5059877		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_015367102.1|1315971_1316202_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	4.1e-08
WP_015367104.1|1316467_1317568_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_015367105.1|1317646_1318501_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	1.2e-47
WP_015367106.1|1318540_1319353_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_015367107.1|1319356_1319749_-	SirB family protein	NA	NA	NA	NA	NA
WP_063444536.1|1319745_1320597_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_015367109.1|1320596_1321679_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
>prophage 96
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1324894	1327658	5059877		Tupanvirus(50.0%)	2	NA	NA
WP_015367113.1|1324894_1325842_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
WP_151085046.1|1325966_1327658_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.0	1.2e-24
>prophage 97
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1341836	1345936	5059877		Enterobacteria_phage(50.0%)	5	NA	NA
WP_015705067.1|1341836_1342565_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	43.8	6.0e-45
WP_015367132.1|1342713_1343673_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_015367133.1|1343707_1344055_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_015705066.1|1344188_1344587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015705065.1|1344685_1345936_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	2.3e-20
>prophage 98
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1349170	1350541	5059877		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_015367145.1|1349170_1350541_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	1.9e-108
>prophage 99
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1356460	1366006	5059877		Mycoplasma_phage(25.0%)	9	NA	NA
WP_015705060.1|1356460_1357597_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	41.4	1.0e-30
WP_015705059.1|1357580_1358438_+	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_012968557.1|1358434_1359220_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_015367153.1|1359216_1360263_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_045367205.1|1360342_1361971_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.7	1.4e-30
WP_015367165.1|1362204_1363029_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.6	4.7e-22
WP_015705055.1|1363043_1363955_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_047739883.1|1364060_1365305_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_015367168.1|1365304_1366006_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	4.1e-35
>prophage 100
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1372338	1372596	5059877		Erwinia_phage(100.0%)	1	NA	NA
WP_139396619.1|1372338_1372596_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	6.2e-05
>prophage 101
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1385855	1386497	5059877		Pseudomonas_phage(100.0%)	1	NA	NA
WP_020079143.1|1385855_1386497_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	3.4e-28
>prophage 102
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1389780	1390962	5059877		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|1389780_1390017_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_015367190.1|1390227_1390962_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 103
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1410178	1410424	5059877		Enterobacteria_phage(100.0%)	1	NA	NA
WP_015367207.1|1410178_1410424_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	48.7	3.5e-13
>prophage 104
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1413655	1414576	5059877		Morganella_phage(100.0%)	1	NA	NA
WP_020079153.1|1413655_1414576_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	3.9e-57
>prophage 105
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1422299	1422824	5059877		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_015705022.1|1422299_1422824_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	46.2	1.1e-29
>prophage 106
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1431918	1432983	5059877		Cronobacter_phage(100.0%)	1	NA	NA
WP_071596092.1|1431918_1432983_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	78.1	6.6e-93
>prophage 107
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1450828	1453961	5059877		Enterobacteria_phage(100.0%)	3	NA	NA
WP_020079167.1|1450828_1451323_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	70.8	3.8e-35
WP_032707741.1|1452703_1453630_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015367250.1|1453787_1453961_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	88.9	7.1e-05
>prophage 108
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1460000	1465357	5059877		Ralstonia_phage(66.67%)	3	NA	NA
WP_032710191.1|1460000_1460696_-	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	29.6	7.6e-05
WP_047739889.1|1460705_1462847_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	24.7	2.2e-23
WP_151085060.1|1462846_1465357_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.3	1.1e-16
>prophage 109
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1473409	1474675	5059877		Klosneuvirus(100.0%)	1	NA	NA
WP_032707736.1|1473409_1474675_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.9e-24
>prophage 110
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1515670	1516618	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_139397374.1|1515670_1516618_-	hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	34.7	8.4e-31
>prophage 111
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1527951	1528896	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_020079221.1|1527951_1528896_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	Q9ZXE4	Bacillus_phage	35.6	3.2e-14
>prophage 112
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1541470	1547246	5059877		Bacillus_thuringiensis_phage(50.0%)	5	NA	NA
WP_015367338.1|1541470_1541860_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	1.5e-05
WP_015367339.1|1541931_1542981_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	35.2	7.9e-06
WP_015367340.1|1542980_1543853_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_032714190.1|1543881_1545492_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	6.4e-15
WP_032711322.1|1545575_1547246_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.9	8.4e-10
>prophage 113
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1556409	1557810	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_139397645.1|1556409_1557810_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.5	3.0e-16
>prophage 114
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1566345	1567005	5059877	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_139397570.1|1566345_1567005_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	1.9e-45
>prophage 115
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1570616	1572671	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_047739914.1|1570616_1572671_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.3	3.0e-17
>prophage 116
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1585432	1587340	5059877		Tupanvirus(100.0%)	1	NA	NA
WP_015367439.1|1585432_1587340_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.4	2.5e-50
>prophage 117
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1596104	1604358	5059877	tRNA	Bacillus_virus(20.0%)	6	NA	NA
WP_015704897.1|1596104_1596878_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.5e-30
WP_015704896.1|1596975_1599591_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.5	3.5e-18
WP_100280362.1|1599529_1599715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026612359.1|1599919_1601122_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.4	1.2e-42
WP_015367451.1|1601286_1602687_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.4	8.5e-80
WP_015367453.1|1603278_1604358_+	porin OmpK35	NA	Q1MVN1	Enterobacteria_phage	53.4	1.8e-101
>prophage 118
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1621710	1626253	5059877		Bacillus_phage(100.0%)	3	NA	NA
WP_015367468.1|1621710_1623459_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	1.5e-57
WP_151085088.1|1623504_1625760_-	ComEC family protein	NA	NA	NA	NA	NA
WP_004100704.1|1625965_1626253_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
>prophage 119
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1630449	1631538	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_047076238.1|1630449_1631538_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.2	2.9e-80
>prophage 120
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1635401	1662705	5059877	protease,tRNA	Tetraselmis_virus(15.38%)	20	NA	NA
WP_015367478.1|1635401_1637684_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.1	1.7e-162
WP_015367479.1|1637875_1638616_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.1e-21
WP_015367480.1|1638727_1639876_-	MFS transporter	NA	NA	NA	NA	NA
WP_015367481.1|1640149_1641013_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_015367482.1|1641014_1641632_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	1.7e-72
WP_151085090.1|1641642_1644081_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	1.6e-219
WP_015704878.1|1644275_1645568_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	2.1e-93
WP_015367485.1|1645660_1647004_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	1.5e-81
WP_015367486.1|1647012_1647624_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_151085092.1|1647746_1651814_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.2e-88
WP_000228469.1|1651949_1652444_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_151085094.1|1652976_1653945_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	4.7e-61
WP_151085096.1|1654059_1655826_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	A0A2H4UU96	Bodo_saltans_virus	24.3	1.3e-16
WP_151085098.1|1655826_1657548_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2H4UU96	Bodo_saltans_virus	28.5	9.6e-17
WP_015367492.1|1657590_1658295_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1658654_1658873_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_032714159.1|1658956_1659433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015367493.1|1659531_1661811_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.6e-165
WP_015367494.1|1661841_1662159_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	9.0e-14
WP_015367495.1|1662483_1662705_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	4.6e-17
>prophage 121
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1680067	1680910	5059877		Roseobacter_phage(100.0%)	1	NA	NA
WP_015367510.1|1680067_1680910_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.6	1.4e-05
>prophage 122
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1685050	1685779	5059877		Planktothrix_phage(100.0%)	1	NA	NA
WP_015367515.1|1685050_1685779_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.2e-29
>prophage 123
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1688893	1700498	5059877		Bacillus_phage(33.33%)	14	NA	NA
WP_100279957.1|1688893_1690366_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.5	3.0e-27
WP_015704857.1|1690362_1691079_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	2.7e-37
WP_100279958.1|1691156_1692284_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	23.2	1.8e-19
WP_015704855.1|1692326_1692815_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_071596099.1|1692712_1692967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100279959.1|1692997_1693843_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_015367525.1|1693839_1694793_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_151085102.1|1694803_1695937_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	8.5e-30
WP_032714149.1|1696060_1697173_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_015367528.1|1697503_1697989_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_015367529.1|1698077_1698980_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.3	3.5e-34
WP_015704853.1|1699046_1699769_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_015367531.1|1699752_1700043_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_015367533.1|1700234_1700498_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
>prophage 124
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1710664	1711867	5059877		Stx2-converting_phage(100.0%)	1	NA	NA
WP_032705602.1|1710664_1711867_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.9	6.1e-95
>prophage 125
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1719701	1721555	5059877		Planktothrix_phage(100.0%)	1	NA	NA
WP_151085106.1|1719701_1721555_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.2	4.1e-13
>prophage 126
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1725739	1728172	5059877		Citrobacter_phage(100.0%)	1	NA	NA
WP_020079296.1|1725739_1728172_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
>prophage 127
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1735785	1741708	5059877		Tupanvirus(50.0%)	4	NA	NA
WP_015367567.1|1735785_1737378_-	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	28.8	7.2e-59
WP_047049100.1|1737557_1738340_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_015367569.1|1738538_1739453_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_151085115.1|1740331_1741708_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.4	1.6e-22
>prophage 128
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1746816	1751955	5059877		Escherichia_phage(33.33%)	6	NA	NA
WP_015367577.1|1746816_1747332_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	5.0e-14
WP_015367578.1|1747683_1748571_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_015367579.1|1748809_1749313_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	26.7	4.2e-05
WP_015367580.1|1749704_1750451_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_015367581.1|1750576_1751236_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_015367582.1|1751232_1751955_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	40.6	1.2e-34
>prophage 129
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1756045	1765704	5059877		Erwinia_phage(20.0%)	9	NA	NA
WP_015704817.1|1756045_1756309_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	51.0	5.7e-06
WP_015367587.1|1756428_1756695_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	53.4	1.6e-16
WP_015367588.1|1756979_1757240_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_045360011.1|1757342_1758311_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_015367590.1|1758361_1760506_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.4	2.8e-42
WP_045360014.1|1760702_1762046_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.2	3.4e-46
WP_015704813.1|1762305_1762983_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015704812.1|1762979_1763972_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_020079305.1|1763964_1765704_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	3.3e-17
>prophage 130
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1775377	1776283	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_015704803.1|1775377_1776283_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.0	3.4e-29
>prophage 131
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1786331	1791699	5059877		Klosneuvirus(50.0%)	4	NA	NA
