The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	453342	486600	5438014	protease,tail,integrase,head,portal,capsid,tRNA,terminase	uncultured_Caudovirales_phage(73.33%)	35	470950:470967	486945:486962
WP_002919147.1|453342_454290_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|454304_454814_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|454942_456067_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|456038_456512_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|456537_457080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|457084_457657_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|457660_458479_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|458475_458733_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|458708_459263_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|465058_465280_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|465573_468684_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|468696_469836_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|470214_470865_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
470950:470967	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|471140_472367_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|472459_473401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|473582_473867_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|473877_474657_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|474780_474975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|475108_475378_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|475370_475559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|475551_475866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|475862_476231_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|476227_476593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|476592_478728_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|479070_479406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|479454_479967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|480230_481397_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|481448_482009_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|482010_483252_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|483248_483584_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|483580_483880_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|483879_484323_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004198610.1|484449_484641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113647.1|484598_484955_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|484938_486600_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
486945:486962	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	1217297	1266441	5438014	tail,lysis,integrase,tRNA,transposase,head,plate,portal,capsid,coat,terminase	Salmonella_phage(80.0%)	63	1209912:1209929	1245975:1245992
1209912:1209929	attL	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
WP_000019473.1|1217297_1218278_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1218323_1219322_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1219324_1219954_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1220076_1220319_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1220351_1220861_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1220868_1221069_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1221032_1221371_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1221438_1221672_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1221671_1221899_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1221895_1222747_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1222743_1225128_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_009483812.1|1225357_1225609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|1225608_1227093_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1227200_1227389_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1227400_1227634_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1227729_1228413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1228399_1229479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1229478_1230480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1231001_1231271_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1231327_1232371_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_151085624.1|1232370_1234134_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.6	0.0e+00
WP_004151004.1|1234274_1235108_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1235124_1236177_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1236180_1236834_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1236929_1237394_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1237393_1237597_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1237600_1237816_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1237796_1238306_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1238310_1238694_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1238690_1239119_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_085955118.1|1239048_1239252_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
WP_004150997.1|1239214_1239637_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1239629_1240076_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1240098_1240965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1241059_1241632_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1241628_1241991_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1241977_1242886_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1242878_1243550_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1243551_1245501_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1245510_1246629_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
1245975:1245992	attR	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
WP_004150988.1|1246680_1247754_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1247902_1249075_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1249084_1249600_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1249652_1249952_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1249966_1250086_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1250078_1252709_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1252705_1253191_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1253187_1254282_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1254348_1254567_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1254594_1254972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1255575_1256058_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1256168_1256645_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1256634_1256925_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1256991_1257333_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1257480_1259142_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1259228_1260107_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1260231_1260822_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1260941_1262228_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1262247_1263039_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1263202_1264567_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1264826_1265075_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1265093_1265642_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1265673_1266441_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	1371157	1443243	5438014	protease,tail,integrase,transposase,holin,terminase	Salmonella_phage(37.5%)	77	1372152:1372169	1445991:1446008
WP_004151980.1|1371157_1372624_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
1372152:1372169	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
