The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031695	Erwinia billingiae strain TH88 chromosome, complete genome	4824998	2153538	2212345	4824998	integrase,protease,terminase,capsid,tail,head,holin,portal	Enterobacteria_phage(28.0%)	78	2153392:2153406	2217733:2217747
2153392:2153406	attL	AGCGTTTAATTCTTT	NA	NA	NA	NA
WP_151037264.1|2153538_2154720_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PGY1	Enterobacteria_phage	49.9	1.6e-116
WP_151037265.1|2154700_2154925_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	51.7	7.8e-12
WP_151037266.1|2154969_2155320_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	56.9	1.7e-29
WP_151037267.1|2155366_2156050_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	66.4	2.0e-90
WP_151037268.1|2156061_2156319_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	73.1	3.2e-25
WP_151037269.1|2156311_2157052_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_151037270.1|2157300_2157483_-	DUF1317 family protein	NA	NA	NA	NA	NA
WP_151037271.1|2157443_2157893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151038699.1|2158365_2159004_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	42.8	1.1e-34
WP_151037272.1|2159110_2159314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151037273.1|2159336_2159861_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	43.0	5.3e-19
WP_151037274.1|2159887_2160097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151037275.1|2160077_2160266_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	49.1	3.9e-09
WP_151037276.1|2160262_2161297_+	GntR family transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	60.6	2.7e-38
WP_151037277.1|2161293_2161737_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_151037278.1|2161855_2163157_+	chromosome partitioning protein ParB	NA	A0A2H4J902	uncultured_Caudovirales_phage	65.7	5.2e-92
WP_151037279.1|2163153_2163780_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	66.5	4.3e-76
WP_151037280.1|2163776_2164160_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	59.5	2.5e-34
WP_151037281.1|2164240_2165044_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	58.8	3.2e-84
WP_151037282.1|2165053_2166058_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.8	7.1e-105
WP_151037283.1|2166069_2166435_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	74.4	2.1e-46
WP_151037284.1|2166437_2167067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151037285.1|2167059_2167482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151037286.1|2167492_2168590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134824684.1|2168825_2169209_+	hypothetical protein	NA	F1C592	Cronobacter_phage	76.4	1.3e-46
WP_134824683.1|2169195_2169480_+|holin	phage holin family protein	holin	A0A248XD85	Klebsiella_phage	36.0	1.7e-08
WP_151037287.1|2169476_2170103_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	63.8	1.2e-73
WP_151038700.1|2170382_2170628_+	peptidase	NA	Q8SBD8	Shigella_phage	58.0	4.1e-14
WP_151037288.1|2170670_2170976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151037289.1|2171180_2171402_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151037290.1|2171431_2171716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151037291.1|2171796_2172204_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_151037292.1|2172372_2173830_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	70.7	2.1e-214
WP_151037293.1|2173811_2174402_+	hypothetical protein	NA	K7P7D2	Enterobacteria_phage	66.3	5.0e-74
WP_151037294.1|2174424_2174775_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	71.6	2.0e-46
WP_151037295.1|2175031_2175505_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.8	4.1e-63
WP_151037296.1|2175508_2177239_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	77.8	1.2e-274
WP_151037297.1|2177238_2178543_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.3	1.5e-216
WP_151037298.1|2178554_2179403_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	71.0	4.6e-105
WP_151037299.1|2179412_2180627_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.3	1.8e-195
WP_151037300.1|2180679_2181006_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	62.0	9.5e-35
WP_151037301.1|2181068_2181275_+	hypothetical protein	NA	Q9MCV3	Escherichia_phage	52.9	2.4e-07
WP_151037302.1|2181277_2181610_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	71.8	1.0e-39
WP_151038701.1|2181602_2182088_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	57.9	2.3e-48
WP_151037303.1|2182084_2182450_+	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	73.6	1.4e-47
WP_151037304.1|2182503_2182998_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	70.6	4.0e-61
WP_151037305.1|2183053_2183485_+|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	78.9	1.5e-51
WP_151038702.1|2183445_2183700_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	65.1	2.2e-26
WP_151037306.1|2183719_2186194_+|tail	phage tail tape measure protein	tail	K7PGX8	Enterobacteria_phage	54.8	2.9e-224
WP_151037307.1|2186197_2186536_+|tail	phage tail protein	tail	K7PHL4	Enterobacterial_phage	69.6	1.5e-43
WP_151037308.1|2186532_2187288_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	79.7	1.3e-111
WP_151037309.1|2187290_2187998_+	peptidase P60	NA	Q9MCU3	Escherichia_phage	78.8	5.0e-113
