The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038226	Burkholderia pseudomallei strain Yap1 chromosome 1, complete sequence	3933317	426121	437097	3933317	protease	Agrobacterium_phage(16.67%)	11	NA	NA
WP_004196461.1|426121_428422_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|428418_428733_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|429265_429469_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004546221.1|429598_431218_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|431230_431413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|431385_432645_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|432912_433491_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|433753_433972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004526282.1|434163_434673_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	4.2e-13
WP_071897722.1|434669_434858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197486.1|434982_437097_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 2
NZ_CP038226	Burkholderia pseudomallei strain Yap1 chromosome 1, complete sequence	3933317	1467173	1478402	3933317	integrase	Burkholderia_virus(22.22%)	11	1464578:1464594	1481183:1481199
1464578:1464594	attL	CGCGGCGAGCGCGTCGA	NA	NA	NA	NA
WP_004524472.1|1467173_1469261_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	35.8	1.9e-99
WP_004202928.1|1469583_1470483_-	cytochrome c	NA	NA	NA	NA	NA
WP_076804979.1|1471314_1471494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533467.1|1471509_1472253_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	47.3	1.9e-54
WP_009922658.1|1472632_1472950_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_004530410.1|1472949_1473867_+	hypothetical protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009932250.1|1474120_1474663_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	55.8	8.1e-47
WP_009932249.1|1474920_1475373_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_004530408.1|1475372_1476452_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_004525721.1|1476608_1476857_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_076859550.1|1477700_1478402_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.5	3.7e-07
1481183:1481199	attR	TCGACGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 3
NZ_CP038226	Burkholderia pseudomallei strain Yap1 chromosome 1, complete sequence	3933317	1699787	1714892	3933317	tail,plate,transposase,integrase,protease	Burkholderia_phage(42.86%)	17	1696395:1696411	1705440:1705456
1696395:1696411	attL	GTCGACATCGGCGCGCT	NA	NA	NA	NA
WP_004535032.1|1699787_1700315_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	2.0e-21
WP_004555439.1|1700974_1701979_+	AAA family ATPase	NA	Q677Q6	Lymphocystis_disease_virus	31.7	2.6e-14
WP_004555440.1|1702035_1704333_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_100209513.1|1704291_1704807_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	52.5	4.0e-27
WP_123903074.1|1704731_1705259_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	49.2	5.1e-30
WP_028358682.1|1705346_1705760_+|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	99.2	6.8e-70
1705440:1705456	attR	GTCGACATCGGCGCGCT	NA	NA	NA	NA
WP_122798709.1|1705756_1706260_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	90.6	2.1e-81
WP_111963042.1|1706655_1707246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004547581.1|1707349_1707715_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	88.4	1.5e-52
WP_004521948.1|1707816_1708602_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004521949.1|1708598_1709945_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521950.1|1710053_1710668_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004531875.1|1711042_1711714_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521952.1|1711750_1712269_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004521953.1|1712285_1713776_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004527837.1|1713848_1714352_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011205263.1|1714379_1714892_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP038226	Burkholderia pseudomallei strain Yap1 chromosome 1, complete sequence	3933317	2043904	2053160	3933317		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|2043904_2045857_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004533593.1|2046122_2047253_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	3.8e-22
WP_058040641.1|2047286_2049305_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.2	7.0e-51
WP_004194137.1|2049488_2050304_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|2050368_2051052_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_009971015.1|2051048_2051576_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004522151.1|2051612_2053160_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 5
NZ_CP038226	Burkholderia pseudomallei strain Yap1 chromosome 1, complete sequence	3933317	2390294	2399182	3933317		Bacillus_phage(16.67%)	9	NA	NA
WP_004522358.1|2390294_2391695_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
WP_004522359.1|2391663_2392650_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.8	6.7e-15
WP_004190173.1|2392708_2393701_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|2393772_2394090_+	competence protein ComE	NA	NA	NA	NA	NA
WP_076853525.1|2394102_2394429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550116.1|2394440_2395343_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	3.3e-53
WP_151018678.1|2395569_2396946_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_122656575.1|2397073_2397997_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_004547474.1|2398339_2399182_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	5.5e-18
>prophage 6
NZ_CP038226	Burkholderia pseudomallei strain Yap1 chromosome 1, complete sequence	3933317	2689388	2762371	3933317	tRNA,head,portal,terminase,tail,plate,capsid,integrase,protease	uncultured_Caudovirales_phage(26.32%)	94	2686050:2686067	2761769:2761786
