The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038218	Burkholderia pseudomallei strain Yap5 chromosome 1, complete sequence	3934903	237949	247205	3934903		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|237949_239902_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004533593.1|240167_241298_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	3.8e-22
WP_058040641.1|241331_243350_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.2	7.0e-51
WP_004194137.1|243533_244349_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|244413_245097_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_009971015.1|245093_245621_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004522151.1|245657_247205_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 2
NZ_CP038218	Burkholderia pseudomallei strain Yap5 chromosome 1, complete sequence	3934903	584480	593362	3934903		Bacillus_phage(16.67%)	9	NA	NA
WP_004522358.1|584480_585881_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
WP_004522359.1|585849_586836_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.8	6.7e-15
WP_004190173.1|586894_587887_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|587958_588276_+	competence protein ComE	NA	NA	NA	NA	NA
WP_076853525.1|588288_588615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550116.1|588626_589529_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	3.3e-53
WP_122821904.1|589755_591126_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_122656575.1|591253_592177_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_004547474.1|592519_593362_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	5.5e-18
>prophage 3
NZ_CP038218	Burkholderia pseudomallei strain Yap5 chromosome 1, complete sequence	3934903	883476	956461	3934903	integrase,protease,head,plate,capsid,tail,portal,terminase,tRNA	uncultured_Caudovirales_phage(26.32%)	93	880138:880155	955859:955876
880138:880155	attL	GCCGCGCGCCTTGCCGAG	NA	NA	NA	NA
WP_004192745.1|883476_884142_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_004191887.1|884150_885353_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_150976902.1|885349_885967_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191516.1|886011_886914_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_004544024.1|887024_888167_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_076903200.1|888171_888948_+	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	26.6	1.5e-09
WP_004550225.1|889189_889444_-	lipoprotein	NA	NA	NA	NA	NA
WP_009904701.1|889349_889619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076887471.1|889675_890839_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004524740.1|890931_891477_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_038741765.1|891456_892755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137984612.1|892741_895414_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.3e-27
WP_024430959.1|895585_896887_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.7	2.6e-147
WP_009890227.1|896837_897080_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_004555249.1|897088_897562_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	2.3e-05
WP_004555250.1|897570_897900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150976904.1|898013_899330_-	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
WP_004533966.1|899329_899779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038758333.1|899775_900381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533940.1|900377_900713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|900764_900983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038758334.1|901115_901589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076840169.1|901533_902043_-	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	42.1	3.6e-12
WP_085955187.1|902193_902373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009927752.1|902472_903000_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_004555255.1|903013_903346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143293908.1|903373_903889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555256.1|903947_904511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430956.1|904574_904754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555257.1|904884_905355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150976906.1|905474_907967_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	4.7e-97
WP_017844234.1|908184_908958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123903065.1|909118_909478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123903064.1|909428_909737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024430516.1|909878_910067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935700.1|910162_910732_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004552756.1|910694_912680_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	2.1e-180
WP_004533700.1|912690_912897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122766286.1|912893_914387_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	7.5e-135
WP_004555261.1|914383_915484_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.3	7.9e-49
WP_004539732.1|915510_915855_+|head	head decoration protein	head	NA	NA	NA	NA
WP_004550216.1|915889_916915_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	1.7e-109
WP_004555262.1|916918_917209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539763.1|917210_917741_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
WP_004533675.1|917730_918264_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
WP_122657137.1|918266_918947_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.2e-18
WP_004547866.1|919011_919218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004547840.1|919214_919559_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004547860.1|919555_920449_+|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	40.7	6.4e-49
WP_004547894.1|920441_921017_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
WP_004552413.1|921004_922468_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.2	1.6e-214
WP_009909071.1|922483_922936_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	77.7	4.8e-45