WP_134824662.1|2188057_2188480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134824951.1|2188537_2189125_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	71.0	1.8e-68
WP_151037310.1|2189178_2192352_+	host specificity protein J	NA	O64335	Escherichia_phage	80.1	0.0e+00
WP_151037311.1|2192361_2192670_+	hypothetical protein	NA	A0A192Y8D4	Enterobacteria_phage	41.7	8.2e-12
WP_151037312.1|2192666_2193329_+	hypothetical protein	NA	G8C7R6	Escherichia_phage	43.9	5.8e-47
WP_151037313.1|2193405_2193717_+	TonB family protein	NA	NA	NA	NA	NA
WP_151037314.1|2193780_2194968_+|tail	tail fiber domain-containing protein	tail	A0A1V0E5M2	Salmonella_phage	49.5	2.6e-37
WP_151038703.1|2195074_2195320_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	50.0	9.1e-14
WP_151037315.1|2195321_2195642_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	32.1	5.0e-12
WP_053142832.1|2195830_2196367_-	septation protein A	NA	NA	NA	NA	NA
WP_151037316.1|2196434_2197172_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_151037317.1|2197510_2198143_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_013202402.1|2198203_2198518_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_151037318.1|2198675_2199482_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_013202400.1|2199481_2200672_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_151037319.1|2200722_2202084_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	5.0e-37
WP_053142839.1|2202086_2203085_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	40.6	3.1e-52
WP_013202397.1|2203100_2203679_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	37.0	6.2e-29
WP_151037320.1|2203678_2205241_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_053142843.1|2205488_2206400_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_013202393.1|2206433_2207054_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_151037321.1|2207152_2207779_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_013202391.1|2208695_2209643_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_013202390.1|2209726_2210317_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_151037322.1|2210316_2211078_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_013202388.1|2211295_2212345_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	3.1e-18
2217733:2217747	attR	AGCGTTTAATTCTTT	NA	NA	NA	NA
>prophage 3
NZ_CP031695	Erwinia billingiae strain TH88 chromosome, complete genome	4824998	2969114	2979020	4824998	holin	uncultured_Caudovirales_phage(16.67%)	14	NA	NA
WP_013201731.1|2969114_2969360_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	69.6	1.5e-24
WP_151038735.1|2969459_2969699_+	hypothetical protein	NA	A0A2H4J1D0	uncultured_Caudovirales_phage	52.9	2.0e-13
WP_013201729.1|2969714_2969912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151037753.1|2970211_2971963_-	amylovoran biosynthesis protein AmsF	NA	A0A1S6L3G8	Erwinia_phage	48.3	1.6e-165
WP_013201726.1|2972103_2972454_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	45.5	9.9e-22
WP_013201725.1|2972450_2972918_-	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	44.4	2.0e-25
WP_151037754.1|2973197_2973887_+	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	75.1	9.5e-93
WP_151037755.1|2974154_2974442_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_151037756.1|2974428_2974809_-|holin	holin	holin	F1C592	Cronobacter_phage	58.8	2.2e-30
WP_053145469.1|2975123_2975954_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	29.1	4.9e-11
WP_151037757.1|2976175_2976694_+	ATP-binding protein	NA	A0A2H4JFX6	uncultured_Caudovirales_phage	34.4	1.5e-21
WP_105759230.1|2976816_2976999_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	55.9	1.1e-13
WP_151038736.1|2977071_2977485_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	41.8	3.8e-20
WP_013201718.1|2977769_2979020_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	87.0	8.2e-18
>prophage 4
NZ_CP031695	Erwinia billingiae strain TH88 chromosome, complete genome	4824998	3565968	3625092	4824998	integrase,protease,terminase,capsid,tail,lysis,head,plate,tRNA,portal	Salmonella_phage(68.18%)	70	3574713:3574734	3622132:3622153
WP_151038041.1|3565968_3567357_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.0	1.8e-45
WP_013201152.1|3567590_3568085_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_151038042.1|3568084_3568810_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_053141923.1|3568957_3569467_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_151038043.1|3569463_3570534_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_151038044.1|3570986_3571730_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151038045.1|3571697_3572351_-	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_151038046.1|3572508_3574926_-	ABC transporter permease	NA	NA	NA	NA	NA
3574713:3574734	attL	TCGCTTCATCCAGCCAGGCTTG	NA	NA	NA	NA
WP_013201145.1|3574922_3575609_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.8	2.0e-05
WP_151038047.1|3575579_3576203_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_013201143.1|3576469_3576688_-	transcriptional regulator	NA	Q37973	Salmonella_virus	61.1	4.0e-21
WP_151038048.1|3576767_3577862_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	73.4	2.5e-148
WP_013201141.1|3577858_3578344_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	66.5	7.2e-55