WP_026612368.1|1786331_1787621_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	2.9e-18
WP_015704792.1|1787691_1788168_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_015367620.1|1788681_1790064_-	amino acid permease	NA	NA	NA	NA	NA
WP_015367622.1|1790163_1791699_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	36.9	1.1e-80
>prophage 132
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1800077	1802587	5059877		Morganella_phage(50.0%)	4	NA	NA
WP_032714111.1|1800077_1800611_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	61.4	2.4e-51
WP_015367633.1|1801003_1801216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015367634.1|1801244_1801799_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015704784.1|1801852_1802587_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	3.7e-50
>prophage 133
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1807251	1813760	5059877		Planktothrix_phage(33.33%)	7	NA	NA
WP_151085133.1|1807251_1808310_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.5	8.2e-19
WP_015367643.1|1808312_1809002_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_151085135.1|1808998_1809775_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015367645.1|1809902_1810052_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_015704777.1|1810205_1810994_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_045386620.1|1811061_1812537_+	molybdate ABC transporter ATP-binding protein ModF	NA	M1I1A6	Acanthocystis_turfacea_Chlorella_virus	24.2	3.7e-09
WP_015367648.1|1812743_1813760_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.3	6.1e-80
>prophage 134
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1818124	1821632	5059877		Edwardsiella_phage(33.33%)	4	NA	NA
WP_045380480.1|1818124_1819177_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	2.0e-81
WP_015367654.1|1819491_1819863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139397309.1|1819977_1820916_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	7.3e-27
WP_015367656.1|1820912_1821632_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	1.7e-23
>prophage 135
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1845812	1846604	5059877		Kaumoebavirus(100.0%)	1	NA	NA
WP_020079341.1|1845812_1846604_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	29.3	1.8e-10
>prophage 136
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1852406	1859835	5059877		Acinetobacter_phage(33.33%)	6	NA	NA
WP_015704759.1|1852406_1853885_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.1	5.8e-47
WP_151085143.1|1853888_1855298_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.4	1.0e-56
WP_015367687.1|1855477_1855684_-	DUF2517 family protein	NA	NA	NA	NA	NA
WP_020079348.1|1855997_1856087_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_151085145.1|1856086_1857766_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_015704756.1|1857786_1859835_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	7.1e-27
>prophage 137
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1866300	1880009	5059877	tRNA	Mycobacterium_phage(20.0%)	12	NA	NA
WP_015367695.1|1866300_1867074_+	esterase	NA	W0LK50	Mycobacterium_phage	39.0	1.3e-08
WP_015367696.1|1867207_1867501_+	LexA regulated protein	NA	NA	NA	NA	NA
WP_015367697.1|1867650_1868181_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_015367698.1|1868473_1868926_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_047042273.1|1869039_1869966_+	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
WP_015367700.1|1870062_1871466_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	7.8e-09
WP_015704751.1|1871452_1872592_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_049034978.1|1872646_1873942_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.2	1.5e-59
WP_015367703.1|1873994_1874327_-	lipoprotein	NA	NA	NA	NA	NA
WP_015704749.1|1874374_1875775_-	chitoporin	NA	NA	NA	NA	NA
WP_015704748.1|1876211_1877879_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.0	0.0e+00
WP_015704747.1|1878056_1880009_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	45.9	7.1e-08
>prophage 138
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1884680	1886345	5059877		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_015367711.1|1884680_1886345_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 139
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1890321	1891368	5059877		Pseudomonas_phage(100.0%)	1	NA	NA
WP_015367714.1|1890321_1891368_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	1.9e-47
>prophage 140
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1897353	1905285	5059877	tRNA	Moraxella_phage(50.0%)	5	NA	NA
WP_015367722.1|1897353_1898079_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	2.7e-29
WP_151085149.1|1898460_1900116_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	22.9	2.7e-16
WP_047042284.1|1900154_1901948_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.5	3.5e-30
WP_015704740.1|1901993_1902476_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_072207247.1|1902702_1905285_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.8e-184
>prophage 141
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1912305	1914784	5059877		Synechococcus_phage(50.0%)	2	NA	NA
WP_045411811.1|1912305_1913442_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
WP_015367735.1|1913584_1914784_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.7	1.4e-104
>prophage 142
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1918678	1920206	5059877		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_015704731.1|1918678_1919467_-	deaminated glutathione amidase	NA	M1HHT1	Paramecium_bursaria_Chlorella_virus	23.7	8.3e-08
WP_015704730.1|1919555_1919939_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	1.5e-23
WP_012542460.1|1919996_1920206_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	3.5e-22
>prophage 143
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1924303	1926377	5059877		Morganella_phage(50.0%)	2	NA	NA
WP_015367746.1|1924303_1924732_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	8.7e-20
WP_151085151.1|1924811_1926377_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	4.9e-44
>prophage 144
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1929469	1931304	5059877		Streptococcus_phage(50.0%)	2	NA	NA
WP_015367751.1|1929469_1930693_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.9	8.5e-60
WP_015367752.1|1930677_1931304_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.7	3.7e-51
>prophage 145
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1938915	1940418	5059877		Staphylococcus_phage(100.0%)	1	NA	NA
WP_151085155.1|1938915_1940418_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	1.9e-16
>prophage 146
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1950551	1952684	5059877		Plodia_interpunctella_granulovirus(100.0%)	1	NA	NA
WP_151085161.1|1950551_1952684_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	27.1	2.2e-31
>prophage 147
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1956089	1960853	5059877		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_015367776.1|1956089_1956884_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	25.1	2.9e-08
WP_151085165.1|1956971_1960853_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.3	5.4e-60
>prophage 148
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1971574	1973119	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_047047098.1|1971574_1973119_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	7.3e-16
>prophage 149
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	1979045	1990144	5059877	holin	Vibrio_phage(33.33%)	8	NA	NA
WP_015704693.1|1979045_1981079_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	7.6e-21
WP_045392822.1|1981207_1981801_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_126027574.1|1981812_1983285_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_045411856.1|1983299_1984964_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	3.4e-59
WP_108684481.1|1984960_1985293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045361940.1|1985492_1986608_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_151085167.1|1986656_1987385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087876812.1|1987429_1990144_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.9	2.7e-66
>prophage 150
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2012243	2013359	5059877		Tupanvirus(100.0%)	1	NA	NA
WP_047464949.1|2012243_2013359_-	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.2e-39
>prophage 151
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2037108	2040303	5059877	tRNA	Catovirus(50.0%)	2	NA	NA
WP_015704650.1|2037108_2038626_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	7.2e-85
WP_063443344.1|2038830_2040303_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.6	8.1e-49
>prophage 152
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2047621	2048542	5059877		Morganella_phage(100.0%)	1	NA	NA
WP_015704646.1|2047621_2048542_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	1.2e-55
>prophage 153
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2052020	2062726	5059877		Escherichia_phage(33.33%)	6	NA	NA
WP_151085187.1|2052020_2058791_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.8	1.6e-99
WP_015704641.1|2059230_2060139_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020079428.1|2060177_2060408_+	ANR family transcriptional regulator	NA	S4TT84	Salmonella_phage	42.5	1.0e-06
WP_015704640.1|2060653_2060818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080638346.1|2060906_2061425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020079429.1|2061889_2062726_-	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	37.7	6.3e-14
>prophage 154
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2070861	2073364	5059877	tRNA	Enterococcus_phage(50.0%)	3	NA	NA
WP_015367875.1|2070861_2071728_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.3	5.0e-30
WP_015367876.1|2071729_2071942_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_032707566.1|2071978_2073364_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	4.6e-46
>prophage 155
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2081987	2082674	5059877		Planktothrix_phage(100.0%)	1	NA	NA
WP_015367886.1|2081987_2082674_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-32
>prophage 156
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2085840	2091044	5059877		Organic_Lake_phycodnavirus(50.0%)	5	NA	NA
WP_151085193.1|2085840_2086518_-	iron ABC transporter ATP-binding protein FetA	NA	F2Y165	Organic_Lake_phycodnavirus	28.9	2.1e-15
WP_020079443.1|2086657_2087575_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_015367893.1|2087571_2088030_+	NfeD family protein	NA	NA	NA	NA	NA
WP_015367894.1|2088026_2088437_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_048228458.1|2088542_2091044_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.6	3.2e-114
>prophage 157
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2101033	2102908	5059877		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_151085195.1|2101033_2102908_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	9.2e-114
>prophage 158
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2106015	2106567	5059877		Klosneuvirus(100.0%)	1	NA	NA
WP_015367908.1|2106015_2106567_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
>prophage 159
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2118903	2120358	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_045388538.1|2118903_2120358_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.5	2.9e-14
>prophage 160
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2134134	2137675	5059877		Bacillus_phage(100.0%)	2	NA	NA
WP_032707552.1|2134134_2135913_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	8.9e-42
WP_151085201.1|2135905_2137675_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	2.8e-48
>prophage 161
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2142082	2142793	5059877		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_047081001.1|2142082_2142793_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.5e-88
>prophage 162
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2146221	2151271	5059877	protease	Sodalis_phage(25.0%)	4	NA	NA
WP_002444653.1|2146221_2146494_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
WP_015367948.1|2146700_2149055_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.3	2.1e-224
WP_015704591.1|2149238_2150513_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.6	1.9e-131
WP_003021624.1|2150647_2151271_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 163
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2177733	2183265	5059877		Diadromus_pulchellus_ascovirus(50.0%)	4	NA	NA
WP_042893566.1|2177733_2178489_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	30.3	3.7e-13
WP_047035446.1|2178508_2178877_-	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_045361799.1|2178895_2180542_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_151085212.1|2180604_2183265_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	31.1	1.6e-18
>prophage 164
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2194456	2196117	5059877		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001021161.1|2194456_2194927_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_151085214.1|2195013_2196117_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.9	1.3e-51
>prophage 165
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2202570	2204053	5059877	tRNA	uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_003859109.1|2202570_2202903_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_015368001.1|2202925_2204053_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	1.5e-90
>prophage 166
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2216471	2224989	5059877		Bacillus_phage(60.0%)	6	NA	NA
WP_015704551.1|2216471_2217767_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	5.0e-26
WP_004099401.1|2217788_2218478_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_015704550.1|2218697_2219900_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	24.1	4.3e-08
WP_151085224.1|2219896_2223031_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	1.9e-10
WP_015704548.1|2223080_2223986_-	fructokinase	NA	NA	NA	NA	NA
WP_015368016.1|2224077_2224989_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	4.2e-104
>prophage 167
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2245536	2246304	5059877		Planktothrix_phage(100.0%)	1	NA	NA
WP_015368106.1|2245536_2246304_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.7	3.8e-26
>prophage 168
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2251329	2252148	5059877		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_047042422.1|2251329_2252148_+	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.4	5.0e-16
>prophage 169
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2264566	2265409	5059877		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_151085237.1|2264566_2265409_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	2.4e-13
>prophage 170
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2270934	2277746	5059877		Erwinia_phage(50.0%)	7	NA	NA
WP_026612390.1|2270934_2271501_+	hypothetical protein	NA	S5MM68	Bacillus_phage	38.9	2.2e-10
