The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044230	Streptococcus sp. LPB0220 chromosome, complete genome	2133380	571291	576477	2133380		Streptococcus_phage(66.67%)	7	NA	NA
WP_003005875.1|571291_571618_-	hypothetical protein	NA	E4ZFJ0	Streptococcus_phage	51.2	8.1e-18
WP_013903193.1|571598_571970_-	hypothetical protein	NA	M1PLN9	Streptococcus_phage	44.6	3.5e-17
WP_150905480.1|571966_573379_-	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	66.7	1.8e-178
WP_041826243.1|573381_574059_-	helix-turn-helix transcriptional regulator	NA	A0A1B0RXB1	Streptococcus_phage	49.1	7.8e-55
WP_003005888.1|574218_575211_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	39.5	9.6e-54
WP_021152746.1|575459_575999_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003011880.1|575988_576477_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	33.1	1.6e-14
>prophage 2
NZ_CP044230	Streptococcus sp. LPB0220 chromosome, complete genome	2133380	631587	701673	2133380	portal,head,holin,capsid,transposase,tRNA,integrase,terminase,tail	Streptococcus_phage(65.96%)	76	648116:648135	702935:702954
WP_150905522.1|631587_633579_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.9	2.0e-87
WP_003006064.1|633906_634113_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_150905524.1|634123_634645_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_150905526.1|634894_636157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905528.1|636505_637441_+	adhesion protein	NA	NA	NA	NA	NA
WP_150905530.1|637448_640685_+	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_150905532.1|640924_642109_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_150905534.1|642277_642955_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_150905536.1|642947_643922_+	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	29.7	1.5e-06
WP_150905538.1|644182_644941_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	3.8e-26
WP_150905540.1|644941_646927_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003012241.1|647295_647559_-	membrane protein	NA	NA	NA	NA	NA
WP_003006102.1|647847_648105_+	membrane protein	NA	NA	NA	NA	NA
648116:648135	attL	AGAGAGTGGGACAGAAATCG	NA	NA	NA	NA
WP_129269549.1|648243_648621_+	YbgA family protein	NA	NA	NA	NA	NA
WP_150905542.1|648621_648987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905544.1|649113_652107_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_150905546.1|652123_653197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905548.1|653193_655038_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_150905549.1|655041_655752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905551.1|655748_656975_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_049507635.1|657140_657506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021144391.1|657495_657789_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_150905553.1|657810_659412_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	46.7	4.6e-114
WP_150905555.1|659527_660439_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150905557.1|660613_661759_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	54.7	1.0e-115
WP_150905558.1|661866_662388_-	hypothetical protein	NA	A7J267	Streptococcus_phage	54.1	3.8e-41
WP_150905560.1|662404_662782_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	59.5	9.6e-39
WP_150905562.1|662778_663132_-	helix-turn-helix transcriptional regulator	NA	O21993	Streptococcus_virus	50.0	1.0e-21
WP_150905564.1|663319_663538_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVR5	Streptococcus_phage	76.1	6.6e-24
WP_150905566.1|663653_663935_+	hypothetical protein	NA	A0A1S5S7M1	Streptococcus_phage	53.8	6.3e-19
WP_061455382.1|663931_664195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905568.1|664341_665622_+	AAA family ATPase	NA	Q5YA97	Bacillus_phage	71.1	8.4e-143
WP_150905570.1|665640_665988_+	hypothetical protein	NA	A0A1S5SAM2	Streptococcus_phage	31.6	8.4e-05
WP_150905572.1|665991_667053_+	ATP-binding protein	NA	Q5YA96	Bacillus_phage	59.9	1.0e-101
WP_150905574.1|667074_667638_+	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	46.6	3.6e-29
WP_150905576.1|667655_669239_+	DEAD/DEAH box helicase	NA	A0A097BY72	Enterococcus_phage	75.9	8.3e-233
WP_150905578.1|669257_670883_+	LPXTG cell wall anchor domain-containing protein	NA	A0A2H4IZY2	uncultured_Caudovirales_phage	53.4	1.8e-86
WP_150906785.1|670892_671666_+	DNA methyltransferase	NA	U4KJA1	Streptococcus_phage	75.6	2.2e-114
WP_150905581.1|671647_673975_+	AAA family ATPase	NA	A0A0K2CZN7	Paenibacillus_phage	66.8	1.3e-295
WP_150905584.1|674297_674717_+	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	62.3	1.9e-43
WP_150905586.1|674694_674916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905588.1|674912_675164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905590.1|675144_675660_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_150905592.1|675656_676148_+	DUF1642 domain-containing protein	NA	A0A1S5SE80	Streptococcus_phage	36.9	2.6e-15
WP_150905594.1|676251_676461_+	hypothetical protein	NA	A0A1S5SA40	Streptococcus_phage	71.6	1.3e-21