WP_076900924.1|923001_924171_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.9	8.1e-161
WP_004552768.1|924181_924685_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	4.3e-42
WP_004552769.1|924754_925057_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_076889983.1|925144_927559_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.5	5.2e-69
WP_004547832.1|927567_928449_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	36.6	1.5e-29
WP_004540041.1|928423_928630_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
WP_122656927.1|928639_929692_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	45.8	7.0e-79
WP_004533694.1|929767_929962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050883818.1|929954_930497_+	lysozyme	NA	A4JX20	Burkholderia_virus	90.6	1.3e-84
WP_038712566.1|930496_931042_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	95.0	1.0e-81
WP_076819500.1|931185_931974_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.6	6.7e-151
WP_076812051.1|932009_932318_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	62.1	5.0e-25
WP_076910187.1|932749_933349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534452.1|933690_934200_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	37.7	9.7e-18
WP_004534755.1|934196_934622_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
WP_122836968.1|936125_937082_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	38.7	1.7e-47
WP_004534728.1|937389_937650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534916.1|937639_938089_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	68.5	1.8e-47
WP_004534654.1|938433_940386_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080002259.1|940571_940778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038714120.1|941038_942178_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024430922.1|942174_943008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076853220.1|943207_943447_-	DNA mismatch repair protein	NA	NA	NA	NA	NA
WP_004192883.1|943509_943737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076809161.1|943722_943914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009954883.1|944245_944461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009921282.1|944364_944616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527347.1|944644_944917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191664.1|945185_945989_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_004532151.1|946032_946284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014917760.1|946280_947195_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_004193377.1|947385_948171_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_009921276.1|948225_948438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550230.1|948506_949307_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004193779.1|949331_949823_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	33.3	4.2e-10
WP_004191635.1|949903_950479_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	39.3	5.3e-12
WP_004191389.1|950535_951201_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004192752.1|951489_952887_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	1.8e-42
WP_004205123.1|952934_953873_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004193249.1|953976_954948_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_009931101.1|954991_956461_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
955859:955876	attR	GCCGCGCGCCTTGCCGAG	NA	NA	NA	NA
>prophage 4
NZ_CP038218	Burkholderia pseudomallei strain Yap5 chromosome 1, complete sequence	3934903	2007714	2014490	3934903	integrase	Burkholderia_virus(33.33%)	11	1999625:1999640	2011283:2011298
1999625:1999640	attL	GGGCGTGGGCGGCTCG	NA	NA	NA	NA
WP_076838831.1|2007714_2008140_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	1.3e-15
WP_038728717.1|2008136_2008643_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	3.9e-19
WP_038728719.1|2008635_2009109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076831547.1|2009143_2009587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076846902.1|2009952_2010291_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	58.0	3.2e-25
WP_009941993.1|2010311_2010518_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	86.7	3.7e-16
WP_071810706.1|2010468_2010897_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	47.4	4.6e-21
WP_004521810.1|2011205_2012036_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
2011283:2011298	attR	CGAGCCGCCCACGCCC	NA	NA	NA	NA
WP_029671251.1|2012280_2012388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526695.1|2012583_2013492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192768.1|2013788_2014490_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	44.8	9.9e-13
>prophage 5
NZ_CP038218	Burkholderia pseudomallei strain Yap5 chromosome 1, complete sequence	3934903	2553563	2564539	3934903	protease	Agrobacterium_phage(16.67%)	11	NA	NA
WP_004196461.1|2553563_2555864_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|2555860_2556175_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|2556707_2556911_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004546221.1|2557040_2558660_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|2558672_2558855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|2558827_2560087_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|2560354_2560933_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|2561195_2561414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004526282.1|2561605_2562115_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	4.2e-13
WP_071897722.1|2562111_2562300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197486.1|2562424_2564539_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 6
NZ_CP038218	Burkholderia pseudomallei strain Yap5 chromosome 1, complete sequence	3934903	3318475	3374882	3934903	integrase,protease,transposase,portal,tRNA	Vibrio_phage(15.38%)	54	3312406:3312426	3381151:3381171
3312406:3312426	attL	GCCGGCGCGCGTGCCGTTCGA	NA	NA	NA	NA
WP_004203414.1|3318475_3319012_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004198316.1|3319021_3320365_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.8	3.7e-40