WP_004151979.1|1372691_1374269_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1374460_1375711_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1375653_1375896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1375892_1376486_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1376482_1377145_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1377141_1377300_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1377292_1377586_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1377695_1377944_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1377992_1378874_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1378870_1379692_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1379688_1379988_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1380354_1380936_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1381090_1381324_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1381470_1381680_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1381679_1382447_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1382443_1383229_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1383348_1383696_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1383888_1384299_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1384282_1384474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1384470_1385115_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1385408_1385876_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1385875_1386169_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1386165_1386786_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1386785_1386989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1386981_1387320_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|1387416_1388901_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|1388900_1389152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418540.1|1389304_1389562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1389639_1390224_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1390220_1391696_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1391739_1392111_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_072354015.1|1392160_1392403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004141368.1|1392864_1393071_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1393085_1394768_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
WP_004152446.1|1394764_1395061_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1395063_1395744_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1395758_1396745_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_151085626.1|1396798_1397236_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	1.8e-65
WP_062955141.1|1397246_1397588_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1397638_1397962_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1397961_1398567_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1398566_1401044_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1401043_1401508_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1401507_1402047_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1402057_1404592_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1404591_1406502_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1406501_1409258_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955134.1|1409254_1409449_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
WP_071787028.1|1409483_1409636_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
WP_062955133.1|1409734_1410031_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_062955131.1|1412858_1413122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093939511.1|1413162_1414431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000608644.1|1415059_1416322_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|1417430_1418747_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1418833_1419238_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1419224_1419530_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1419519_1420149_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1420145_1420646_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1420832_1422701_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004162150.1|1422684_1423863_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_002913847.1|1424156_1425389_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913846.1|1425486_1426374_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913843.1|1426470_1426662_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
WP_002913841.1|1427014_1429243_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913839.1|1429296_1430829_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913838.1|1430832_1432893_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004152007.1|1433073_1433715_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913836.1|1433711_1434749_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_002913833.1|1435012_1435906_+	beta-glucoside kinase	NA	NA	NA	NA	NA
WP_002913829.1|1435915_1437349_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913827.1|1437566_1438193_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913824.1|1438288_1439575_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|1439673_1440375_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913812.1|1440371_1441283_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_002913810.1|1441410_1441770_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913807.1|1441779_1443243_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
1445991:1446008	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 4
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	1752898	1759804	5438014		Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1752898_1753762_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1753772_1754546_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1754787_1755681_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1755926_1757288_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1757606_1758329_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_062955084.1|1758325_1759804_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	1799098	1816044	5438014	transposase	Escherichia_phage(38.46%)	17	NA	NA
WP_062955058.1|1799098_1800505_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_062955056.1|1800728_1801793_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
WP_062956182.1|1801806_1802676_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
WP_048996045.1|1802707_1803598_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_004175260.1|1803612_1804167_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_000704907.1|1804346_1805513_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_016947628.1|1805941_1806061_-	small membrane protein	NA	NA	NA	NA	NA
WP_062955151.1|1806461_1807466_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
WP_075053193.1|1807421_1807703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073547076.1|1808305_1809370_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_063002077.1|1809383_1810253_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_048996045.1|1810284_1811175_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_015958693.1|1811189_1811744_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_094948683.1|1811830_1812385_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000019445.1|1812425_1813406_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_062955124.1|1813889_1814723_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_062955125.1|1814712_1816044_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	6.9e-15
>prophage 6
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	2777509	2788396	5438014		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2777509_2780617_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2780671_2781937_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2781967_2783056_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2783142_2783403_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2783700_2784561_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2784581_2785343_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2785603_2786506_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2786517_2787783_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2787775_2788396_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	3015283	3053018	5438014	transposase,terminase,integrase	uncultured_Caudovirales_phage(33.33%)	57	3008556:3008615	3051970:3053166
3008556:3008615	attL	GGAAGGTGCGAACAAGTTCCTGATATGAGATCATCATATTCATCCGGAGCGCATCCCAGA	NA	NA	NA	NA
WP_004152576.1|3015283_3016150_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3016149_3016923_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_151085640.1|3016919_3018116_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.6	1.1e-157