2686050:2686067	attL	GCCGCGCGCCTTGCCGAG	NA	NA	NA	NA
WP_004192745.1|2689388_2690054_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_004191887.1|2690062_2691265_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_150976902.1|2691261_2691879_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191516.1|2691923_2692826_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_004544024.1|2692936_2694079_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_076903200.1|2694083_2694860_+	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	26.6	1.5e-09
WP_004550225.1|2695100_2695355_-	lipoprotein	NA	NA	NA	NA	NA
WP_009904701.1|2695260_2695530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076887471.1|2695586_2696750_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004524740.1|2696842_2697388_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_038741765.1|2697367_2698666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137984612.1|2698652_2701325_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.3e-27
WP_024430959.1|2701496_2702798_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.7	2.6e-147
WP_009890227.1|2702748_2702991_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_004555249.1|2702999_2703473_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	2.3e-05
WP_004555250.1|2703481_2703811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150976904.1|2703924_2705241_-	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
WP_004533966.1|2705240_2705690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038758333.1|2705686_2706292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533940.1|2706288_2706624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|2706675_2706894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038758334.1|2707026_2707500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076840169.1|2707444_2707954_-	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	42.1	3.6e-12
WP_085955187.1|2708104_2708284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009927752.1|2708383_2708911_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_004555255.1|2708924_2709257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143293908.1|2709284_2709800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555256.1|2709858_2710422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430956.1|2710485_2710665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555257.1|2710795_2711266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150976906.1|2711385_2713878_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	4.7e-97
WP_017844234.1|2714095_2714869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123903065.1|2715029_2715389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123903064.1|2715339_2715648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024430516.1|2715789_2715978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935700.1|2716073_2716643_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004552756.1|2716605_2718591_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	2.1e-180
WP_004533700.1|2718601_2718808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122766286.1|2718804_2720298_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	7.5e-135
WP_004555261.1|2720294_2721395_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.3	7.9e-49
WP_004539732.1|2721421_2721766_+|head	head decoration protein	head	NA	NA	NA	NA
WP_004550216.1|2721800_2722826_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	1.7e-109
WP_004555262.1|2722829_2723120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539763.1|2723121_2723652_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
WP_004533675.1|2723641_2724175_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
WP_122657137.1|2724177_2724858_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.2e-18
WP_004547866.1|2724922_2725129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004547840.1|2725125_2725470_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004547860.1|2725466_2726360_+|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	40.7	6.4e-49
WP_004547894.1|2726352_2726928_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
WP_004552413.1|2726915_2728379_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.2	1.6e-214
WP_009909071.1|2728394_2728847_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	77.7	4.8e-45
WP_076900924.1|2728912_2730082_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.9	8.1e-161
WP_004552768.1|2730092_2730596_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	4.3e-42
WP_004552769.1|2730665_2730968_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_076889983.1|2731055_2733470_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.5	5.2e-69
WP_004547832.1|2733478_2734360_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	36.6	1.5e-29
WP_004540041.1|2734334_2734541_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
WP_122656927.1|2734550_2735603_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	45.8	7.0e-79
WP_004533694.1|2735678_2735873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050883818.1|2735865_2736408_+	lysozyme	NA	A4JX20	Burkholderia_virus	90.6	1.3e-84
WP_038712566.1|2736407_2736953_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	95.0	1.0e-81
WP_076819500.1|2737096_2737885_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.6	6.7e-151
WP_076812051.1|2737920_2738229_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	62.1	5.0e-25
WP_076910187.1|2738660_2739260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534452.1|2739601_2740111_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	37.7	9.7e-18
WP_004534755.1|2740107_2740533_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
WP_122794587.1|2741752_2742061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122836968.1|2742035_2742992_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	38.7	1.7e-47