WP_004198315.1|3320791_3321334_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004198314.1|3321353_3322634_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004198312.1|3322651_3322903_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_004200214.1|3323227_3324127_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004198307.1|3324123_3324927_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_004525865.1|3324893_3325586_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_150976804.1|3325934_3327080_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004545692.1|3327076_3327691_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004523086.1|3327702_3329016_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_076804690.1|3329101_3330058_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004531039.1|3330431_3331376_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004534096.1|3331585_3332650_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.8	1.3e-80
WP_004538372.1|3332939_3334403_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_004190029.1|3334569_3335340_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004523089.1|3335372_3336212_-	polyphosphate kinase	NA	NA	NA	NA	NA
WP_004552444.1|3336338_3337811_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004525859.1|3337813_3339304_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|3339416_3339716_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|3340081_3341125_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|3341244_3342318_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004523092.1|3342314_3342827_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_024428815.1|3343010_3345422_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|3345433_3346582_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004523094.1|3346966_3347743_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|3347739_3348525_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_009969946.1|3348517_3348850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189793.1|3348946_3349399_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|3349418_3350051_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|3350144_3350879_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_009941464.1|3350875_3351166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189647.1|3351347_3352031_-	response regulator	NA	NA	NA	NA	NA
WP_004523096.1|3352031_3354440_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|3354441_3355032_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004523097.1|3355028_3356438_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|3356933_3357791_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004525854.1|3357900_3358536_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004525853.1|3358656_3359640_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004525852.1|3359671_3360175_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.1e-12
WP_004553745.1|3360403_3361594_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|3361653_3362025_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004525850.1|3362235_3364845_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_150976808.1|3365066_3366122_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|3366561_3367578_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004531073.1|3367552_3367675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189208.1|3367698_3368568_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|3368605_3369010_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004525848.1|3369598_3370024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009941462.1|3370144_3370588_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	50.0	2.9e-26
WP_009918009.1|3372239_3372494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525845.1|3373031_3373514_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004523107.1|3373510_3373795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525844.1|3373868_3374882_-|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	100.0	1.5e-195
3381151:3381171	attR	TCGAACGGCACGCGCGCCGGC	NA	NA	NA	NA
>prophage 7
NZ_CP038218	Burkholderia pseudomallei strain Yap5 chromosome 1, complete sequence	3934903	3596038	3607267	3934903	integrase	Burkholderia_virus(22.22%)	11	3593443:3593459	3610048:3610064
3593443:3593459	attL	CGCGGCGAGCGCGTCGA	NA	NA	NA	NA
WP_004524472.1|3596038_3598126_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	35.8	1.9e-99
WP_004202928.1|3598448_3599348_-	cytochrome c	NA	NA	NA	NA	NA
WP_076804979.1|3600179_3600359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533467.1|3600374_3601118_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	47.3	1.9e-54
WP_009922658.1|3601497_3601815_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_004530410.1|3601814_3602732_+	hypothetical protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009932250.1|3602985_3603528_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	55.8	8.1e-47
WP_009932249.1|3603785_3604238_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_004530408.1|3604237_3605317_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_004525721.1|3605473_3605722_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_076859550.1|3606565_3607267_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.5	3.7e-07
3610048:3610064	attR	TCGACGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 8
NZ_CP038218	Burkholderia pseudomallei strain Yap5 chromosome 1, complete sequence	3934903	3828631	3843736	3934903	integrase,protease,plate,transposase,tail	Burkholderia_phage(42.86%)	17	3825239:3825255	3834284:3834300
3825239:3825255	attL	GTCGACATCGGCGCGCT	NA	NA	NA	NA
WP_004535032.1|3828631_3829159_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	2.0e-21
WP_004555439.1|3829818_3830823_+	AAA family ATPase	NA	Q677Q6	Lymphocystis_disease_virus	31.7	2.6e-14
WP_004555440.1|3830879_3833177_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_100209513.1|3833135_3833651_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	52.5	4.0e-27
WP_123903074.1|3833575_3834103_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	49.2	5.1e-30