WP_045366670.1|2271564_2272617_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-113
WP_015368077.1|2272906_2274010_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.7	9.7e-63
WP_047076161.1|2275613_2275928_+	DUF1493 family protein	NA	A0A218M4K1	Erwinia_phage	66.7	1.6e-31
WP_020079535.1|2276036_2276675_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_151085241.1|2276955_2277402_+	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	35.9	5.9e-19
WP_047740029.1|2277395_2277746_+	DUF1493 family protein	NA	A0A218M4K1	Erwinia_phage	43.5	2.7e-11
>prophage 171
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2290207	2291491	5059877		Klosneuvirus(100.0%)	1	NA	NA
WP_015368062.1|2290207_2291491_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.2	2.3e-31
>prophage 172
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2327206	2327788	5059877		Caulobacter_phage(100.0%)	1	NA	NA
WP_004099149.1|2327206_2327788_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	1.1e-12
>prophage 173
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2333289	2337500	5059877		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_020079566.1|2333289_2334030_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.5e-38
WP_015368126.1|2334085_2334553_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	57.4	5.2e-50
WP_032707485.1|2334549_2335272_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_151085253.1|2335305_2336061_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_047740032.1|2336132_2337500_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	28.6	6.9e-10
>prophage 174
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2341558	2342362	5059877		Indivirus(100.0%)	1	NA	NA
WP_042895734.1|2341558_2342362_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	9.9e-41
>prophage 175
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2348956	2349988	5059877		Planktothrix_phage(100.0%)	1	NA	NA
WP_015368136.1|2348956_2349988_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.4	8.8e-34
>prophage 176
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2363971	2368071	5059877		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_015704450.1|2363971_2367454_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	7.4e-210
WP_015368153.1|2367471_2368071_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	5.5e-28
>prophage 177
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2376893	2377655	5059877		Flavobacterium_phage(100.0%)	1	NA	NA
WP_015368162.1|2376893_2377655_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	1.2e-24
>prophage 178
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2388002	2393794	5059877	protease	Lymantria_dispar_multicapsid_nuclear_polyhedrosis_virus(50.0%)	3	NA	NA
WP_151085258.1|2388002_2390990_+	viral enhancin protein	NA	A0A140IKX2	Lymantria_dispar_multicapsid_nuclear_polyhedrosis_virus	23.9	4.5e-38
WP_015368175.1|2391026_2392184_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032706960.1|2392360_2393794_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	2.1e-25
>prophage 179
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2397764	2398109	5059877		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_015368181.1|2397764_2398109_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	54.1	4.1e-28
>prophage 180
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2404073	2404871	5059877		Planktothrix_phage(100.0%)	1	NA	NA
WP_020079587.1|2404073_2404871_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	1.2e-14
>prophage 181
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2410307	2412737	5059877		Niemeyer_virus(100.0%)	1	NA	NA
WP_048230633.1|2410307_2412737_-	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	32.8	1.1e-39
>prophage 182
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2422527	2429084	5059877		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_015368204.1|2422527_2423454_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.9	8.2e-23
WP_015368205.1|2423560_2424223_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_015368206.1|2424280_2424817_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
WP_046883564.1|2425019_2427410_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_139397421.1|2427488_2429084_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	62.6	9.2e-22
>prophage 183
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2439866	2441291	5059877		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_015368220.1|2439866_2441291_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	1.6e-41
>prophage 184
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2452564	2453128	5059877		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_151085266.1|2452564_2453128_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	34.6	4.2e-14
>prophage 185
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2457392	2458436	5059877		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_015368234.1|2457392_2458436_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	1.2e-102
>prophage 186
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2484655	2486380	5059877		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_032706640.1|2484655_2486380_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.5	1.2e-35
>prophage 187
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2497736	2498492	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_046883551.1|2497736_2498492_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.2	7.1e-25
>prophage 188
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2507091	2507793	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_032716012.1|2507091_2507793_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	1.2e-21
>prophage 189
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2514444	2519840	5059877		Heterocapsa_circularisquama_DNA_virus(50.0%)	2	NA	NA
WP_151085274.1|2514444_2516802_+	DNA polymerase II	NA	D0FZR7	Heterocapsa_circularisquama_DNA_virus	37.1	1.0e-05
WP_015704377.1|2516933_2519840_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
>prophage 190
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2532375	2534336	5059877		Enterococcus_phage(50.0%)	2	NA	NA
WP_015368293.1|2532375_2533224_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	50.7	6.8e-08
WP_015368294.1|2533856_2534336_-	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	41.5	2.3e-29
>prophage 191
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2543801	2544950	5059877		Halovirus(100.0%)	1	NA	NA
WP_015704367.1|2543801_2544950_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	5.4e-48
>prophage 192
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2570900	2577490	5059877	tRNA	Tupanvirus(50.0%)	5	NA	NA
WP_015368328.1|2570900_2573717_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.4	3.5e-77
WP_015704352.1|2573762_2574701_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_151085286.1|2575031_2575295_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_015368331.1|2575367_2576267_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_151085288.1|2576317_2577490_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.6	3.2e-88
>prophage 193
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2590016	2598307	5059877		Dasychira_pudibunda_nucleopolyhedrovirus(25.0%)	7	NA	NA
WP_042892469.1|2590016_2592131_-	chitinase	NA	A0A0N7D5A5	Dasychira_pudibunda_nucleopolyhedrovirus	29.2	3.1e-33
WP_015368346.1|2592522_2592966_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015368347.1|2592981_2593515_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	6.1e-55
WP_046883353.1|2593575_2593920_-	phage protein	NA	NA	NA	NA	NA
WP_100279214.1|2594046_2594991_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020079653.1|2595160_2596303_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.7	1.2e-28
WP_020079654.1|2596390_2598307_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	8.4e-147
>prophage 194
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2601474	2602428	5059877		Synechococcus_phage(100.0%)	1	NA	NA
WP_015368356.1|2601474_2602428_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	35.2	1.3e-10
>prophage 195
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2613517	2614942	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_042892496.1|2613517_2614942_-	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	31.2	5.3e-21
>prophage 196
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2618868	2624023	5059877		Bacillus_phage(33.33%)	3	NA	NA
WP_042892506.1|2618868_2620806_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	3.6e-12
WP_015704325.1|2621025_2622693_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	3.2e-41
WP_020079664.1|2622790_2624023_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	8.2e-87
>prophage 197
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2630496	2631819	5059877		Geobacillus_virus(100.0%)	1	NA	NA
WP_015368380.1|2630496_2631819_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	8.8e-79
>prophage 198
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2635127	2637831	5059877		Salmonella_phage(50.0%)	3	NA	NA
WP_015368384.1|2635127_2635289_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	5.0e-13
WP_020079668.1|2635412_2636024_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_015704321.1|2636241_2637831_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.2	1.8e-30
>prophage 199
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2651019	2652298	5059877		Salmonella_phage(50.0%)	2	NA	NA
WP_015368405.1|2651019_2651559_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	60.6	5.4e-27
WP_141146357.1|2651602_2652298_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	54.0	1.4e-62
>prophage 200
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2688806	2696843	5059877		Moraxella_phage(100.0%)	1	NA	NA
WP_151085309.1|2688806_2696843_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	39.4	2.6e-48
>prophage 201
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2724800	2725385	5059877		Moraxella_phage(100.0%)	1	NA	NA
WP_015704263.1|2724800_2725385_+	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	2.4e-12
>prophage 202
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2731177	2734564	5059877	holin	Serratia_phage(100.0%)	1	NA	NA
WP_151085311.1|2731177_2734564_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 203
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2739352	2744938	5059877		Bacillus_phage(50.0%)	3	NA	NA
WP_045365284.1|2739352_2740747_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	3.4e-20
WP_026612414.1|2741117_2742182_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_151085315.1|2742178_2744938_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.6e-21
>prophage 204
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2754470	2756586	5059877		Hokovirus(50.0%)	2	NA	NA
WP_045386894.1|2754470_2755913_-	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.4	7.0e-13
WP_117110734.1|2755902_2756586_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.5	2.7e-31
>prophage 205
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2759825	2762975	5059877		Leptospira_phage(100.0%)	1	NA	NA
WP_045360199.1|2759825_2762975_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	7.5e-60
>prophage 206
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2767280	2772269	5059877		Enterobacteria_phage(50.0%)	6	NA	NA
WP_151085319.1|2767280_2769056_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.9	1.1e-12
WP_151085321.1|2769681_2770515_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_009309816.1|2770630_2770972_-	toxin	NA	NA	NA	NA	NA
WP_009309815.1|2770995_2771322_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_151085323.1|2771335_2771812_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_151085325.1|2771822_2772269_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	32.3	1.7e-10
>prophage 207
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2778595	2790159	5059877		Plesiomonas_phage(25.0%)	7	NA	NA
WP_151085337.1|2778595_2780302_+	type I restriction-modification system subunit M	NA	A0A2I6PG28	Plesiomonas_phage	25.6	9.2e-12
WP_151085339.1|2780291_2781701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103060615.1|2781693_2782890_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_151085341.1|2782905_2786040_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.5	8.5e-80
WP_151085343.1|2786078_2787155_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_151085345.1|2787802_2788678_-	HNH endonuclease	NA	A0A2P0QEG9	Haloarcula_hispanica_pleomorphic_virus	34.4	1.5e-13
WP_151085347.1|2788893_2790159_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.8	5.3e-81
>prophage 208
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2793227	2798053	5059877		Tupanvirus(50.0%)	5	NA	NA
WP_032709732.1|2793227_2794247_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	7.9e-43
WP_015368525.1|2794389_2795262_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_046654732.1|2795251_2796139_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_046883295.1|2796149_2796974_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_047464514.1|2796979_2798053_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	2.1e-22
>prophage 209
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2813075	2822221	5059877	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_042894220.1|2813075_2814578_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	5.7e-82
WP_015368543.1|2814719_2815802_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_020079782.1|2815801_2816899_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_139397283.1|2817289_2818801_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	4.1e-48
WP_020079783.1|2818922_2819366_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_015368547.1|2819365_2822221_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.9	9.3e-142
>prophage 210
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2826322	2827258	5059877		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_015704213.1|2826322_2827258_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	3.8e-52
>prophage 211
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2830802	2834840	5059877		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_046883304.1|2830802_2833511_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.4	5.9e-45
WP_015704209.1|2833892_2834840_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.3	1.8e-12
>prophage 212
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2845047	2845512	5059877		Cronobacter_phage(100.0%)	1	NA	NA
WP_015368567.1|2845047_2845512_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.3	3.2e-52
>prophage 213
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2859602	2866162	5059877		Klosneuvirus(33.33%)	6	NA	NA
WP_015368583.1|2859602_2860601_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	7.4e-70
WP_045386756.1|2860643_2861642_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_071993155.1|2861628_2862654_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015704196.1|2862664_2864167_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	9.9e-10
WP_020079801.1|2864270_2865227_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015368588.1|2865631_2866162_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.2e-56
>prophage 214