WP_004534728.1|2743299_2743560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534916.1|2743549_2743999_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	68.5	1.8e-47
WP_004534654.1|2744343_2746296_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080002259.1|2746481_2746688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038714120.1|2746948_2748088_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024430922.1|2748084_2748918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076853220.1|2749117_2749357_-	DNA mismatch repair protein	NA	NA	NA	NA	NA
WP_004192883.1|2749419_2749647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076809161.1|2749632_2749824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009954883.1|2750155_2750371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009921282.1|2750274_2750526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527347.1|2750554_2750827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191664.1|2751095_2751899_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_004532151.1|2751942_2752194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014917760.1|2752190_2753105_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_004193377.1|2753295_2754081_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_009921276.1|2754135_2754348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550230.1|2754416_2755217_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004193779.1|2755241_2755733_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	33.3	4.2e-10
WP_004191635.1|2755813_2756389_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	39.3	5.3e-12
WP_004191389.1|2756445_2757111_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004192752.1|2757399_2758797_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	1.8e-42
WP_004205123.1|2758844_2759783_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004193249.1|2759886_2760858_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_009931101.1|2760901_2762371_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
2761769:2761786	attR	GCCGCGCGCCTTGCCGAG	NA	NA	NA	NA
>prophage 7
NZ_CP038226	Burkholderia pseudomallei strain Yap1 chromosome 1, complete sequence	3933317	3813597	3820373	3933317	integrase	Burkholderia_virus(33.33%)	11	3805508:3805523	3817166:3817181
3805508:3805523	attL	GGGCGTGGGCGGCTCG	NA	NA	NA	NA
WP_076838831.1|3813597_3814023_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	1.3e-15
WP_038728717.1|3814019_3814526_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	3.9e-19
WP_038728719.1|3814518_3814992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076831547.1|3815026_3815470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076846902.1|3815835_3816174_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	58.0	3.2e-25
WP_009941993.1|3816194_3816401_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	86.7	3.7e-16
WP_071810706.1|3816351_3816780_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	47.4	4.6e-21
WP_004521810.1|3817088_3817919_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
3817166:3817181	attR	CGAGCCGCCCACGCCC	NA	NA	NA	NA
WP_029671251.1|3818163_3818271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526695.1|3818466_3819375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192768.1|3819671_3820373_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	44.8	9.9e-13
>prophage 1
NZ_CP038227	Burkholderia pseudomallei strain Yap1 chromosome 2, complete sequence	3208533	117548	160855	3208533	protease,tRNA,portal,integrase,transposase	Streptococcus_phage(20.0%)	37	113745:113763	153976:153994
113745:113763	attL	CGGCCGTCGCGCCGCTCGC	NA	NA	NA	NA
WP_038802333.1|117548_118669_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_058040323.1|118908_125508_-	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_009935573.1|126750_127011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935574.1|127147_127870_+|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
WP_025991576.1|128232_128427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004538372.1|128517_129981_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_004552017.1|130386_131427_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	2.2e-93
WP_004530324.1|131566_132790_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190342.1|132869_133082_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004190948.1|133248_133695_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	8.8e-23
WP_004530325.1|133789_135664_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	2.4e-66
WP_004549232.1|135710_136049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190933.1|136107_138150_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_004538372.1|138589_140053_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_004195713.1|140171_140981_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004525143.1|141131_143036_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004525142.1|143119_144004_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004190549.1|144000_144294_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190814.1|144563_145670_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004190656.1|145817_146687_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190499.1|146745_147621_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004525140.1|147780_148002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934941.1|148074_148167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009950019.1|148340_150134_+	membrane protein	NA	NA	NA	NA	NA
WP_004190401.1|150460_151843_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076913543.1|152152_154924_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	4.9e-71
153976:153994	attR	CGGCCGTCGCGCCGCTCGC	NA	NA	NA	NA