WP_004152573.1|3018115_3018469_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3018470_3019124_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3019177_3019744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3019780_3019966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3020018_3020360_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3020359_3021382_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3021384_3021687_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3021687_3022287_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3022286_3024290_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3024279_3024432_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3024467_3024893_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3024896_3025337_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3025347_3026493_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3026496_3026937_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3027031_3027418_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3027417_3027924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3027920_3028340_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3028308_3028590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3028629_3029571_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3029582_3030077_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3030080_3031283_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3031334_3031883_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3031938_3033390_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3033627_3035028_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3034978_3035731_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3035832_3036153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064754420.1|3036245_3036503_-	hypothetical protein	NA	S5FXQ4	Shigella_phage	70.9	2.3e-23
WP_004153952.1|3036387_3036777_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3036773_3037304_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3037306_3037555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3037960_3038743_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3038739_3039216_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3039212_3040175_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3040176_3041835_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152163.1|3042143_3042437_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
WP_004152162.1|3042411_3042633_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3042730_3043399_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3043569_3043884_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3043876_3044065_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3044234_3044600_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3044592_3044847_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3044818_3045037_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|3045033_3045459_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3045455_3045650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3045646_3046474_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3046578_3047097_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3047102_3047813_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3047802_3048027_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3048023_3048236_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3048232_3048712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3048890_3049133_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3049113_3050295_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3050491_3051040_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_000019473.1|3052037_3053018_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
3051970:3053166	attR	GGAAGGTGCGAACAAGTTCCTGATATGAGATCATCATATTCATCCGGAGCGCATCCCAGAGGGACATCATGAGCCATCAACTCACCTTCGCCGATAGTGAATTCAGCACTAAGCGCCGTCAGACCCGAAAAGAGATTTTCCTCTCCCGCATGGAGCAGATTCTGCCATGGCAAAACATGGTGGAAGTCATCGAGCCGTTTTATCCCAAGGCGGGCAATGGCCGACGGCCCTATCCGCTGGAGACCATGCTGCGTATTCACTGCATGCAGCATTGGTACAACCTGAGCGACGGTGCCATGGAAGATGCCCTGTACGAAATCGCCTCCATGCGCCTGTTTGCCCGATTATCCCTGGATAGCGCCCTGCCGGATCGCACCACCATCATGAATTTCCGCCACCTGCTCGAGCAGCATCAACTGGCCCGTCAATTGTTCAAGACCATCAATCGCTGGCTGGCCGAAGCAGGCGTCATGATGACCCAAGGCACTTTGGTGGATGCCACCATCATTGAGGCACCCAGCTCTACCAAGAACAAAGAGCAGCAACGCGATCCGGAGATGCATCAGACCAAGAAAGGCAATCAGTGGCACTTTGGCATGAAGGCCCACATTGGTGTCGATGCCAAGAGTGGCCTGACCCACAGCCTAGTCACCACCGCGGCCAACGAGCATGACCTCAATCAGCTGGGTAATCTGCTTCATGGAGAGGAGCAATTTGTCTCAGCCGATGCCGGCTACCAAGGAGCGCCACAGCGCGAGGAGCTGGCCGAGGTGGATGTGGACTGGCTGATCGCCGAGCGTCCCGGCAAGGTAAAAACCTTGAAGCAGCATCCGCGCAAGAACAAAACGGCCATCAACATCGAATACATGAAAGCCAGCATCCGTGCCAGGGTGGAGCACCCGTTTCGCATCATCAAGCGGCAGTTCGGCTTCGTGAAAGCCAGATACAAAGGGCTGCTGAAAAACGATAACCAACTGGCGATGTTATTCACCCTGGCCAACCTGTTTCGGGTGGACCAAATGATACGTCAGTGGGAGAGATCTCAGTAAAAACCGGAAATAACGCCAGAAATGGTGGAAAAAATAGCCTAAATAGGCTGATTCGATGTGTTTGCGGGAAAAAAATCGGCCCAGATCCGCGAAATTTTAATCAGCGAGTCAGCTTGGGAAGAAATGACCTGCTTATTCGCACCTTCCT	NA	NA	NA	NA
>prophage 8
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	3087882	3115322	5438014	transposase,integrase,holin	Enterobacteria_phage(38.71%)	40	3087664:3087679	3112628:3112643
3087664:3087679	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3087882_3088554_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3088740_3089568_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3089643_3090909_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3090910_3091330_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3091409_3092894_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3092893_3093145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152776.1|3093791_3094214_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3094806_3095511_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3095547_3095835_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3095831_3096371_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3096367_3096667_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004232548.1|3097316_3098006_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3098005_3098146_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3098142_3098781_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3098773_3099442_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3099438_3099606_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3099586_3100054_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3100574_3101603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3101810_3102056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3102111_3102414_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3102410_3103259_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3103255_3104116_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3104201_3104423_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3104463_3104691_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3104802_3105501_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3105523_3105643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3105788_3106865_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3106946_3107150_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3107578_3107773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3107861_3108146_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3108161_3109007_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3109003_3109291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3109292_3109973_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3109969_3110398_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3110394_3111057_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004190725.1|3111053_3111368_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_004153574.1|3111264_3112452_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3112628_3113519_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3112628:3112643	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3113518_3114511_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3114512_3115322_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 9
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	3242994	3370424	5438014	protease,tail,lysis,integrase,holin,transposase,head,portal,capsid,tRNA,terminase	Klebsiella_phage(25.81%)	149	3269797:3269811	3368235:3368249