WP_028358682.1|3834190_3834604_+|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	99.2	6.8e-70
3834284:3834300	attR	GTCGACATCGGCGCGCT	NA	NA	NA	NA
WP_122798709.1|3834600_3835104_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	90.6	2.1e-81
WP_111963042.1|3835499_3836090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004547581.1|3836193_3836559_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	88.4	1.5e-52
WP_004521948.1|3836660_3837446_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004521949.1|3837442_3838789_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521950.1|3838897_3839512_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004531875.1|3839886_3840558_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521952.1|3840594_3841113_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004521953.1|3841129_3842620_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004527837.1|3842692_3843196_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011205263.1|3843223_3843736_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 1
NZ_CP038219	Burkholderia pseudomallei strain Yap5 chromosome 2, complete sequence	3171635	415196	458517	3171635	tRNA,transposase,portal,integrase,protease	Streptococcus_phage(20.0%)	37	411393:411411	451638:451656
411393:411411	attL	CGGCCGTCGCGCCGCTCGC	NA	NA	NA	NA
WP_038802333.1|415196_416317_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_058040323.1|416556_423156_-	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_009935573.1|424398_424659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935574.1|424795_425518_+|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
WP_025991576.1|425880_426075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004538372.1|426165_427629_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_004552017.1|428034_429075_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	2.2e-93
WP_004530324.1|429214_430438_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190342.1|430517_430730_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004190948.1|430896_431343_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	8.8e-23
WP_004530325.1|431437_433312_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	2.4e-66
WP_004549232.1|433358_433697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190933.1|433755_435798_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_004538372.1|436237_437701_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_004195713.1|437819_438629_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004525143.1|438779_440684_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004525142.1|440767_441652_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004190549.1|441648_441942_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190814.1|442211_443318_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004190656.1|443465_444335_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190499.1|444393_445269_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004525140.1|445428_445650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934941.1|445722_445815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009950019.1|445988_447782_+	membrane protein	NA	NA	NA	NA	NA
WP_004190401.1|448122_449505_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076913543.1|449814_452586_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	4.9e-71
451638:451656	attR	CGGCCGTCGCGCCGCTCGC	NA	NA	NA	NA
WP_004530319.1|452587_453337_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190924.1|453333_453603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529031.1|453754_454039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009934946.1|454698_455190_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_009926491.1|455525_455702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934948.1|455626_455890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934949.1|455888_456062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529035.1|456068_457295_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_123875335.1|457411_457600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529037.1|457848_457986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004553592.1|458229_458517_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	1.7e-43
>prophage 2
NZ_CP038219	Burkholderia pseudomallei strain Yap5 chromosome 2, complete sequence	3171635	793021	851278	3171635	plate,transposase	Streptococcus_phage(22.22%)	41	NA	NA
WP_004539275.1|793021_793750_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_004544687.1|793796_793931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076913332.1|793969_795403_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004552566.1|795428_796082_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004539275.1|796262_796991_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_004552499.1|797000_797258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123874560.1|797420_797639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025991558.1|797622_798762_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_025991559.1|798761_800522_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004555168.1|800564_800807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150977081.1|801061_810340_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_076808576.1|810491_810689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533385.1|810689_810953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076859446.1|811544_816176_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.9	8.3e-23
WP_004530178.1|816189_817458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935222.1|817473_819678_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.0	1.7e-42
WP_004529305.1|819645_819861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935223.1|820094_820541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935224.1|820547_820841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935225.1|821695_822295_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_004524853.1|822319_822730_-	RidA family protein	NA	NA	NA	NA	NA