WP_004530319.1|154925_155675_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190924.1|155671_155941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529031.1|156092_156377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009934946.1|157036_157528_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_009926491.1|157863_158040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934948.1|157964_158228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934949.1|158226_158400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529035.1|158406_159633_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_123875335.1|159749_159938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529037.1|160186_160324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004553592.1|160567_160855_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	1.7e-43
>prophage 2
NZ_CP038227	Burkholderia pseudomallei strain Yap1 chromosome 2, complete sequence	3208533	495322	553579	3208533	transposase,plate	Streptococcus_phage(22.22%)	41	NA	NA
WP_004539275.1|495322_496051_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_004544687.1|496097_496232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076913332.1|496270_497704_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004552566.1|497729_498383_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004539275.1|498563_499292_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_004552499.1|499301_499559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123874560.1|499721_499940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025991558.1|499923_501063_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_025991559.1|501062_502823_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004555168.1|502865_503108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150977081.1|503362_512641_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_076808576.1|512792_512990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533385.1|512990_513254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076859446.1|513845_518477_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.9	8.3e-23
WP_004530178.1|518490_519759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935222.1|519774_521979_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.0	1.7e-42
WP_004529305.1|521946_522162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935223.1|522395_522842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935224.1|522848_523142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935225.1|523996_524596_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_004524853.1|524620_525031_-	RidA family protein	NA	NA	NA	NA	NA
WP_004530174.1|526460_526808_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.0	4.7e-40
WP_004524833.1|526804_527212_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	36.5	3.2e-11
WP_004530171.1|527644_529678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004546333.1|529918_532090_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004524829.1|532094_532946_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004544732.1|532946_533900_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004524827.1|533932_535174_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004524825.1|535209_536454_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_009935227.1|536496_537135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131201358.1|537969_538404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076812937.1|538698_538911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009927050.1|538907_539966_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_004552182.1|541358_542144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050376279.1|542875_544135_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_076812934.1|544094_544805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|544820_547025_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004533146.1|547021_549688_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	5.2e-78
WP_100227576.1|549700_551146_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004553897.1|551142_553014_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004196148.1|553018_553579_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP038227	Burkholderia pseudomallei strain Yap1 chromosome 2, complete sequence	3208533	960300	1024857	3208533	transposase,holin,plate	Ralstonia_phage(28.57%)	55	NA	NA
WP_004187738.1|960300_962496_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_076805246.1|962693_962849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099975938.1|964397_965438_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004558008.1|965401_965854_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004523728.1|966315_967233_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004544882.1|967219_968074_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004523726.1|968070_969102_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004531014.1|969727_970948_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	100.0	1.1e-240
WP_004528499.1|971057_971363_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_080305612.1|971691_974463_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.8	6.8e-89
WP_150977042.1|974476_976717_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.4	3.4e-22
WP_150977040.1|976855_978391_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_004524152.1|978400_978664_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004523721.1|979078_979498_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_004523720.1|979517_979844_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004529617.1|979929_980145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531588.1|980076_980304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004531587.1|980315_981008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009932418.1|981046_981361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038735890.1|981400_981589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076892633.1|981593_982217_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_004523716.1|982303_983899_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.3	1.9e-06