WP_151038049.1|3578340_3580986_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	43.4	1.0e-134
WP_071822138.1|3580978_3581101_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	71.8	1.8e-10
WP_151038050.1|3581115_3581439_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	68.1	1.2e-26
WP_151038051.1|3581497_3582013_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	91.2	2.9e-86
WP_151038052.1|3582025_3583198_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.3	5.8e-207
WP_151038053.1|3583440_3584523_+	DUF4875 domain-containing protein	NA	NA	NA	NA	NA
WP_151038054.1|3584562_3585153_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	47.5	2.2e-45
WP_151038055.1|3585152_3586214_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	55.7	4.3e-100
WP_151038758.1|3586210_3586804_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	76.6	3.6e-88
WP_151038056.1|3586821_3587736_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	65.9	1.3e-100
WP_151038057.1|3587722_3588079_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	65.0	2.8e-40
WP_151038058.1|3588078_3588657_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	77.5	9.8e-83
WP_151038059.1|3588743_3589952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151038060.1|3589985_3590435_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	55.5	2.1e-40
WP_151038061.1|3590427_3590862_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	70.0	6.7e-52
WP_151038062.1|3590824_3591028_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	67.2	4.1e-20
WP_151038759.1|3590957_3591383_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	66.7	1.9e-43
WP_151038063.1|3591382_3591898_-	lysozyme	NA	E5G6N1	Salmonella_phage	79.4	3.0e-75
WP_151038064.1|3591878_3592091_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	61.8	5.3e-18
WP_053143687.1|3592094_3592298_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	85.1	5.4e-28
WP_151038760.1|3592297_3592762_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	66.9	7.4e-57
WP_151038065.1|3592868_3593519_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	78.7	1.4e-90
WP_151038066.1|3593522_3594584_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	85.1	5.8e-166
WP_151038067.1|3594600_3595455_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.4	3.8e-107
WP_151038068.1|3595598_3597365_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	89.5	0.0e+00
WP_151038069.1|3597364_3598414_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.0	9.2e-172
WP_151038070.1|3598434_3599454_-	DUF2806 domain-containing protein	NA	A0A291AUV8	Sinorhizobium_phage	24.5	2.0e-06
WP_151038071.1|3599582_3601259_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_041691929.1|3601476_3601734_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	47.1	5.1e-15
WP_013201115.1|3601782_3601974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151038761.1|3602078_3604355_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	75.5	0.0e+00
WP_151038072.1|3604394_3604970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151038073.1|3604966_3605821_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	64.0	1.8e-93
WP_151038074.1|3605817_3606045_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	51.4	1.5e-15
WP_053143662.1|3606044_3606272_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	51.9	2.1e-09
WP_053143659.1|3606339_3606681_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	60.2	4.6e-32
WP_151038075.1|3606644_3606836_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	69.6	1.1e-11
WP_151038076.1|3606843_3607353_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	59.5	9.6e-50
WP_013201107.1|3607365_3607620_-	phage regulatory protein	NA	F1BUS7	Erwinia_phage	39.5	2.7e-05
WP_013201106.1|3607715_3608312_+	bacteriophage CI repressor	NA	A0A1S6KZZ7	Salmonella_phage	39.2	1.5e-33
WP_151038077.1|3608320_3609361_+|integrase	tyrosine-type recombinase/integrase	integrase	E5G6L0	Salmonella_phage	56.2	1.1e-105
WP_134823621.1|3609476_3610250_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_151038078.1|3610327_3611185_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_013201102.1|3611282_3612200_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_105759596.1|3612196_3612664_+	NfeD family protein	NA	NA	NA	NA	NA
WP_013201100.1|3612632_3613826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151038079.1|3613825_3614905_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_013201098.1|3614908_3615205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151038080.1|3615220_3615970_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	42.7	3.5e-08
WP_151038081.1|3615978_3616752_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	1.2e-14
WP_053141903.1|3616755_3618138_-	MFS transporter	NA	NA	NA	NA	NA
WP_151038082.1|3618168_3619050_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_151038083.1|3619431_3620439_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_134823614.1|3620454_3620865_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_151038084.1|3620961_3623547_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.7	6.1e-108
3622132:3622153	attR	CAAGCCTGGCTGGATGAAGCGA	NA	NA	NA	NA
WP_151038085.1|3623638_3624439_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_013201089.1|3624612_3625092_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