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2903122	2907539	5059877		Lactococcus_phage(50.0%)	3	NA	NA
WP_045396877.1|2903122_2905564_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.0	1.3e-67
WP_015368627.1|2905655_2906090_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002885665.1|2906240_2907539_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
>prophage 215
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2913066	2916295	5059877		Wolbachia_phage(50.0%)	2	NA	NA
WP_047058385.1|2913066_2914932_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	2.2e-59
WP_015704167.1|2914942_2916295_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.5e-17
>prophage 216
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2921135	2921681	5059877		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_015704162.1|2921135_2921681_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	3.4e-29
>prophage 217
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2929049	2934242	5059877		Tupanvirus(33.33%)	6	NA	NA
WP_015368646.1|2929049_2930027_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.0	2.0e-27
WP_058675922.1|2930304_2932095_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	26.5	1.4e-15
WP_058675923.1|2932087_2932822_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_045396402.1|2932832_2933228_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_015368650.1|2933238_2933598_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_015368651.1|2933711_2934242_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	49.3	5.9e-42
>prophage 218
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2944856	2950361	5059877		Bacillus_phage(33.33%)	5	NA	NA
WP_020079833.1|2944856_2946980_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.2	1.7e-31
WP_139396962.1|2946990_2947860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015368664.1|2947902_2948256_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_015368665.1|2948383_2950030_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	2.6e-189
WP_003855929.1|2950067_2950361_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
>prophage 219
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2968678	2974995	5059877		Escherichia_phage(40.0%)	9	NA	NA
WP_015368679.1|2968678_2970010_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	B9UDL7	Salmonella_phage	35.9	7.7e-06
WP_015704090.1|2970006_2970441_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_059476360.1|2970497_2971289_-	DsbA family protein	NA	NA	NA	NA	NA
WP_048229762.1|2971508_2972192_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	40.4	1.1e-32
WP_075206095.1|2972192_2972318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015368684.1|2972333_2973251_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	43.8	2.1e-07
WP_015368685.1|2973250_2973556_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_032713469.1|2973657_2974029_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	52.0	1.1e-21
WP_015368687.1|2974038_2974995_-	plasmid stability protein StbA	NA	A0A222YXF2	Escherichia_phage	78.9	5.1e-145
>prophage 220
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2979358	2980861	5059877		Burkholderia_virus(100.0%)	1	NA	NA
WP_015704083.1|2979358_2980861_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	2.8e-57
>prophage 221
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2986268	2987822	5059877		Bacillus_virus(50.0%)	2	NA	NA
WP_015368700.1|2986268_2987027_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	25.3	8.2e-13
WP_015704077.1|2987135_2987822_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
>prophage 222
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2993213	2994734	5059877		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_047740158.1|2993213_2994734_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.3	6.5e-09
>prophage 223
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	2997740	2999888	5059877		Escherichia_phage(100.0%)	1	NA	NA
WP_108683964.1|2997740_2999888_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.4	3.5e-32
>prophage 224
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3002982	3004941	5059877		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032709622.1|3002982_3004941_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.0	6.7e-91
>prophage 225
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3017398	3018748	5059877		Moraxella_phage(100.0%)	1	NA	NA
WP_015704058.1|3017398_3018748_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	7.5e-158
>prophage 226
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3024235	3029500	5059877		Bacillus_phage(33.33%)	3	NA	NA
WP_042894964.1|3024235_3025816_+	lytic transglycosylase F	NA	A0A1P8CWQ1	Bacillus_phage	40.2	4.0e-09
WP_015368746.1|3025895_3026420_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.3e-54
WP_015368747.1|3026674_3029500_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.5	0.0e+00
>prophage 227
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3033623	3036149	5059877		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_047041957.1|3033623_3034703_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	1.3e-27
WP_015368755.1|3034733_3036149_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
>prophage 228
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3041856	3042465	5059877		Lactococcus_phage(100.0%)	1	NA	NA
WP_015704040.1|3041856_3042465_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	6.0e-14
>prophage 229
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3049572	3050682	5059877		Mycoplasma_phage(100.0%)	1	NA	NA
WP_015368770.1|3049572_3050682_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 230
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3063057	3065079	5059877		Pseudomonas_phage(50.0%)	2	NA	NA
WP_142430577.1|3063057_3063846_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.4	1.2e-46
WP_151085372.1|3063852_3065079_-	RtcB family protein	NA	K4K356	Caulobacter_virus	63.0	1.0e-137
>prophage 231
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3073538	3077222	5059877		Dickeya_phage(100.0%)	1	NA	NA
WP_151085377.1|3073538_3077222_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	91.8	1.7e-26
>prophage 232
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3090829	3092419	5059877		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_045367993.1|3090829_3092419_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	1.4e-70
>prophage 233
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3097829	3099593	5059877		Bacillus_phage(50.0%)	3	NA	NA
WP_002884342.1|3097829_3098102_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
WP_015704016.1|3098288_3098879_-	YjaG family protein	NA	NA	NA	NA	NA
WP_026612433.1|3098921_3099593_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.2	6.1e-20
>prophage 234
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3108205	3120584	5059877		Bacillus_phage(33.33%)	6	NA	NA
WP_139397316.1|3108205_3109675_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.5	2.3e-11
WP_015704006.1|3109850_3110156_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_015704005.1|3110159_3110477_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_015368823.1|3110519_3111860_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_015368824.1|3112255_3116479_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	2.9e-67
WP_015704004.1|3116555_3120584_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
>prophage 235
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3124585	3127708	5059877		Tupanvirus(50.0%)	2	NA	NA
WP_015368828.1|3124585_3125770_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.0e-13
WP_015368830.1|3126757_3127708_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.0e-28
>prophage 236
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3136332	3138180	5059877		Acinetobacter_phage(100.0%)	1	NA	NA
WP_015368904.1|3136332_3138180_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.2	4.2e-10
>prophage 237
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3152805	3153468	5059877		Cyanophage(100.0%)	1	NA	NA
WP_015368918.1|3152805_3153468_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	6.0e-28
>prophage 238
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3166737	3168072	5059877		Erwinia_phage(100.0%)	1	NA	NA
WP_015368931.1|3166737_3168072_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.9	2.1e-43
>prophage 239
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3172586	3176085	5059877		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_015368937.1|3172586_3173285_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_015368938.1|3173281_3174655_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_015368939.1|3174717_3175392_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_015368940.1|3175464_3176085_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.4	1.2e-62
>prophage 240
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3197558	3198476	5059877		Tupanvirus(100.0%)	1	NA	NA
WP_015703935.1|3197558_3198476_+	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	53.8	1.4e-06
>prophage 241
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3208578	3211046	5059877		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_015368972.1|3208578_3209628_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	4.5e-09
WP_045362484.1|3209636_3211046_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	29.1	3.7e-06
>prophage 242
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3229589	3230204	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_015704001.1|3229589_3230204_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.3	1.4e-18
>prophage 243
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3240620	3245151	5059877		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_015368845.1|3240620_3242261_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.8	3.8e-39
WP_015368846.1|3242257_3242863_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_015368847.1|3242876_3243632_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_116326782.1|3243702_3245151_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	56.4	6.8e-08
>prophage 244
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3254923	3256750	5059877		Catovirus(100.0%)	1	NA	NA
WP_015368858.1|3254923_3256750_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	1.6e-83
>prophage 245
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3260644	3264489	5059877		Bacillus_phage(50.0%)	3	NA	NA
WP_015368861.1|3260644_3262807_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	2.7e-117
WP_015368862.1|3262870_3263587_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_042894680.1|3263586_3264489_-	tyrosine recombinase XerC	NA	A0A2L1IV36	Escherichia_phage	31.7	6.1e-15
>prophage 246
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3281398	3287539	5059877		uncultured_marine_virus(20.0%)	6	NA	NA
WP_015368878.1|3281398_3282529_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	39.4	2.8e-17
WP_042894670.1|3282533_3283208_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_015368880.1|3283185_3284067_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.1	2.4e-109
WP_015368881.1|3284085_3285153_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	7.3e-100
WP_015368882.1|3285149_3286412_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	26.6	3.8e-23
WP_015703970.1|3286408_3287539_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	34.0	6.3e-25
>prophage 247
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3291590	3293529	5059877		Indivirus(50.0%)	2	NA	NA
WP_002883224.1|3291590_3291920_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
WP_015368886.1|3292263_3293529_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	2.4e-41
>prophage 248
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3297979	3300001	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_015368891.1|3297979_3300001_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	8.4e-113
>prophage 249
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3308108	3309755	5059877		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_015368898.1|3308108_3309755_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.4	3.7e-66
>prophage 250
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3323331	3329211	5059877		Enterobacteria_phage(33.33%)	5	NA	NA
WP_015368990.1|3323331_3324222_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.1	9.7e-05
WP_015368991.1|3324249_3325215_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_015368992.1|3325220_3326726_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.7	6.2e-20
WP_015368993.1|3326736_3327156_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_015368994.1|3327342_3329211_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	9.9e-68
>prophage 251
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3332376	3333369	5059877		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_015368997.1|3332376_3333369_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	1.6e-48
>prophage 252
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3345730	3349116	5059877		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_015369010.1|3345730_3347101_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
WP_015703916.1|3347286_3349116_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.1	6.6e-125
>prophage 253
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3352297	3356133	5059877		Cyanophage(50.0%)	4	NA	NA
WP_032712997.1|3352297_3353338_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	36.3	5.7e-49
WP_015703914.1|3353463_3354423_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_015369014.1|3354422_3355313_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_015369015.1|3355359_3356133_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.7	1.3e-13
>prophage 254
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3361901	3363239	5059877		Moraxella_phage(100.0%)	1	NA	NA
WP_015369021.1|3361901_3363239_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.4e-63
>prophage 255
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3370246	3370504	5059877		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015703903.1|3370246_3370504_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	5.4e-17
>prophage 256
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3375357	3377772	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_015703899.1|3375357_3377772_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	2.4e-114
>prophage 257
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3383646	3384795	5059877		Oenococcus_phage(100.0%)	1	NA	NA
WP_045367068.1|3383646_3384795_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	3.6e-52
>prophage 258
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3388217	3389176	5059877		Synechococcus_phage(100.0%)	2	NA	NA
WP_015703892.1|3388217_3388631_+	heat shock chaperone IbpA	NA	M1UG22	Synechococcus_phage	38.3	4.6e-18
WP_015369047.1|3388747_3389176_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.5e-14
>prophage 259
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3400060	3405417	5059877		Salmonella_phage(50.0%)	6	NA	NA
WP_015369059.1|3400060_3401245_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.5	3.4e-13
WP_020077634.1|3401420_3402254_-	EamA family transporter	NA	NA	NA	NA	NA