WP_004530174.1|824159_824507_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.0	4.7e-40
WP_004524833.1|824503_824911_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	36.5	3.2e-11
WP_004530171.1|825343_827377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004546333.1|827617_829789_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004524829.1|829793_830645_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004544732.1|830645_831599_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004524827.1|831631_832873_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004524825.1|832908_834153_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_009935227.1|834195_834834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131201358.1|835668_836103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076812937.1|836397_836610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009927050.1|836606_837665_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_004552182.1|839057_839843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050376279.1|840574_841834_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_076812934.1|841793_842504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|842519_844724_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004533146.1|844720_847387_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	5.2e-78
WP_100227576.1|847399_848845_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004553897.1|848841_850713_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004196148.1|850717_851278_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP038219	Burkholderia pseudomallei strain Yap5 chromosome 2, complete sequence	3171635	1257901	1322459	3171635	holin,plate,transposase	Ralstonia_phage(28.57%)	55	NA	NA
WP_004187738.1|1257901_1260097_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_076805246.1|1260294_1260450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099975938.1|1261999_1263040_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004558008.1|1263003_1263456_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004523728.1|1263917_1264835_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004544882.1|1264821_1265676_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004523726.1|1265672_1266704_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004531014.1|1267329_1268550_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	100.0	1.1e-240
WP_004528499.1|1268659_1268965_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_080305612.1|1269293_1272065_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.8	6.8e-89
WP_150977042.1|1272078_1274319_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.4	3.4e-22
WP_150977040.1|1274457_1275993_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_004524152.1|1276002_1276266_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004523721.1|1276680_1277100_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_004523720.1|1277119_1277446_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004529617.1|1277531_1277747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531588.1|1277678_1277906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004531587.1|1277917_1278610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009932418.1|1278648_1278963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038735890.1|1279002_1279191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076892633.1|1279195_1279819_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_004523716.1|1279905_1281501_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.3	1.9e-06
WP_009932421.1|1281450_1281738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009932423.1|1281765_1282020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009932424.1|1282649_1284107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523712.1|1284266_1284455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076809385.1|1284466_1284931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150977312.1|1285659_1287765_+	hypothetical protein	NA	A0A2C9CZG8	Yersinia_phage	46.1	4.9e-07
WP_004551161.1|1287831_1289319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523708.1|1289354_1289570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004549711.1|1289580_1290135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523706.1|1290719_1291265_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_025991399.1|1291329_1292067_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_076866615.1|1292290_1294924_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004529637.1|1294916_1295489_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_076892806.1|1295553_1296210_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009932432.1|1296212_1297889_+	OmpA family protein	NA	NA	NA	NA	NA
WP_076892803.1|1298035_1298233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004523700.1|1298278_1298818_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004523699.1|1298851_1300351_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004529642.1|1300550_1301033_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_095413485.1|1301160_1301703_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004523698.1|1301708_1303058_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009932435.1|1303054_1304356_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_009932436.1|1304370_1308279_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009932439.1|1308468_1309038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122799165.1|1309102_1311748_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	9.2e-35
WP_004523693.1|1311822_1312092_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_150977038.1|1312104_1315557_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_004531572.1|1315449_1316808_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.2	3.4e-110
WP_004529650.1|1316840_1317869_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004529651.1|1317923_1318994_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_004523688.1|1319012_1320062_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004523687.1|1320058_1321939_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004523686.1|1321940_1322459_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP038219	Burkholderia pseudomallei strain Yap5 chromosome 2, complete sequence	3171635	1870805	1942383	3171635	holin,plate	Vibrio_phage(25.0%)	58	NA	NA