WP_009932421.1|983848_984136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009932423.1|984163_984418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009932424.1|985047_986505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523712.1|986664_986853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076809385.1|986864_987329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150977312.1|988057_990163_+	hypothetical protein	NA	A0A2C9CZG8	Yersinia_phage	46.1	4.9e-07
WP_004551161.1|990229_991717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523708.1|991752_991968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004549711.1|991978_992533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523706.1|993117_993663_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_025991399.1|993727_994465_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_076866615.1|994688_997322_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004529637.1|997314_997887_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_076892806.1|997951_998608_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009932432.1|998610_1000287_+	OmpA family protein	NA	NA	NA	NA	NA
WP_076892803.1|1000433_1000631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004523700.1|1000676_1001216_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004523699.1|1001249_1002749_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004529642.1|1002948_1003431_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_095413485.1|1003558_1004101_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004523698.1|1004106_1005456_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009932435.1|1005452_1006754_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_009932436.1|1006768_1010677_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009932439.1|1010866_1011436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122799165.1|1011500_1014146_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	9.2e-35
WP_004523693.1|1014220_1014490_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_150977038.1|1014502_1017955_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_004531572.1|1017847_1019206_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.2	3.4e-110
WP_004529650.1|1019238_1020267_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004529651.1|1020321_1021392_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_004523688.1|1021410_1022460_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004523687.1|1022456_1024337_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004523686.1|1024338_1024857_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP038227	Burkholderia pseudomallei strain Yap1 chromosome 2, complete sequence	3208533	1573200	1644792	3208533	holin,plate	Vibrio_phage(25.0%)	58	NA	NA
WP_004525541.1|1573200_1573968_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004206084.1|1574006_1575008_-	HpnL family protein	NA	NA	NA	NA	NA
WP_004525542.1|1575004_1575778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188272.1|1575774_1576464_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004188420.1|1576828_1578343_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004525545.1|1580062_1581001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202234.1|1581034_1581583_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004530038.1|1581579_1583091_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|1583234_1583762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190879.1|1583841_1584273_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|1584286_1586149_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|1586145_1587135_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_122648489.1|1587137_1590008_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_050868720.1|1589998_1592290_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004190563.1|1592455_1594744_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004547074.1|1594747_1596964_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|1596963_1598034_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004530790.1|1598036_1598753_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|1598795_1599185_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004202226.1|1599190_1599784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525552.1|1599780_1601142_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004530043.1|1601167_1602883_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004525554.1|1602879_1606383_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|1606441_1606801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190471.1|1606823_1607249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530793.1|1607473_1607845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009923697.1|1607942_1608116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004528661.1|1608395_1609295_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_076846473.1|1609392_1609521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011857650.1|1609528_1610848_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011205597.1|1610844_1612431_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004524284.1|1612671_1613667_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_038724161.1|1613792_1613975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004532078.1|1613971_1615555_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_076883461.1|1615538_1615835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038730208.1|1616047_1617301_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_076882195.1|1617517_1617820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150976984.1|1617814_1619479_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.4	1.2e-56