WP_015369061.1|3402321_3402768_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002923292.1|3402857_3402947_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_016162016.1|3403528_3403624_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_151085388.1|3403728_3405417_+	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	32.0	5.8e-59
>prophage 260
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3416814	3417927	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_015369074.1|3416814_3417927_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.5e-26
>prophage 261
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3444282	3445332	5059877		Tupanvirus(100.0%)	1	NA	NA
WP_151085396.1|3444282_3445332_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.7	4.9e-72
>prophage 262
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3448615	3449653	5059877		Wolbachia_phage(100.0%)	1	NA	NA
WP_032715332.1|3448615_3449653_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.8	6.5e-69
>prophage 263
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3461153	3462545	5059877		environmental_Halophage(100.0%)	1	NA	NA
WP_015369129.1|3461153_3462545_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	94.5	3.1e-66
>prophage 264
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3465685	3466534	5059877		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_015369132.1|3465685_3466534_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.8	1.7e-14
>prophage 265
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3477635	3482664	5059877		Bordetella_phage(33.33%)	4	NA	NA
WP_117026061.1|3477635_3479756_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3479774_3480050_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_151085404.1|3480104_3480728_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	33.9	6.3e-19
WP_020077679.1|3480984_3482664_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.6	1.9e-22
>prophage 266
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3488550	3493231	5059877		Xanthomonas_phage(25.0%)	7	NA	NA
WP_015703810.1|3488550_3489006_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	2.1e-48
WP_026612194.1|3488986_3490198_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.0	6.9e-46
WP_015369154.1|3490375_3491041_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002436699.1|3491258_3491495_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922510.1|3491515_3491683_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_015369156.1|3491863_3492673_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.1	1.0e-24
WP_015703808.1|3492751_3493231_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
>prophage 267
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3498031	3499015	5059877		Catovirus(100.0%)	1	NA	NA
WP_015369162.1|3498031_3499015_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.8	7.6e-11
>prophage 268
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3507248	3509480	5059877		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_015703795.1|3507248_3508442_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.2e-37
WP_015369171.1|3508454_3509480_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
>prophage 269
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3515907	3516159	5059877		Rhizobium_phage(100.0%)	1	NA	NA
WP_015369179.1|3515907_3516159_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
>prophage 270
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3532062	3533922	5059877		Tupanvirus(100.0%)	1	NA	NA
WP_139397322.1|3532062_3533922_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.5	6.9e-13
>prophage 271
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3543045	3544587	5059877		Staphylococcus_phage(100.0%)	1	NA	NA
WP_020077705.1|3543045_3544587_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.0e-17
>prophage 272
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3549544	3550540	5059877		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_020077708.1|3549544_3550540_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.2	3.5e-11
>prophage 273
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3554386	3556315	5059877		Hokovirus(50.0%)	2	NA	NA
WP_063443088.1|3554386_3556006_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	23.3	3.0e-12
WP_000014594.1|3556102_3556315_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 274
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3565812	3568143	5059877		Escherichia_phage(100.0%)	1	NA	NA
WP_047054630.1|3565812_3568143_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.7	3.8e-69
>prophage 275
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3578088	3580082	5059877		Planktothrix_phage(50.0%)	2	NA	NA
WP_015703765.1|3578088_3579072_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	3.0e-15
WP_015369233.1|3579068_3580082_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
>prophage 276
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3622391	3624434	5059877		Indivirus(100.0%)	1	NA	NA
WP_015369266.1|3622391_3624434_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.7	4.9e-44
>prophage 277
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3633011	3633803	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_046883641.1|3633011_3633803_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.3	2.9e-16
>prophage 278
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3639880	3643987	5059877		Tupanvirus(66.67%)	3	NA	NA
WP_020077748.1|3639880_3641020_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.3	6.5e-30
WP_047064481.1|3641021_3642005_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.0	2.8e-37
WP_015369285.1|3642001_3643987_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	3.3e-21
>prophage 279
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3663505	3667693	5059877		Dickeya_phage(50.0%)	4	NA	NA
WP_015703712.1|3663505_3664171_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	6.2e-57
WP_015703711.1|3664378_3664624_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	3.9e-09
WP_048231408.1|3664780_3666988_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.1	9.4e-118
WP_015369312.1|3667066_3667693_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	2.5e-31
>prophage 280
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3670805	3673632	5059877		Staphylococcus_phage(50.0%)	3	NA	NA
WP_015369317.1|3670805_3671474_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	2.5e-13
WP_015369318.1|3671466_3672522_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920815.1|3672777_3673632_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
>prophage 281
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3679653	3681902	5059877		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_015369325.1|3679653_3680421_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.0	2.2e-13
WP_086538103.1|3680438_3681152_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.9	1.1e-11
WP_004174006.1|3681315_3681537_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002920800.1|3681533_3681902_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
>prophage 282
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3685347	3687155	5059877		Planktothrix_phage(50.0%)	2	NA	NA
WP_048231406.1|3685347_3686418_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
WP_048231405.1|3686414_3687155_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.7	1.7e-10
>prophage 283
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3705394	3707842	5059877		Dickeya_phage(100.0%)	1	NA	NA
WP_015369347.1|3705394_3707842_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 284
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3710884	3711643	5059877		Escherichia_phage(100.0%)	1	NA	NA
WP_046883666.1|3710884_3711643_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.0	1.8e-23
>prophage 285
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3714976	3717367	5059877		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_151085423.1|3714976_3717367_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	2.1e-14
>prophage 286
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3737463	3741210	5059877		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3737463_3738183_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_015369373.1|3738179_3739541_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.3	5.6e-12
WP_045375850.1|3739590_3741210_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.7	6.9e-142
>prophage 287
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3756709	3757537	5059877		Vibrio_phage(100.0%)	1	NA	NA
WP_015369388.1|3756709_3757537_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.4	7.2e-71
>prophage 288
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3768902	3781800	5059877		Salmonella_phage(28.57%)	11	NA	NA
WP_015369400.1|3768902_3769466_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	9.9e-56
WP_015369401.1|3769555_3770776_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_046883947.1|3770765_3772844_-	membrane protein	NA	H9YQA8	environmental_Halophage	87.7	2.2e-63
WP_015703648.1|3773830_3774235_+	OsmC family protein	NA	NA	NA	NA	NA
WP_015369404.1|3774297_3775167_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_015369405.1|3775239_3775458_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	8.9e-05
WP_015703647.1|3775454_3776477_-	hydrolase	NA	NA	NA	NA	NA
WP_108684469.1|3776557_3777277_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	28.8	3.0e-20
WP_139397217.1|3777474_3778344_+	ribose-phosphate diphosphokinase	NA	A0A2P1CBA5	Salmonella_phage	39.4	1.9e-45
WP_139397215.1|3778348_3779839_+	nicotinate phosphoribosyltransferase	NA	K4I4P8	Salmonella_phage	49.6	1.6e-140
WP_151085437.1|3779895_3781800_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	4.2e-74
>prophage 289
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3789634	3791749	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_015369417.1|3789634_3791749_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	2.3e-57
>prophage 290
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3812893	3814365	5059877	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_015703637.1|3812893_3813841_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	6.5e-07
WP_015703636.1|3813855_3814365_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.5	2.0e-18
>prophage 291
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3842704	3843748	5059877		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|3842704_3843748_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 292
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3861905	3863174	5059877		Oenococcus_phage(100.0%)	1	NA	NA
WP_042895784.1|3861905_3863174_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	32.8	5.3e-57
>prophage 293
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3870796	3872164	5059877	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_042897946.1|3870796_3872164_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.2	4.3e-20
>prophage 294
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3876092	3876590	5059877	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_015369484.1|3876092_3876590_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	6.6e-27
>prophage 295
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3884314	3897187	5059877		Hokovirus(16.67%)	15	NA	NA
WP_032712588.1|3884314_3886651_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.4	9.9e-41
WP_020077831.1|3886885_3887539_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_015369490.1|3887535_3888261_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002918431.1|3888283_3888556_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_015369491.1|3888552_3889407_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_015369492.1|3889452_3889941_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004125711.1|3889999_3890287_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_032715896.1|3890309_3891743_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004206203.1|3891790_3892516_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_015369494.1|3892522_3893068_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_015369495.1|3893036_3893612_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_015369496.1|3893608_3894175_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.1	3.1e-57
WP_015369497.1|3894189_3895176_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	1.8e-39
WP_015369498.1|3895190_3896168_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_015369499.1|3896374_3897187_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.9	4.8e-19
>prophage 296
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3901244	3902685	5059877		Vibrio_phage(50.0%)	2	NA	NA
WP_015703605.1|3901244_3901517_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	66.7	8.3e-16
WP_015369507.1|3901713_3902685_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	5.4e-09
>prophage 297
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3909280	3912418	5059877	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_015369514.1|3909280_3911215_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	5.4e-117
WP_151085452.1|3911569_3912418_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.9	1.0e-19
>prophage 298
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3916509	3923125	5059877		Dickeya_phage(50.0%)	4	NA	NA
WP_015369521.1|3916509_3917853_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.1	1.2e-62
WP_151085454.1|3918442_3918895_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_015369524.1|3918922_3920410_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_015369525.1|3920434_3923125_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.0e-25
>prophage 299
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3928538	3930473	5059877		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_015369531.1|3928538_3930473_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 300
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3935621	3945953	5059877		Bacillus_phage(16.67%)	14	NA	NA
WP_015703593.1|3935621_3936125_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	33.3	2.6e-15
WP_015369538.1|3936111_3936396_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	51.3	6.8e-13
WP_151085458.1|3936451_3936895_+	YhbP family protein	NA	NA	NA	NA	NA
WP_151085460.1|3936874_3937393_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	26.4	9.0e-11
WP_042897920.1|3937521_3938169_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_045389116.1|3938241_3939285_+	permease	NA	NA	NA	NA	NA
WP_080752566.1|3939331_3939526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015369543.1|3939552_3940128_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_015369544.1|3940137_3940728_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_015369545.1|3940753_3941140_-	YraN family protein	NA	NA	NA	NA	NA
WP_047740276.1|3941097_3943203_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_004144878.1|3943266_3944130_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
WP_047740277.1|3944133_3945135_+	Fic family protein	NA	NA	NA	NA	NA
WP_047740278.1|3945179_3945953_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	2.4e-23
>prophage 301
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3960789	3961935	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_042897903.1|3960789_3961935_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.7	4.8e-49