WP_150905596.1|676457_676700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905598.1|676696_676897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905600.1|676893_677169_+	hypothetical protein	NA	A0A2H4JBI5	uncultured_Caudovirales_phage	76.9	2.3e-29
WP_150905602.1|677362_677788_+	hypothetical protein	NA	A0A1P8BM80	Lactococcus_phage	40.3	2.9e-23
WP_150905604.1|678110_679169_+	DUF4417 domain-containing protein	NA	A0A1S5SDI7	Streptococcus_phage	57.7	5.0e-109
WP_150905606.1|679158_679611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905608.1|679637_680090_+	stress-induced protein	NA	A0A2H4JBK2	uncultured_Caudovirales_phage	47.5	1.4e-23
WP_150905610.1|680079_681315_+|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	73.9	1.1e-176
WP_150905612.1|681333_682863_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	64.2	9.6e-186
WP_150905614.1|682834_683770_+|head	phage head morphogenesis protein	head	A7J293	Streptococcus_phage	59.5	8.9e-102
WP_150905616.1|683911_684124_+	hypothetical protein	NA	A0A1S5SCQ9	Streptococcus_phage	72.9	1.0e-21
WP_150905619.1|684249_684843_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	41.4	1.1e-20
WP_150905621.1|684859_685744_+|capsid	phage capsid protein	capsid	A7J297	Streptococcus_phage	77.9	5.1e-123
WP_150905622.1|685762_686128_+	hypothetical protein	NA	A7J298	Streptococcus_phage	45.7	1.8e-21
WP_150905624.1|686141_686420_+	hypothetical protein	NA	A7J299	Streptococcus_phage	52.2	9.6e-20
WP_150905625.1|686416_686761_+	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	53.5	1.3e-26
WP_150905627.1|686764_687130_+	hypothetical protein	NA	A7J2A1	Streptococcus_phage	50.4	1.5e-25
WP_150905628.1|687147_687729_+|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	61.1	8.7e-55
WP_150905630.1|687796_688273_+	hypothetical protein	NA	A7J2A3	Streptococcus_phage	47.8	2.5e-31
WP_150906787.1|688344_688575_+	hypothetical protein	NA	A7J2A4	Streptococcus_phage	50.0	3.4e-10
WP_150905632.1|688590_693291_+|tail	phage tail tape measure protein	tail	A0A0S2GLG8	Bacillus_phage	40.2	8.6e-60
WP_150905633.1|693300_694164_+|tail	phage tail protein	tail	A7J2A6	Streptococcus_phage	47.4	1.7e-78
WP_150905635.1|694179_697476_+	hypothetical protein	NA	A7J2A7	Streptococcus_phage	50.4	5.9e-132
WP_150905636.1|697487_697700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905638.1|697706_698327_+	hypothetical protein	NA	B3GW17	Streptococcus_phage	35.0	1.8e-21
WP_150906789.1|698355_698757_+	hypothetical protein	NA	Q9AF62	Streptococcus_phage	74.2	5.4e-48
WP_150905639.1|698758_699088_+|holin	phage holin	holin	A0A141E0R5	Streptococcus_phage	55.6	4.5e-24
WP_150905641.1|699099_699945_+	peptidoglycan hydrolase	NA	O34082	Streptococcus_phage	79.4	1.3e-139
WP_150905643.1|699956_700421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150905644.1|700432_700783_+	hypothetical protein	NA	A0A2I6QR26	Streptococcus_phage	48.5	1.8e-18
WP_150905646.1|700794_701673_+	hypothetical protein	NA	Q708K2	Streptococcus_phage	54.8	6.7e-51
702935:702954	attR	AGAGAGTGGGACAGAAATCG	NA	NA	NA	NA
>prophage 3
NZ_CP044230	Streptococcus sp. LPB0220 chromosome, complete genome	2133380	830144	838122	2133380		Streptococcus_phage(50.0%)	8	NA	NA
WP_150905778.1|830144_831035_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.9e-08
WP_003017791.1|831031_832009_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	78.8	2.1e-149
WP_003006525.1|832005_832923_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	67.3	6.7e-102
WP_150905780.1|833212_834181_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	74.2	5.3e-49
WP_000048054.1|834359_834536_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_021152922.1|834636_835017_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_150905782.1|835231_837010_+	DNA primase	NA	A0A1S5RFR1	Helicobacter_phage	31.6	1.8e-47
WP_021152924.1|837012_838122_+	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	34.8	1.6e-36
>prophage 4
NZ_CP044230	Streptococcus sp. LPB0220 chromosome, complete genome	2133380	1570278	1580599	2133380		Streptococcus_phage(69.23%)	13	NA	NA
WP_024054832.1|1570278_1571124_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	36.4	8.6e-19
WP_003005197.1|1571157_1572699_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.9	2.0e-53
WP_003013024.1|1573062_1573416_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	59.0	4.6e-35
WP_070466364.1|1573421_1573913_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	3.4e-36
WP_150906413.1|1573896_1574478_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	56.7	7.9e-56
WP_003008262.1|1574495_1575353_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	72.5	5.7e-111
WP_003005416.1|1575355_1575676_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	70.8	7.9e-34
WP_150906414.1|1575685_1576579_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	52.4	3.0e-78
WP_003008266.1|1576575_1577214_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	66.7	1.2e-76
WP_150906415.1|1577363_1578251_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	49.5	2.6e-82
WP_003005183.1|1578293_1578950_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	76.1	3.3e-87
WP_003005434.1|1579124_1579835_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	1.8e-17
WP_003005595.1|1579834_1580599_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	8.0e-16