WP_004525541.1|1870805_1871573_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004206084.1|1871611_1872613_-	HpnL family protein	NA	NA	NA	NA	NA
WP_004525542.1|1872609_1873383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188272.1|1873379_1874069_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004188420.1|1874433_1875948_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004525545.1|1877667_1878606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202234.1|1878639_1879188_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004530038.1|1879184_1880696_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|1880839_1881367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190879.1|1881446_1881878_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|1881891_1883754_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|1883750_1884740_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_122648489.1|1884742_1887613_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_050868720.1|1887603_1889895_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004190563.1|1890060_1892349_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004547074.1|1892352_1894569_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|1894568_1895639_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004530790.1|1895641_1896358_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|1896400_1896790_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004202226.1|1896795_1897389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525552.1|1897385_1898747_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004530043.1|1898772_1900488_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004525554.1|1900484_1903988_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|1904046_1904406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190471.1|1904428_1904854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530793.1|1905078_1905450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009923697.1|1905547_1905721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004528661.1|1906000_1906900_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_076846473.1|1906997_1907126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011857650.1|1907133_1908453_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011205597.1|1908449_1910036_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004524284.1|1910276_1911272_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_038724161.1|1911397_1911580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004532078.1|1911576_1913160_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_076883461.1|1913143_1913440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038730208.1|1913652_1914906_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_076882195.1|1915122_1915425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150976984.1|1915419_1917084_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.4	1.2e-56
WP_004530051.1|1917216_1918782_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004530052.1|1918970_1919987_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|1920538_1921738_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004198247.1|1921915_1922941_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009933096.1|1923110_1923362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004523136.1|1923373_1924648_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_004535113.1|1924720_1925692_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|1925842_1926376_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_150977306.1|1926436_1928500_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186901.1|1928502_1930428_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004202150.1|1930432_1931605_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004530055.1|1931601_1932387_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523139.1|1932411_1933680_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530056.1|1933700_1934846_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004186918.1|1934955_1935819_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004530057.1|1935999_1937655_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|1937741_1938617_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_076809203.1|1938760_1939660_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186939.1|1939795_1941349_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_076887547.1|1941384_1942383_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 5
NZ_CP038219	Burkholderia pseudomallei strain Yap5 chromosome 2, complete sequence	3171635	2503191	2614126	3171635	plate,transposase,tail,integrase,protease,terminase	Burkholderia_phage(86.0%)	78	2533009:2533028	2603821:2603840
WP_004526384.1|2503191_2504454_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_143293927.1|2504570_2504807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528254.1|2504773_2505946_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_004551638.1|2506331_2507564_-	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
WP_004528257.1|2507983_2508118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151038835.1|2508165_2521941_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.5	2.7e-21
WP_151061526.1|2522074_2539480_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	33.2	1.3e-23
2533009:2533028	attL	CGAGTTGACCGCGCTGTCCG	NA	NA	NA	NA
WP_151018815.1|2539476_2554656_+	amino acid adenylation domain-containing protein	NA	D0R7J2	Paenibacillus_phage	45.2	2.7e-86
WP_150977238.1|2554639_2559334_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_009957834.1|2559416_2561075_+	halogenase	NA	NA	NA	NA	NA
WP_004539123.1|2561157_2562600_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	37.5	2.4e-53