>prophage 302
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3978182	3979151	5059877		Enterobacteria_phage(100.0%)	1	NA	NA
WP_020077873.1|3978182_3979151_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.6	9.8e-35
>prophage 303
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	3987469	3988957	5059877		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_151085584.1|3987469_3988957_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	28.2	3.7e-09
>prophage 304
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4000301	4006734	5059877	tRNA	Herpes_simplex_virus(50.0%)	4	NA	NA
WP_151085466.1|4000301_4003394_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	1.0e-157
WP_020077884.1|4003788_4004772_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_020077885.1|4004979_4005312_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_020077886.1|4005354_4006734_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.0	5.8e-33
>prophage 305
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4018409	4020098	5059877		Tetraselmis_virus(100.0%)	1	NA	NA
WP_015369607.1|4018409_4020098_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	32.9	2.2e-58
>prophage 306
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4029778	4031347	5059877		Tetraselmis_virus(100.0%)	1	NA	NA
WP_015369617.1|4029778_4031347_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.1	1.0e-134
>prophage 307
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4036816	4044242	5059877	tRNA,transposase	Bacillus_phage(25.0%)	6	NA	NA
WP_139397514.1|4036816_4037948_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	24.1	7.0e-08
WP_020077903.1|4038280_4038787_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_015369628.1|4038856_4040701_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_015703524.1|4040851_4042597_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	1.9e-76
WP_001144069.1|4042774_4042990_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015369630.1|4043228_4044242_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
>prophage 308
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4048118	4049360	5059877		Escherichia_phage(100.0%)	1	NA	NA
WP_015703520.1|4048118_4049360_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	44.9	2.0e-85
>prophage 309
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4054467	4066768	5059877		uncultured_Mediterranean_phage(16.67%)	13	NA	NA
WP_015369639.1|4054467_4055901_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
WP_015369641.1|4056119_4056317_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_015369643.1|4056351_4056621_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_015703517.1|4057005_4057659_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.8e-45
WP_015369645.1|4057864_4058659_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_015369646.1|4058707_4059868_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.4	9.8e-90
WP_015369647.1|4059873_4060545_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	47.3	1.2e-39
WP_015369648.1|4060711_4062166_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_015369649.1|4062361_4062991_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	35.7	2.0e-20
WP_015369650.1|4062992_4063415_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_045392177.1|4063439_4064267_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_045392174.1|4064266_4064842_+	esterase YqiA	NA	NA	NA	NA	NA
WP_015369653.1|4064872_4066768_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	2.5e-90
>prophage 310
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4070031	4079935	5059877		Stx_converting_phage(25.0%)	8	NA	NA
WP_015369658.1|4070031_4070427_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	40.9	3.7e-17
WP_151085480.1|4070504_4071374_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_151085482.1|4071495_4073754_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	6.3e-85
WP_015369660.1|4073940_4074678_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_015369661.1|4074761_4076174_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_015369662.1|4076298_4078482_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	3.4e-104
WP_015703504.1|4078545_4079073_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015369664.1|4079107_4079935_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	1.2e-60
>prophage 311
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4118404	4122073	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_082223013.1|4118404_4122073_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	1.6e-45
>prophage 312
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4125933	4127424	5059877		Burkholderia_virus(100.0%)	1	NA	NA
WP_015703467.1|4125933_4127424_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.0	1.3e-09
>prophage 313
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4136528	4137611	5059877		Geobacillus_virus(100.0%)	1	NA	NA
WP_015369719.1|4136528_4137611_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 314
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4142272	4143082	5059877		Bacillus_virus(100.0%)	1	NA	NA
WP_004181271.1|4142272_4143082_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.9e-18
>prophage 315
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4156140	4157295	5059877		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004149807.1|4156140_4157295_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 316
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4171816	4172611	5059877		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_015703442.1|4171816_4172611_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.1	9.9e-09
>prophage 317
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4197080	4198313	5059877		Catovirus(100.0%)	1	NA	NA
WP_015369774.1|4197080_4198313_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.1	9.0e-102
>prophage 318
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4206186	4209060	5059877		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_015369781.1|4206186_4209060_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.2	1.2e-261
>prophage 319
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4213622	4215056	5059877		Pandoravirus(100.0%)	1	NA	NA
WP_032712496.1|4213622_4215056_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	6.7e-32
>prophage 320
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4219838	4227533	5059877	tRNA	Brevibacillus_phage(20.0%)	7	NA	NA
WP_015703420.1|4219838_4220735_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	2.1e-31
WP_015369795.1|4220757_4221471_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_015369796.1|4221476_4223210_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	3.7e-61
WP_096335406.1|4223295_4224393_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_015369798.1|4224403_4225921_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.3	1.7e-86
WP_139396726.1|4226027_4226582_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_015369803.1|4226813_4227533_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	34.2	3.3e-11
>prophage 321
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4232005	4232530	5059877		Bacillus_phage(100.0%)	1	NA	NA
WP_064159924.1|4232005_4232530_+	5'-3'-deoxyribonucleotidase	NA	A0A0A0PKY7	Bacillus_phage	36.8	2.6e-26
>prophage 322
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4262651	4263788	5059877		Tetraselmis_virus(100.0%)	1	NA	NA
WP_015369839.1|4262651_4263788_-	histidine decarboxylase	NA	A0A2P0VP20	Tetraselmis_virus	36.5	2.3e-59
>prophage 323
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4281453	4283004	5059877		Acinetobacter_phage(100.0%)	1	NA	NA
WP_015369856.1|4281453_4283004_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	56.9	8.6e-158
>prophage 324
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4297614	4299395	5059877	integrase	Escherichia_phage(100.0%)	2	4290730:4290743	4300626:4300639
4290730:4290743	attL	TGGCGCTATCGGCG	NA	NA	NA	NA
WP_015703357.1|4297614_4298211_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.0	2.1e-51
WP_015369873.1|4298789_4299395_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.3	2.5e-52
4300626:4300639	attR	CGCCGATAGCGCCA	NA	NA	NA	NA
>prophage 325
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4326617	4329092	5059877		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_015703339.1|4326617_4327379_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.2e-19
WP_015369908.1|4327673_4329092_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.7	3.9e-24
>prophage 326
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4337543	4352931	5059877		Enterobacteria_phage(20.0%)	15	NA	NA
WP_015369916.1|4337543_4338554_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.2	1.3e-29
WP_015703332.1|4338741_4339221_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015703331.1|4339181_4340198_-	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_015703330.1|4340818_4342978_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	3.7e-18
WP_020078036.1|4342970_4344164_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_015369921.1|4344249_4345290_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_004867116.1|4345541_4345760_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_015369923.1|4345883_4346597_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
WP_151085507.1|4346659_4347355_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_071596054.1|4347534_4347726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015703328.1|4348036_4348567_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_015369927.1|4348579_4350826_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.8	4.3e-09
WP_116289375.1|4350779_4350968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015369928.1|4351254_4352130_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_015369929.1|4352136_4352931_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	64.1	1.1e-119
>prophage 327
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4358394	4378084	5059877	tRNA	Hokovirus(14.29%)	13	NA	NA
WP_151085508.1|4358394_4361280_+	pitrilysin	NA	A0A1V0SH69	Hokovirus	21.2	6.1e-40
WP_042897643.1|4361276_4364822_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	20.6	7.0e-06
WP_063410698.1|4364818_4366666_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	23.9	5.8e-20
WP_015369939.1|4367267_4368599_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_020078045.1|4368825_4370079_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	4.2e-14
WP_015369941.1|4370699_4371797_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_015703318.1|4371876_4372686_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	4.2e-15
WP_020078046.1|4372763_4373195_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_045367363.1|4373194_4374400_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	9.5e-72
WP_015369945.1|4374832_4375750_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_015369946.1|4375793_4376189_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015369947.1|4376181_4377282_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_015369948.1|4377325_4378084_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	32.9	3.5e-11
>prophage 328
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4382933	4383779	5059877		Vibrio_phage(100.0%)	1	NA	NA
WP_015369953.1|4382933_4383779_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.2e-41
>prophage 329
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4391173	4397005	5059877		Streptococcus_phage(33.33%)	3	NA	NA
WP_049053026.1|4391173_4392313_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.1	1.7e-46
WP_059305381.1|4392839_4395590_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	1.5e-48
WP_045367347.1|4395700_4397005_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.8	4.8e-37
>prophage 330
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4400513	4406874	5059877		Only_Syngen_Nebraska_virus(25.0%)	5	NA	NA
WP_015703305.1|4400513_4402151_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	3.0e-153
WP_015369968.1|4402232_4403531_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_126027804.1|4403598_4404708_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_015369971.1|4405222_4405894_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	1.9e-13
WP_015703303.1|4406085_4406874_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	2.7e-19
>prophage 331
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4415671	4417704	5059877		Hokovirus(50.0%)	2	NA	NA
WP_032709009.1|4415671_4417099_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.0	6.5e-35
WP_058676382.1|4417098_4417704_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.2	6.1e-27
>prophage 332
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4420766	4426005	5059877		uncultured_Mediterranean_phage(40.0%)	6	NA	NA
WP_015369987.1|4420766_4421528_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.3e-58
WP_015369988.1|4421521_4422148_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	8.2e-35
WP_015703293.1|4422272_4423415_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_015703292.1|4423572_4424565_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_015703291.1|4424617_4424995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015703290.1|4425117_4426005_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.7	4.3e-05
>prophage 333
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4435523	4439045	5059877		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_015703281.1|4435523_4438085_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	7.8e-31
WP_126027811.1|4438265_4439045_-	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.1	2.1e-11
>prophage 334
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4451349	4452171	5059877		Pithovirus(100.0%)	1	NA	NA
WP_047740375.1|4451349_4452171_-	manganese/iron ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	1.8e-13
>prophage 335
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4480273	4481239	5059877		Tetraselmis_virus(100.0%)	1	NA	NA
WP_015370043.1|4480273_4481239_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	6.1e-37
>prophage 336
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4486951	4495158	5059877	tRNA	Bodo_saltans_virus(20.0%)	9	NA	NA
WP_046883396.1|4486951_4487629_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	23.4	4.3e-05
WP_042894998.1|4487625_4488489_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_020078117.1|4488496_4489375_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046883397.1|4489513_4490011_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.0	2.9e-27
WP_015370055.1|4490100_4491159_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.8	8.8e-114
WP_042894995.1|4491229_4491730_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_015370057.1|4491849_4492044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139397263.1|4491981_4494609_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4494972_4495158_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 337
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4508955	4514246	5059877		Bacillus_virus(20.0%)	5	NA	NA
WP_015370073.1|4508955_4510158_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.9	1.3e-28