WP_004530051.1|1619611_1621177_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004530052.1|1621365_1622382_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|1622947_1624147_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004198247.1|1624324_1625350_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009933096.1|1625519_1625771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004523136.1|1625782_1627057_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_004535113.1|1627129_1628101_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|1628251_1628785_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_150977306.1|1628845_1630909_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186901.1|1630911_1632837_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004202150.1|1632841_1634014_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004530055.1|1634010_1634796_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523139.1|1634820_1636089_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530056.1|1636109_1637255_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004186918.1|1637364_1638228_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004530057.1|1638408_1640064_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|1640150_1641026_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_076809203.1|1641169_1642069_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186939.1|1642204_1643758_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_076887547.1|1643793_1644792_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 5
NZ_CP038227	Burkholderia pseudomallei strain Yap1 chromosome 2, complete sequence	3208533	2205474	2316393	3208533	protease,terminase,plate,integrase,transposase,tail	Burkholderia_phage(86.0%)	77	2235285:2235304	2306088:2306107
WP_004526384.1|2205474_2206737_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004528254.1|2207055_2208228_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_004551638.1|2208613_2209846_-	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
WP_004528257.1|2210265_2210400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151018813.1|2210447_2224199_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.5	2.7e-21
WP_151018855.1|2224332_2241747_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	33.2	1.3e-23
2235285:2235304	attL	CGAGTTGACCGCGCTGTCCG	NA	NA	NA	NA
WP_151018815.1|2241743_2256923_+	amino acid adenylation domain-containing protein	NA	D0R7J2	Paenibacillus_phage	45.2	2.7e-86
WP_150977238.1|2256906_2261601_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_009957834.1|2261683_2263342_+	halogenase	NA	NA	NA	NA	NA
WP_004539123.1|2263424_2264867_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	37.5	2.4e-53
WP_151018701.1|2265490_2267410_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004524104.1|2267444_2267858_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004528269.1|2267998_2269192_-	HPP family protein	NA	NA	NA	NA	NA
WP_004524105.1|2269253_2269517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198340.1|2269537_2270509_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038719591.1|2270554_2270917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524106.1|2271060_2272146_-	ionic transporter y4hA	NA	NA	NA	NA	NA
WP_004542782.1|2272873_2273662_+	MarC family protein	NA	NA	NA	NA	NA
WP_004198335.1|2273649_2273805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199327.1|2274008_2274881_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004199325.1|2275092_2275797_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011205503.1|2275972_2277019_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004199295.1|2277695_2277854_+	lipoprotein	NA	NA	NA	NA	NA
WP_004199294.1|2277869_2278391_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	27.1	5.1e-06
WP_004551650.1|2278387_2279212_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_004524113.1|2279280_2280267_+	YceI family protein	NA	NA	NA	NA	NA
WP_004198481.1|2280306_2280666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017882257.1|2280662_2280890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076886874.1|2280886_2281105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038791906.1|2281224_2281659_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	76.5	2.3e-44
WP_009927864.1|2281672_2282959_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	61.9	6.5e-127
WP_009927863.1|2282970_2283567_-	DUF2313 domain-containing protein	NA	B5TAB0	Burkholderia_phage	61.7	2.0e-59
WP_076949407.1|2283566_2284688_-|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	70.8	6.9e-149
WP_038724610.1|2284684_2285272_-|tail	tail protein	tail	B5TAA8	Burkholderia_phage	67.7	9.0e-76
WP_100565532.1|2285357_2285852_-|plate	baseplate assembly protein	plate	B5TAA7	Burkholderia_phage	62.0	2.0e-52
WP_009927857.1|2285848_2287015_-	bacteriophage Mu P	NA	B5TAA6	Burkholderia_phage	80.3	8.9e-184
WP_100565531.1|2287018_2288395_-	multidrug DMT transporter	NA	B5TAA5	Burkholderia_phage	74.0	1.2e-192
WP_100565530.1|2288394_2291070_-|tail	phage tail protein	tail	B5TAA4	Burkholderia_phage	60.4	3.0e-203
WP_058040209.1|2291118_2291667_-	hypothetical protein	NA	B5TAA3	Burkholderia_phage	67.9	6.9e-62
WP_038724605.1|2291760_2292132_-	hypothetical protein	NA	B5TAA2	Burkholderia_phage	72.4	1.2e-46
WP_058040208.1|2292178_2293657_-|tail	phage tail protein	tail	B5TAA1	Burkholderia_phage	76.0	6.8e-221
WP_058040207.1|2293703_2293970_-	hypothetical protein	NA	B5TAA0	Burkholderia_phage	63.2	1.4e-15
WP_058040206.1|2293956_2294553_-	DUF1834 family protein	NA	B5TA99	Burkholderia_phage	51.8	7.8e-51
WP_058040205.1|2294552_2294987_-	virion morphogenesis protein	NA	B5TA98	Burkholderia_phage	75.7	1.3e-55
WP_058040204.1|2294983_2295487_-	DUF1320 domain-containing protein	NA	B5TA97	Burkholderia_phage	91.6	2.0e-87
WP_076949414.1|2295483_2295885_-	hypothetical protein	NA	B5TA96	Burkholderia_phage	67.9	8.5e-09