WP_002901088.1|3242994_3243495_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3243611_3244058_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3244041_3244833_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|3244934_3246119_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3246150_3246843_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3246988_3247498_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3247484_3247841_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|3247830_3248070_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3248370_3249384_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3249441_3249543_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3249542_3249617_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3249734_3249860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3249919_3250183_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004148038.1|3251041_3251956_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3252617_3253661_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3253963_3255172_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3255245_3257030_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3257036_3257927_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3258047_3259556_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3259866_3260553_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3260950_3261130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3261169_3261802_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3262368_3262566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3262681_3263692_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3263688_3265095_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3265150_3266038_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3266054_3266561_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3266587_3267082_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3267172_3267358_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3267979_3269173_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3269285_3269513_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3269797:3269811	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3269949_3270273_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3270265_3270658_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3270654_3271368_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3271640_3271793_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3271947_3273444_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3273512_3286217_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3286279_3286873_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3286899_3287322_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3287363_3288074_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3288075_3288831_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3288827_3289166_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3289165_3292501_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_071836352.1|3292500_3292719_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
WP_014228914.1|3292733_3293099_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3293156_3293618_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3293649_3294051_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3294047_3294437_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3294417_3294756_-	hypothetical protein	NA	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3294752_3295070_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3295050_3295311_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3295369_3296656_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3296733_3297654_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3297690_3298950_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3298949_3299129_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3299122_3300844_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3300843_3301278_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3301526_3301958_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3301954_3302278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3302229_3302592_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3302918_3303143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3303181_3303619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3304568_3304919_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3304915_3305413_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3305412_3305628_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|3306545_3306695_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3307432_3307636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3307879_3308482_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3308498_3309530_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_017898980.1|3309529_3309733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025861428.1|3309729_3310122_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3310162_3310453_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3310464_3310698_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004152765.1|3310776_3312261_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3312260_3312512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954975.1|3313101_3314463_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_151085641.1|3314636_3315350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|3315701_3316571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|3316659_3318051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3318399_3318840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3318853_3319318_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3319310_3320315_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3320374_3320929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3320931_3321156_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3321244_3321682_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3322003_3322318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099143961.1|3322480_3322699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3322708_3322903_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3322945_3323290_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3323431_3325570_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3325622_3325868_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3325848_3326976_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004892953.1|3327093_3327246_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_000664594.1|3327424_3327796_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	1.2e-25
WP_032443530.1|3327752_3327992_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.7	6.8e-22
WP_096735704.1|3328097_3329408_-	hypothetical protein	NA	A0A0K2FI18	Enterobacter_phage	34.5	4.2e-41
WP_000019473.1|3329734_3330715_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_099721912.1|3333558_3336636_-	kinase	NA	A0A286S259	Klebsiella_phage	62.1	0.0e+00
WP_025713372.1|3336632_3337013_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	2.7e-57
WP_004864228.1|3337025_3337502_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004884312.1|3337488_3337962_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_000019473.1|3340706_3341687_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_016530182.1|3342630_3342864_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_050849660.1|3342937_3343243_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_029497345.1|3343245_3343650_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	3.2e-32
WP_021313623.1|3343680_3344385_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	2.5e-80
WP_016530186.1|3344441_3344789_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_048997608.1|3344785_3345235_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	83.2	2.3e-63
WP_032408655.1|3345231_3345570_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_021313626.1|3345578_3345899_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
WP_077254151.1|3345895_3346111_-	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	1.9e-07
WP_021313628.1|3346137_3347346_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
WP_004884313.1|3347360_3348014_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
WP_094818659.1|3348000_3349230_-|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
WP_021313630.1|3349229_3349415_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	63.9	5.2e-14
WP_032418747.1|3349424_3351155_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	9.2e-302
WP_004884285.1|3351151_3351646_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_001111092.1|3351776_3352127_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	79.3	6.0e-51
WP_001223373.1|3352114_3352348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001031858.1|3352518_3352785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274212.1|3352781_3353090_-	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	55.1	5.5e-16
WP_000903809.1|3353185_3353389_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	88.9	5.6e-17
WP_000510547.1|3353345_3353615_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	62.9	3.8e-21
WP_001077080.1|3353617_3354247_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	3.2e-87