WP_151018701.1|2563223_2565143_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004524104.1|2565177_2565591_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004528269.1|2565731_2566925_-	HPP family protein	NA	NA	NA	NA	NA
WP_004524105.1|2566986_2567250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198340.1|2567270_2568242_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038719591.1|2568287_2568650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524106.1|2568793_2569879_-	ionic transporter y4hA	NA	NA	NA	NA	NA
WP_004542782.1|2570606_2571395_+	MarC family protein	NA	NA	NA	NA	NA
WP_004198335.1|2571382_2571538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199327.1|2571741_2572614_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004199325.1|2572825_2573530_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011205503.1|2573705_2574752_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004199295.1|2575428_2575587_+	lipoprotein	NA	NA	NA	NA	NA
WP_004199294.1|2575602_2576124_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	27.1	5.1e-06
WP_004551650.1|2576120_2576945_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_004524113.1|2577013_2578000_+	YceI family protein	NA	NA	NA	NA	NA
WP_004198481.1|2578039_2578399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017882257.1|2578395_2578623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076886874.1|2578619_2578838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038791906.1|2578957_2579392_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	76.5	2.3e-44
WP_009927864.1|2579405_2580692_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	61.9	6.5e-127
WP_009927863.1|2580703_2581300_-	DUF2313 domain-containing protein	NA	B5TAB0	Burkholderia_phage	61.7	2.0e-59
WP_076949407.1|2581299_2582421_-|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	70.8	6.9e-149
WP_038724610.1|2582417_2583005_-|tail	tail protein	tail	B5TAA8	Burkholderia_phage	67.7	9.0e-76
WP_100565532.1|2583090_2583585_-|plate	baseplate assembly protein	plate	B5TAA7	Burkholderia_phage	62.0	2.0e-52
WP_009927857.1|2583581_2584748_-	bacteriophage Mu P	NA	B5TAA6	Burkholderia_phage	80.3	8.9e-184
WP_100565531.1|2584751_2586128_-	multidrug DMT transporter	NA	B5TAA5	Burkholderia_phage	74.0	1.2e-192
WP_100565530.1|2586127_2588803_-|tail	phage tail protein	tail	B5TAA4	Burkholderia_phage	60.4	3.0e-203
WP_058040209.1|2588851_2589400_-	hypothetical protein	NA	B5TAA3	Burkholderia_phage	67.9	6.9e-62
WP_038724605.1|2589493_2589865_-	hypothetical protein	NA	B5TAA2	Burkholderia_phage	72.4	1.2e-46
WP_058040208.1|2589911_2591390_-|tail	phage tail protein	tail	B5TAA1	Burkholderia_phage	76.0	6.8e-221
WP_058040207.1|2591436_2591703_-	hypothetical protein	NA	B5TAA0	Burkholderia_phage	63.2	1.4e-15
WP_058040206.1|2591689_2592286_-	DUF1834 family protein	NA	B5TA99	Burkholderia_phage	51.8	7.8e-51
WP_058040205.1|2592285_2592720_-	virion morphogenesis protein	NA	B5TA98	Burkholderia_phage	75.7	1.3e-55
WP_058040204.1|2592716_2593220_-	DUF1320 domain-containing protein	NA	B5TA97	Burkholderia_phage	91.6	2.0e-87
WP_076949414.1|2593216_2593618_-	hypothetical protein	NA	B5TA96	Burkholderia_phage	67.9	8.5e-09
WP_038755861.1|2593691_2594639_-	hypothetical protein	NA	B5TA95	Burkholderia_phage	92.7	9.8e-165
WP_150977234.1|2594694_2595051_-	hypothetical protein	NA	B5TA94	Burkholderia_phage	76.3	7.4e-41
WP_009927838.1|2595095_2596244_-	hypothetical protein	NA	B5TA92	Burkholderia_phage	83.1	9.1e-181
WP_150977232.1|2596459_2596861_-	hypothetical protein	NA	B5TA91	Burkholderia_phage	86.5	1.4e-59
WP_058040201.1|2596857_2597292_-	regulatory protein GemA	NA	B5TA90	Burkholderia_phage	81.7	2.4e-57
WP_009927831.1|2597293_2597605_-	hypothetical protein	NA	B5TA89	Burkholderia_phage	63.6	4.4e-29
WP_058040200.1|2597756_2598074_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	68.3	2.2e-07
WP_058040199.1|2598162_2598435_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	85.6	3.3e-33
WP_058040198.1|2598498_2598891_-	ASCH domain-containing protein	NA	B5TA86	Burkholderia_phage	82.3	8.7e-59
WP_038724592.1|2598904_2599531_-	DUF3164 family protein	NA	B5TA85	Burkholderia_phage	90.4	3.3e-100
WP_058040197.1|2599527_2600115_-	hypothetical protein	NA	B5TA84	Burkholderia_phage	91.8	1.3e-82
WP_038721762.1|2600101_2600407_-	hypothetical protein	NA	B5TA83	Burkholderia_phage	73.3	6.4e-33
WP_038790982.1|2600403_2600592_-	hypothetical protein	NA	B5TA82	Burkholderia_phage	65.5	5.9e-13
WP_009927794.1|2600599_2601592_-	AAA family ATPase	NA	B5TA81	Burkholderia_phage	87.9	1.1e-166
WP_058040196.1|2601601_2603227_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	B5TA80	Burkholderia_phage	95.6	2.0e-303
WP_058040195.1|2603266_2604313_-	hypothetical protein	NA	B5TA79	Burkholderia_phage	77.3	2.4e-135
2603821:2603840	attR	CGGACAGCGCGGTCAACTCG	NA	NA	NA	NA
WP_009927791.1|2604309_2604501_-	DNA-binding protein	NA	B5TA78	Burkholderia_phage	89.3	2.7e-21
WP_038724587.1|2604582_2605068_+	helix-turn-helix transcriptional regulator	NA	B5TA77	Burkholderia_phage	72.0	1.3e-51
WP_038756160.1|2605111_2605645_+	hypothetical protein	NA	B5TA76	Burkholderia_phage	74.6	9.1e-67
WP_009927787.1|2606010_2606493_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_058040194.1|2606489_2606762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038721770.1|2606882_2607194_+	membrane protein	NA	B5TA74	Burkholderia_phage	70.2	4.4e-37
WP_058040193.1|2607190_2607865_+	lytic transglycosylase domain-containing protein	NA	B5TA73	Burkholderia_phage	70.1	6.9e-88
WP_076949408.1|2607861_2608326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038724579.1|2608433_2608655_+	hypothetical protein	NA	B5TA71	Burkholderia_phage	89.0	4.3e-31
WP_009927781.1|2608651_2608942_+	hypothetical protein	NA	B5TA70	Burkholderia_phage	89.6	1.3e-40
WP_038755846.1|2608945_2609443_+	DUF1804 family protein	NA	B5TA69	Burkholderia_phage	93.9	3.5e-81
WP_150977229.1|2609449_2611066_+|terminase	phage terminase large subunit	terminase	B5TA68	Burkholderia_phage	92.8	6.3e-305
WP_058040191.1|2611055_2612588_+	DUF935 family protein	NA	B5TA67	Burkholderia_phage	89.5	2.9e-251
WP_009927776.1|2612632_2612893_+	hypothetical protein	NA	B5TA66	Burkholderia_phage	72.1	1.0e-23
WP_038791867.1|2612893_2614126_+	hypothetical protein	NA	B5TA65	Burkholderia_phage	89.0	6.1e-215