WP_015370074.1|4510503_4511466_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	5.0e-132
WP_015370075.1|4511476_4513621_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	47.8	7.4e-192
WP_032715672.1|4513593_4514004_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.5	1.5e-16
WP_020078126.1|4514000_4514246_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	43.8	1.1e-11
>prophage 338
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4519309	4520212	5059877		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_015370087.1|4519309_4520212_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.0	2.2e-36
>prophage 339
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4527309	4529236	5059877		Bacillus_virus(50.0%)	2	NA	NA
WP_049035140.1|4527309_4528254_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.2	3.4e-16
WP_032712361.1|4528246_4529236_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.6e-16
>prophage 340
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4534537	4535323	5059877		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_151085515.1|4534537_4535323_+	CatB-related O-acetyltransferase	NA	M1HJ62	Paramecium_bursaria_Chlorella_virus	43.6	5.7e-09
>prophage 341
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4541419	4542043	5059877		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_032708930.1|4541419_4542043_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	28.9	6.3e-11
>prophage 342
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4549407	4557824	5059877		Escherichia_phage(33.33%)	8	NA	NA
WP_020078142.1|4549407_4551927_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.7	1.9e-85
WP_047040645.1|4552107_4552494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071844514.1|4552908_4553136_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_151085518.1|4553291_4553744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045378295.1|4554358_4555129_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	28.6	1.0e-18
WP_047740403.1|4555394_4555577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045388960.1|4555674_4556187_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047740404.1|4556345_4557824_+	HNH endonuclease	NA	G0X580	Salmonella_phage	42.7	3.0e-19
>prophage 343
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4563116	4564412	5059877		Pseudomonas_phage(50.0%)	2	NA	NA
WP_130993876.1|4563116_4563560_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.1	1.9e-14
WP_151085522.1|4563590_4564412_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.9	2.6e-44
>prophage 344
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4569065	4569926	5059877		Mollivirus(100.0%)	1	NA	NA
WP_151085588.1|4569065_4569926_-	site-specific DNA-methyltransferase	NA	A0A0M4JJT6	Mollivirus	53.3	9.8e-87
>prophage 345
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4576750	4580578	5059877	integrase	Vibrio_phage(33.33%)	4	4568067:4568079	4579991:4580003
4568067:4568079	attL	TTACCAGCCCCTG	NA	NA	NA	NA
WP_151085533.1|4576750_4576963_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	45.6	3.2e-07
WP_151085534.1|4577100_4577976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151085535.1|4578145_4579387_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.8	1.7e-103
WP_015370247.1|4580095_4580578_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
4579991:4580003	attR	TTACCAGCCCCTG	NA	NA	NA	NA
>prophage 346
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4595963	4597034	5059877		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_042893249.1|4595963_4597034_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.7	5.3e-90
>prophage 347
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4612440	4613739	5059877		Burkholderia_virus(100.0%)	1	NA	NA
WP_032708912.1|4612440_4613739_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	9.1e-44
>prophage 348
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4619037	4623556	5059877	tRNA	Streptomyces_phage(25.0%)	5	NA	NA
WP_015370277.1|4619037_4619463_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	3.5e-13
WP_015703188.1|4619667_4620738_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_020078167.1|4620793_4621483_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	4.9e-57
WP_002914084.1|4621795_4622179_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_015370281.1|4622224_4623556_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.1	1.5e-46
>prophage 349
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4629325	4651381	5059877	tRNA	Bacillus_phage(25.0%)	21	NA	NA
WP_015370288.1|4629325_4631125_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_020078170.1|4631139_4632114_+	signal peptidase I	NA	NA	NA	NA	NA
WP_020078171.1|4632367_4633048_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.3e-20
WP_015370290.1|4633044_4633950_+	GTPase Era	NA	NA	NA	NA	NA
WP_015370291.1|4633961_4634699_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_020078172.1|4634710_4635442_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_015370293.1|4635441_4635822_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_015370294.1|4635830_4636091_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	2.2e-18
WP_015370295.1|4636147_4636996_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015370296.1|4637095_4637221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015370297.1|4637210_4637846_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_015370298.1|4637925_4638429_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	6.5e-06
WP_026612242.1|4638425_4640045_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_071596060.1|4640034_4640166_+	phosphoribosylformyl-glycineamide synthetase	NA	NA	NA	NA	NA
WP_020078174.1|4640218_4644106_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.1	4.7e-128
WP_026612243.1|4644664_4646101_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	9.1e-13
WP_015370302.1|4646097_4646811_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_015703177.1|4646797_4648135_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	36.3	2.0e-09
WP_002914032.1|4648200_4648539_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_015370304.1|4648612_4649803_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_015370305.1|4650127_4651381_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.3e-99
>prophage 350
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4658923	4665247	5059877		Faustovirus(20.0%)	8	NA	NA
WP_015370315.1|4658923_4660138_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
WP_004866383.1|4660164_4660551_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.0e-52
WP_012540868.1|4660570_4660894_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.2e-21
WP_012540869.1|4660968_4661484_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_015370316.1|4661499_4663350_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.7	2.9e-104
WP_012540871.1|4663351_4663687_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_002913954.1|4663688_4663889_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_015370317.1|4663960_4665247_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	3.8e-34
>prophage 351
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4674633	4675065	5059877		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004866348.1|4674633_4675065_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.3e-18
>prophage 352
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4685576	4688575	5059877		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_015703163.1|4685576_4686950_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	3.8e-40
WP_015370334.1|4687108_4688575_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	8.8e-88
>prophage 353
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4693198	4693408	5059877		Escherichia_phage(100.0%)	1	NA	NA
WP_015703159.1|4693198_4693408_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	76.7	2.5e-20
>prophage 354
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4705810	4713080	5059877	transposase	Prochlorococcus_phage(50.0%)	8	NA	NA
WP_045410924.1|4705810_4706452_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.8	3.3e-31
WP_045392672.1|4706448_4707486_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.8	3.7e-72
WP_072205249.1|4707593_4707713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045367583.1|4707735_4709166_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_015370402.1|4709362_4709989_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015370403.1|4710085_4711372_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	8.3e-66
WP_026612247.1|4711470_4712172_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_047076879.1|4712168_4713080_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.9	1.5e-72
>prophage 355
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4719667	4720381	5059877		Cyanophage(100.0%)	1	NA	NA
WP_042893008.1|4719667_4720381_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	6.9e-38
>prophage 356
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4740444	4748038	5059877		Deep-sea_thermophilic_phage(33.33%)	9	NA	NA
WP_015365483.1|4740444_4741317_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.9	2.5e-13
WP_015365484.1|4741528_4741954_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_015365485.1|4741940_4742390_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_015703137.1|4742451_4743027_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_032715067.1|4743121_4744021_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	33.1	6.5e-25
WP_015365488.1|4744229_4745246_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015365489.1|4745245_4746079_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_015365490.1|4746078_4746954_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_015365491.1|4746943_4748038_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	1.6e-30
>prophage 357
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4752889	4762843	5059877		Hokovirus(25.0%)	9	NA	NA
WP_015365498.1|4752889_4754617_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
WP_000487600.1|4754661_4754919_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_013878168.1|4755298_4756270_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_013878167.1|4756447_4757209_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_072269051.1|4757442_4758522_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_013878165.1|4758596_4760612_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	6.8e-147
WP_013878164.1|4760613_4760832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013878163.1|4760828_4761827_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_020078207.1|4761916_4762843_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	2.2e-07
>prophage 358
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4779386	4781839	5059877		Clostridioides_phage(50.0%)	2	NA	NA
WP_032712114.1|4779386_4780130_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.8	9.5e-14
WP_063443128.1|4780141_4781839_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.6	3.3e-46
>prophage 359
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4785137	4789712	5059877		Pandoravirus(33.33%)	5	NA	NA
WP_015365526.1|4785137_4785593_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.8	2.4e-12
WP_032706117.1|4785751_4786429_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_015365529.1|4786777_4787611_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	20.8	9.1e-05
WP_151085542.1|4787990_4788482_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_047740434.1|4788800_4789712_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	76.5	4.9e-121
>prophage 360
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4798790	4799876	5059877		Pandoravirus(100.0%)	1	NA	NA
WP_015365541.1|4798790_4799876_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.4	1.7e-88
>prophage 361
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4808300	4809437	5059877		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_015706175.1|4808300_4809437_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.9	1.2e-20
>prophage 362
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4815903	4817421	5059877		Mollivirus(100.0%)	1	NA	NA
WP_015365559.1|4815903_4817421_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.8	1.2e-87
>prophage 363
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4821715	4823655	5059877		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_015365566.1|4821715_4822489_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	30.2	5.1e-10
WP_032715040.1|4822527_4823025_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015365568.1|4823100_4823655_-	hypothetical protein	NA	J9Q7G7	Salmonella_phage	52.7	3.9e-44
>prophage 364
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4835657	4836257	5059877		Salmonella_phage(100.0%)	1	NA	NA
WP_032712094.1|4835657_4836257_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 365
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4877235	4889006	5059877		Pseudomonas_phage(33.33%)	7	NA	NA
WP_063443733.1|4877235_4878303_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	2.3e-08
WP_015365617.1|4878396_4878651_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_015365618.1|4878650_4879781_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	5.1e-176
WP_015365619.1|4879881_4882167_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_015365620.1|4882513_4883242_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_032710364.1|4883388_4886022_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.6	4.3e-93
WP_045412294.1|4886153_4889006_+	two-component system sensor histidine kinase RcsC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	1.7e-34
>prophage 366
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4893221	4901731	5059877		Enterobacteria_phage(25.0%)	7	NA	NA
WP_015706141.1|4893221_4894349_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.4	1.8e-120
WP_042893842.1|4894452_4895505_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_042893841.1|4895577_4896648_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.2	8.3e-19
WP_042893840.1|4896647_4897307_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_047066169.1|4897375_4899019_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.8	4.1e-09
WP_045391390.1|4899183_4900620_+	magnesium transporter	NA	NA	NA	NA	NA
WP_072251450.1|4900582_4901731_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.8	3.6e-76
>prophage 367
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4910139	4911147	5059877		Vibrio_phage(100.0%)	1	NA	NA
WP_015365669.1|4910139_4911147_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	50.2	6.3e-85
>prophage 368
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4915403	4921490	5059877		Vibrio_phage(33.33%)	6	NA	NA
WP_047043219.1|4915403_4917161_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.2	3.4e-102
WP_047043216.1|4917308_4918028_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_045391357.1|4918024_4919221_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.6	8.1e-23
WP_072047962.1|4919254_4919527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045391356.1|4919552_4919897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151085553.1|4919900_4921490_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	2.7e-18