WP_038755861.1|2295958_2296906_-	hypothetical protein	NA	B5TA95	Burkholderia_phage	92.7	9.8e-165
WP_150977234.1|2296961_2297318_-	hypothetical protein	NA	B5TA94	Burkholderia_phage	76.3	7.4e-41
WP_009927838.1|2297362_2298511_-	hypothetical protein	NA	B5TA92	Burkholderia_phage	83.1	9.1e-181
WP_150977232.1|2298726_2299128_-	hypothetical protein	NA	B5TA91	Burkholderia_phage	86.5	1.4e-59
WP_058040201.1|2299124_2299559_-	regulatory protein GemA	NA	B5TA90	Burkholderia_phage	81.7	2.4e-57
WP_009927831.1|2299560_2299872_-	hypothetical protein	NA	B5TA89	Burkholderia_phage	63.6	4.4e-29
WP_058040200.1|2300023_2300341_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	68.3	2.2e-07
WP_058040199.1|2300429_2300702_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	85.6	3.3e-33
WP_058040198.1|2300765_2301158_-	ASCH domain-containing protein	NA	B5TA86	Burkholderia_phage	82.3	8.7e-59
WP_038724592.1|2301171_2301798_-	DUF3164 family protein	NA	B5TA85	Burkholderia_phage	90.4	3.3e-100
WP_058040197.1|2301794_2302382_-	hypothetical protein	NA	B5TA84	Burkholderia_phage	91.8	1.3e-82
WP_038721762.1|2302368_2302674_-	hypothetical protein	NA	B5TA83	Burkholderia_phage	73.3	6.4e-33
WP_038790982.1|2302670_2302859_-	hypothetical protein	NA	B5TA82	Burkholderia_phage	65.5	5.9e-13
WP_009927794.1|2302866_2303859_-	AAA family ATPase	NA	B5TA81	Burkholderia_phage	87.9	1.1e-166
WP_058040196.1|2303868_2305494_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	B5TA80	Burkholderia_phage	95.6	2.0e-303
WP_058040195.1|2305533_2306580_-	hypothetical protein	NA	B5TA79	Burkholderia_phage	77.3	2.4e-135
2306088:2306107	attR	CGGACAGCGCGGTCAACTCG	NA	NA	NA	NA
WP_009927791.1|2306576_2306768_-	DNA-binding protein	NA	B5TA78	Burkholderia_phage	89.3	2.7e-21
WP_038724587.1|2306849_2307335_+	helix-turn-helix transcriptional regulator	NA	B5TA77	Burkholderia_phage	72.0	1.3e-51
WP_038756160.1|2307378_2307912_+	hypothetical protein	NA	B5TA76	Burkholderia_phage	74.6	9.1e-67
WP_009927787.1|2308277_2308760_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_058040194.1|2308756_2309029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038721770.1|2309149_2309461_+	membrane protein	NA	B5TA74	Burkholderia_phage	70.2	4.4e-37
WP_058040193.1|2309457_2310132_+	lytic transglycosylase domain-containing protein	NA	B5TA73	Burkholderia_phage	70.1	6.9e-88
WP_076949408.1|2310128_2310593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038724579.1|2310700_2310922_+	hypothetical protein	NA	B5TA71	Burkholderia_phage	89.0	4.3e-31
WP_009927781.1|2310918_2311209_+	hypothetical protein	NA	B5TA70	Burkholderia_phage	89.6	1.3e-40
WP_038755846.1|2311212_2311710_+	DUF1804 family protein	NA	B5TA69	Burkholderia_phage	93.9	3.5e-81
WP_150977229.1|2311716_2313333_+|terminase	phage terminase large subunit	terminase	B5TA68	Burkholderia_phage	92.8	6.3e-305
WP_058040191.1|2313322_2314855_+	DUF935 family protein	NA	B5TA67	Burkholderia_phage	89.5	2.9e-251
WP_009927776.1|2314899_2315160_+	hypothetical protein	NA	B5TA66	Burkholderia_phage	72.1	1.0e-23
WP_038791867.1|2315160_2316393_+	hypothetical protein	NA	B5TA65	Burkholderia_phage	89.0	6.1e-215
>prophage 6
NZ_CP038227	Burkholderia pseudomallei strain Yap1 chromosome 2, complete sequence	3208533	2331461	2415565	3208533	protease,head,plate,transposase,tail	Burkholderia_virus(46.43%)	94	NA	NA
WP_085955848.1|2331461_2332620_+|transposase	IS3-like element ISBps2 family transposase	transposase	A4JX31	Burkholderia_virus	99.3	5.0e-78
WP_004539128.1|2332728_2332977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539130.1|2333437_2333638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524130.1|2333630_2333903_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004184766.1|2334006_2335401_-	heavy metal sensor histidine kinase IrlS	NA	W8CYF6	Bacillus_phage	28.9	1.2e-20
WP_004197868.1|2335397_2336087_-	heavy metal response regulator transcription factor IrlR	NA	W8CYM9	Bacillus_phage	36.8	1.7e-36
WP_076891338.1|2336093_2339327_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_024428522.1|2339372_2340842_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006485401.1|2342469_2342841_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	100.0	8.5e-64
WP_151018817.1|2342837_2343278_-	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	93.8	1.6e-72
WP_025992374.1|2343261_2343603_-	DUF2528 family protein	NA	Q6QIE6	Burkholderia_phage	95.6	4.2e-57
WP_009910736.1|2343696_2343969_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	96.7	8.2e-40
WP_009910737.1|2344032_2344650_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	99.5	6.3e-112
WP_009910738.1|2344773_2344983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009910739.1|2344979_2345309_-	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	89.8	3.6e-50
WP_151018857.1|2345310_2346522_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	99.0	1.6e-220
WP_151018819.1|2346521_2348321_-|transposase	transposase family protein	transposase	Q6QIE0	Burkholderia_phage	97.0	0.0e+00
WP_151018821.1|2348338_2349265_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	80.8	1.2e-127
WP_151018823.1|2349278_2349584_-	helix-turn-helix domain-containing protein	NA	Q6QID7	Burkholderia_phage	84.5	1.0e-38
WP_151018825.1|2349580_2350060_-	hypothetical protein	NA	Q6QID6	Burkholderia_phage	98.1	9.3e-87
WP_060220689.1|2350180_2350417_+	hypothetical protein	NA	Q6QID5	Burkholderia_phage	96.2	9.0e-35
WP_006485399.1|2350465_2350708_-	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	100.0	4.4e-37
WP_151018827.1|2350801_2351233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151018829.1|2351236_2352070_+	hypothetical protein	NA	Q6QID1	Burkholderia_phage	42.4	1.4e-08
WP_151018831.1|2352138_2352660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009910756.1|2352776_2352965_+	hypothetical protein	NA	A4JWP0	Burkholderia_virus	100.0	5.0e-28
WP_009910758.1|2352945_2353482_+	hypothetical protein	NA	A4JWP1	Burkholderia_virus	98.3	3.7e-92