WP_000243811.1|3354246_3354528_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_001294159.1|3354514_3354901_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_001018764.1|3355066_3355306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099721910.1|3355456_3356035_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_099721909.1|3356048_3357029_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.6	7.1e-134
WP_000779146.1|3357041_3357419_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_099721908.1|3357428_3358238_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	5.3e-111
WP_096735696.1|3358234_3359149_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	59.6	3.1e-30
WP_096735697.1|3359111_3359318_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	9.0e-15
WP_040188690.1|3359555_3360008_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.8	3.5e-67
WP_061154047.1|3360042_3360240_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	86.2	1.7e-23
WP_040188688.1|3360339_3360996_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	88.1	1.5e-108
WP_047928777.1|3361607_3361907_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	3.2e-13
WP_099721907.1|3361906_3362692_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.9	1.3e-61
WP_096735657.1|3362819_3363323_+	hypothetical protein	NA	Q858D1	Salmonella_phage	53.1	5.8e-31
WP_048290360.1|3363319_3363520_+	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	70.6	2.5e-09
WP_077264223.1|3363512_3364667_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	56.2	3.5e-47
WP_057729186.1|3364644_3364863_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	4.6e-09
WP_071562415.1|3364862_3365135_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	4.4e-09
WP_000089156.1|3365163_3365400_+	excisionase	NA	NA	NA	NA	NA
WP_000741346.1|3365389_3366532_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_004150800.1|3366644_3367895_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3368135_3368786_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3368235:3368249	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3368802_3369261_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3369317_3370424_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	3586949	3673765	5438014	protease,tail,lysis,integrase,transposase,plate,head,portal,capsid,tRNA,terminase	Salmonella_phage(49.02%)	84	3642475:3642493	3673840:3673858
WP_002898139.1|3586949_3588242_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3588332_3589676_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3589684_3590296_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3590418_3594672_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_151085643.1|3594807_3595302_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3595807_3596803_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3596917_3598684_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3598684_3600406_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3600450_3601152_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3601505_3601724_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3601844_3604124_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3604154_3604472_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3604797_3605019_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3605095_3607036_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3607032_3608148_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3608294_3609953_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3610372_3611068_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3611183_3612083_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3612226_3613879_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3613889_3614858_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3615069_3615504_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3615655_3617374_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3617412_3618414_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3618424_3619867_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3619954_3620968_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3620964_3621795_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3621826_3622966_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3623843_3624359_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3624585_3625314_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3625334_3626066_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3626072_3626789_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3626788_3627457_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3627640_3628372_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3628414_3629887_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3629883_3630600_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3630678_3631806_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3631847_3632336_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3632393_3633239_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3633235_3634189_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3634199_3635333_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3635496_3636609_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3636957_3637437_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3637525_3638428_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3639249_3639537_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_002896352.1|3639739_3640003_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3640009_3640393_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3640659_3642345_+	transporter	NA	NA	NA	NA	NA
3642475:3642493	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3642564_3642783_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3642874_3643975_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3643971_3644457_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3644453_3647081_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3647073_3647193_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3647207_3647507_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3647559_3648075_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3648084_3649257_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3649395_3650472_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3650501_3650705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3650701_3651433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3651436_3654388_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3654389_3654989_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3654981_3655890_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3655876_3656239_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3656235_3656808_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3656902_3657595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3657591_3658038_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3658030_3658462_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3658557_3658986_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3658982_3659366_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3659370_3659880_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3659860_3660076_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3660079_3660283_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3660282_3660747_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3660842_3661493_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3661496_3662555_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3662571_3663405_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3663547_3665314_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3665313_3666339_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_012579081.1|3666614_3667538_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_000700647.1|3669484_3670162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3670276_3670510_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3670520_3670709_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004152765.1|3670809_3672294_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3672293_3672545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151720.1|3672712_3673765_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3673840:3673858	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	4325551	4337204	5438014	integrase	Enterobacteria_phage(70.0%)	13	4326001:4326015	4349056:4349070