>prophage 369
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4927251	4931563	5059877		Bacillus_phage(50.0%)	4	NA	NA
WP_015706124.1|4927251_4927821_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	36.8	3.1e-12
WP_139396665.1|4928247_4928955_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_151085557.1|4928997_4929975_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_139396663.1|4930096_4931563_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	28.7	1.3e-41
>prophage 370
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4939579	4940434	5059877		Catovirus(100.0%)	1	NA	NA
WP_020078284.1|4939579_4940434_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	5.2e-24
>prophage 371
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4945758	4951893	5059877		uncultured_Caudovirales_phage(60.0%)	6	NA	NA
WP_045391307.1|4945758_4947732_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	8.1e-12
WP_049059512.1|4947801_4948236_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.6	1.8e-49
WP_047066123.1|4948248_4949538_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	1.6e-165
WP_151085558.1|4949572_4949893_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.3	1.5e-21
WP_151085559.1|4950044_4950881_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_015365708.1|4951224_4951893_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	1.2e-55
>prophage 372
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4955657	4957094	5059877		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_151085560.1|4955657_4957094_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.5	6.6e-11
>prophage 373
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4972889	4973624	5059877		Streptococcus_phage(100.0%)	1	NA	NA
WP_015365730.1|4972889_4973624_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.2	2.8e-50
>prophage 374
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4977717	4978272	5059877		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_015706095.1|4977717_4978272_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	36.5	1.5e-19
>prophage 375
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	4984814	4993165	5059877	tRNA	Enterobacteria_phage(60.0%)	10	NA	NA
WP_032706052.1|4984814_4985750_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	3.3e-19
WP_015365742.1|4985746_4986484_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015365743.1|4986458_4986572_-	protein YohO	NA	NA	NA	NA	NA
WP_015365744.1|4986631_4987363_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.3	2.5e-75
WP_015365745.1|4987562_4989251_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.3	6.7e-257
WP_015365746.1|4989244_4989964_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_015365747.1|4990017_4990485_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	80.5	6.1e-67
WP_015365748.1|4990528_4990993_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
WP_015706087.1|4991045_4991147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047080766.1|4991131_4993165_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.8	8.9e-54
>prophage 376
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	5001010	5007336	5059877		Tetraselmis_virus(66.67%)	5	NA	NA
WP_015365759.1|5001010_5002987_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.8	2.0e-159
WP_045359644.1|5003202_5003838_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_072383259.1|5003883_5005860_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.1	1.5e-162
WP_042893805.1|5006143_5006569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032715594.1|5006877_5007336_+	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	33.6	5.9e-06
>prophage 377
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	5021157	5025989	5059877		Bacillus_phage(50.0%)	4	NA	NA
WP_015706070.1|5021157_5022051_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.8	1.1e-11
WP_015706069.1|5022308_5023670_-	U32 family peptidase	NA	Q6DW11	Phage_TP	92.3	2.9e-202
WP_015365781.1|5023815_5024538_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	7.1e-30
WP_015365782.1|5024534_5025989_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	5.4e-29
>prophage 378
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	5037712	5044283	5059877		Catovirus(25.0%)	5	NA	NA
WP_015365789.1|5037712_5038354_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	5.8e-36
WP_015365790.1|5038444_5039026_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_032714938.1|5039053_5040901_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_015706061.1|5040950_5042537_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	2.9e-36
WP_015706060.1|5043392_5044283_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.2	1.7e-46
>prophage 379
NZ_CP044214	Klebsiella aerogenes strain KA_P10_L5_03.19 chromosome, complete genome	5059877	5057592	5058687	5059877		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_047740522.1|5057592_5058687_+	glycosyltransferase	NA	A0A0P0CRA9	Ostreococcus_lucimarinus_virus	26.8	9.1e-05
>prophage 1
NZ_CP044215	Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence	333880	103174	157280	333880	transposase,protease	Escherichia_phage(29.41%)	58	NA	NA
WP_001585166.1|103174_104254_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|104255_105029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|105021_106164_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|106173_107232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254137.1|107552_108134_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|108133_109291_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|109313_109769_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|109791_110832_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|110880_111459_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|111527_112103_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|112531_113773_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000374058.1|113863_114319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|114559_114751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|114842_115184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|116171_116426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166877.1|116428_118468_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.7e-25
WP_000211823.1|118464_119451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|120371_120764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695443.1|120742_121054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|121422_122079_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_123906519.1|122118_122301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340139.1|122281_122779_+	membrane protein	NA	NA	NA	NA	NA
WP_001531258.1|122902_123685_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_000627495.1|123681_124704_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.9e-174
WP_151085592.1|124762_126133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|126533_126827_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|126831_128157_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|128217_128424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|128524_128935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001805097.1|128947_129472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|129653_130658_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000405672.1|130748_131183_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001287661.1|131268_133674_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000118563.1|133670_134747_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000993245.1|134755_134968_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|134930_135050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|135033_135270_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|135266_135632_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|135649_137335_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|137373_137799_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|137826_138102_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|138117_138483_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|138554_139010_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000278471.1|139687_140113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|140661_140970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|140985_141843_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001194554.1|141904_142108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287391.1|142449_142854_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|143031_143325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151085609.1|143350_143587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|144141_144807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|144864_145245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|145574_146435_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|146617_147175_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|147338_150344_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001239317.1|155140_155641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|155790_156432_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_151085593.1|156575_157280_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	7.6e-138
>prophage 2
NZ_CP044215	Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence	333880	163553	188697	333880	transposase,integrase	Escherichia_phage(50.0%)	22	156524:156575	179977:180028
156524:156575	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCC	NA	NA	NA	NA
WP_000156884.1|163553_164576_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_104011511.1|166374_167510_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	53.1	2.3e-75
WP_032425473.1|168442_169366_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_001549948.1|169807_171043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549947.1|171095_172199_+	ring-opening amidohydrolase	NA	NA	NA	NA	NA
WP_100160450.1|172314_173625_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.2	4.4e-30
WP_072193879.1|174257_174701_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_151085602.1|174796_176344_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_001549942.1|176353_177775_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_115431745.1|178951_179635_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	4.6e-132
WP_080377936.1|179664_179976_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	100.0	1.1e-43
WP_072040076.1|180157_181072_+	J domain-containing protein	NA	A0A1E1EVQ1	Acanthamoeba_castellanii_mimivirus	40.3	1.8e-06
179977:180028	attR	GGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_044256790.1|181155_182136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151085610.1|182404_183037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000785965.1|184680_184998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100610.1|185020_185326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|185370_186042_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001371904.1|186499_186907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000900745.1|186957_187275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122966916.1|187243_187459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001119291.1|187999_188503_-|transposase	IS1 family transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
WP_000179210.1|188421_188697_-|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 3
NZ_CP044215	Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence	333880	230866	265506	333880	transposase	uncultured_Caudovirales_phage(46.15%)	35	NA	NA
WP_000219087.1|230866_232105_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
WP_000589001.1|232526_233867_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_085949440.1|234041_235411_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_151085603.1|235743_236349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|236565_236847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|237222_237534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|237756_237957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|237996_238221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781547.1|238275_238479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143014.1|238658_238952_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	4.1e-05
WP_001371932.1|239031_239523_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001165367.1|239527_239839_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000071366.1|240355_240676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371935.1|240854_241085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000252081.1|241255_242149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151085593.1|242458_243163_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	7.6e-138
WP_001549940.1|243315_244218_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_115431745.1|245023_245707_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	4.6e-132
WP_071885229.1|245697_245922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044257530.1|245985_246483_-	damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_149410115.1|247153_248134_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
WP_044257532.1|249263_251051_-	allophanate hydrolase	NA	NA	NA	NA	NA
WP_072193875.1|251142_251910_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	1.8e-28
WP_032489965.1|251947_252754_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_044257535.1|252944_253877_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044257537.1|254240_254975_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044257539.1|255407_256253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|256540_257944_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_000125668.1|258802_260206_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|260238_260943_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|261029_261350_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|261395_262685_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|262697_263123_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|263181_264009_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|264027_265506_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
>prophage 4
NZ_CP044215	Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence	333880	315462	324906	333880	transposase	Escherichia_phage(85.71%)	11	NA	NA
WP_000259031.1|315462_316302_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|316428_316929_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|317234_317348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|317435_318200_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_115431745.1|318942_319626_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	4.6e-132
WP_071538079.1|319616_319799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002904004.1|319762_320623_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|320643_321405_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|321395_321629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903955.1|321666_322569_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_115431745.1|324222_324906_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	4.6e-132