WP_151018832.1|2353549_2353774_+	hypothetical protein	NA	A4JWP2	Burkholderia_virus	98.6	5.5e-34
WP_006485400.1|2353840_2354188_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	100.0	8.0e-56
WP_009910760.1|2354190_2354802_+	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	97.5	4.5e-110
WP_038769559.1|2354798_2355398_+	hypothetical protein	NA	A4JWP5	Burkholderia_virus	89.9	3.5e-91
WP_025992379.1|2355394_2355733_+	hypothetical protein	NA	A4JWP6	Burkholderia_virus	99.1	1.4e-52
WP_006485389.1|2355729_2356062_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	100.0	8.7e-60
WP_009910765.1|2356063_2356609_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	100.0	3.0e-89
WP_151018834.1|2356605_2358108_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	98.6	3.1e-290
WP_015985080.1|2358104_2359580_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	100.0	4.3e-284
WP_038798100.1|2359572_2360409_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	99.6	7.9e-166
WP_009910771.1|2360405_2360933_+	phage virion morphogenesis protein	NA	A4JWJ7	Burkholderia_virus	100.0	2.8e-92
WP_151018859.1|2361147_2362263_+	peptidase	NA	A4JWJ9	Burkholderia_virus	91.6	3.3e-196
WP_038798135.1|2362308_2363232_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	99.3	3.4e-170
WP_151018836.1|2363306_2363639_+	DUF2190 family protein	NA	A4JWK1	Burkholderia_virus	98.2	2.8e-50
WP_009910777.1|2363640_2364093_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	99.3	6.1e-80
WP_038798103.1|2364092_2364557_+	hypothetical protein	NA	A4JWK3	Burkholderia_virus	96.1	6.9e-79
WP_009910780.1|2364553_2364799_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	98.8	5.3e-38
WP_009910781.1|2364802_2366236_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	97.1	5.7e-265
WP_009910782.1|2366238_2366763_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	97.1	7.2e-93
WP_025992380.1|2366884_2367214_+|tail	phage tail assembly protein	tail	A4JWK7	Burkholderia_virus	93.6	3.8e-47
WP_050791341.1|2367140_2367344_+	hypothetical protein	NA	Q6QIA7	Burkholderia_phage	95.5	3.7e-29
WP_009910787.1|2367346_2367589_-	hypothetical protein	NA	A4JWK9	Burkholderia_virus	95.0	1.7e-33
WP_151018838.1|2367618_2370231_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	96.3	0.0e+00
WP_151018840.1|2370232_2371123_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	99.2	9.7e-106
WP_009910792.1|2371122_2371332_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	94.2	3.1e-31
WP_151018842.1|2371319_2372528_+	phage protein D	NA	A4JWL3	Burkholderia_virus	98.5	1.3e-214
WP_038798106.1|2372524_2373127_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	97.5	4.9e-101
WP_009910797.1|2373180_2373534_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	99.1	2.0e-62
WP_009910798.1|2373530_2374682_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	93.5	1.4e-197
WP_038798108.1|2374674_2375256_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	90.2	6.2e-93
WP_151018861.1|2376449_2377271_+|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	76.7	5.8e-97
WP_151018844.1|2377407_2378481_-	acyltransferase	NA	A9YX16	Burkholderia_phage	46.6	5.1e-85
WP_004197874.1|2378892_2379078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004532722.1|2379094_2379379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524134.1|2379776_2379917_-	bacteriophage protein	NA	NA	NA	NA	NA
WP_004197879.1|2380617_2381106_-	membrane protein	NA	NA	NA	NA	NA
WP_004197880.1|2381437_2381923_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004528294.1|2382277_2383393_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_004536620.1|2383457_2383691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524142.1|2384117_2384447_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011205535.1|2384460_2385012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004543456.1|2385022_2385307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004528297.1|2385347_2385527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075019091.1|2385451_2386288_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_004528299.1|2386655_2387231_+	DUF2760 domain-containing protein	NA	NA	NA	NA	NA
WP_004539133.1|2387227_2389075_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_004553375.1|2389078_2391886_+	hsp70 family protein	NA	A0A2H4UU19	Bodo_saltans_virus	26.1	1.7e-07
WP_009968343.1|2392174_2393308_-	CapA family protein	NA	S4VS02	Pandoravirus	56.2	7.2e-114
WP_004554974.1|2393876_2394137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024428523.1|2395623_2396247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044353068.1|2396298_2398812_-	cation-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	27.9	4.8e-57
WP_085547278.1|2398909_2399389_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_011205539.1|2400402_2401212_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_076891343.1|2401188_2401470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009981568.1|2401466_2402897_-	thiamine pyridinylase	NA	NA	NA	NA	NA
WP_004542833.1|2402986_2403787_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_076911642.1|2403783_2404011_-	heat-shock protein Hsp70	NA	NA	NA	NA	NA
WP_004528317.1|2404028_2404769_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004528318.1|2404784_2405774_-	thymidylate synthase	NA	NA	NA	NA	NA
WP_004528319.1|2405775_2406231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011205540.1|2406227_2406791_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	42.9	1.9e-14
WP_004531806.1|2407289_2408084_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_150977214.1|2408140_2409289_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_004528326.1|2409484_2410321_-	EamA family transporter	NA	NA	NA	NA	NA
WP_150977212.1|2411004_2412495_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_004531808.1|2412803_2413412_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004528329.1|2413564_2415565_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	46.2	6.4e-105