WP_004144574.1|4325551_4326655_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4326001:4326015	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4326665_4327919_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4328271_4329462_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4329449_4330400_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4330399_4330825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4331392_4331959_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4331976_4332222_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4332218_4332956_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4333497_4333764_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4333760_4334318_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4334314_4334542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4334538_4334859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889890.1|4334870_4337204_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4349056:4349070	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 12
NZ_CP044258	Klebsiella pneumoniae strain KP65 chromosome, complete genome	5438014	4805440	4814965	5438014	transposase	Enterobacteria_phage(83.33%)	10	NA	NA
WP_004152207.1|4805440_4807774_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4807788_4808109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152205.1|4808105_4808333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4808329_4808878_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|4809701_4810439_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4810435_4810681_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4810698_4811265_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152201.1|4812005_4813085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152200.1|4813085_4813622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4813984_4814965_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP044259	Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence	144422	1796	32315	144422	transposase,integrase,protease	Escherichia_phage(68.42%)	28	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013188475.1|5659_6535_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_012579081.1|6614_7538_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001067855.1|9288_9993_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|11103_11808_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839979.1|11873_12392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|12396_12813_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|13198_13903_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000957857.1|14580_14769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|14860_15397_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|15579_16440_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|16609_17365_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067858.1|17814_18519_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067855.1|19806_20511_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_151085653.1|20547_21219_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-125
WP_001067855.1|21620_22325_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013214011.1|22674_23946_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_086523286.1|24027_25005_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977818.1|25001_26207_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_004118283.1|27316_28183_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_013214010.1|28960_29218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214009.1|29263_30043_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_011977814.1|30226_31231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977813.1|31260_31464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|31610_32315_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP044259	Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence	144422	61144	96043	144422	transposase	Escherichia_phage(35.71%)	50	NA	NA
WP_001067858.1|61144_61849_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_071557810.1|61839_61980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333089.1|63790_64072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|64194_64545_-	protein stbB	NA	NA	NA	NA	NA
WP_000959884.1|64547_65510_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|65656_65950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072109530.1|65890_66070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|66026_66710_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|66710_66932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|66945_67380_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_011161242.1|68079_68652_+	YubH family protein	NA	NA	NA	NA	NA
WP_001198928.1|68624_69050_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271762.1|69096_69519_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001027493.1|69515_69707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012372796.1|70020_71688_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_015059006.1|72567_72825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|73087_73318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|73369_74731_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_015059007.1|74777_75341_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	6.1e-21
WP_021537720.1|75340_75589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072206670.1|75492_75708_+	transporter	NA	NA	NA	NA	NA
WP_012881134.1|75882_76119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290834.1|76183_76711_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|76768_77002_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000845953.1|79154_79589_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276217.1|79585_80305_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|80584_80743_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001309236.1|80965_81184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012881134.1|81358_81595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272251.1|81657_81954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234445.1|82064_82886_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_015059008.1|83182_83830_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|84106_84490_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_015059009.1|84680_85367_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_001254386.1|85460_85688_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_021519752.1|85721_86087_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012106.1|86101_86413_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399794.1|86434_87001_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_151085654.1|86987_87251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|87196_87901_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_151085655.1|87891_88530_+	replication protein	NA	NA	NA	NA	NA
WP_013213990.1|89063_89342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213989.1|89452_89878_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213987.1|90206_90503_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|91245_91950_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_151085656.1|91920_92316_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004199234.1|92565_93447_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213985.1|93722_94703_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_014343468.1|94825_95299_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_001067855.1|95338_96043_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP044259	Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence	144422	107555	121361	144422	transposase	Enterobacteria_phage(18.18%)	18	NA	NA
WP_000019445.1|107555_108536_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_015493087.1|109049_109445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493086.1|109441_110053_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493085.1|110049_111000_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_040219232.1|111146_111347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652286.1|111400_112033_-	LacI family DNA-binding transcriptional regulator	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_015493083.1|112395_113601_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479949.1|113597_114569_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493081.1|114704_115976_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_015493080.1|115975_116398_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493079.1|116577_117249_-	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_002211749.1|117607_118285_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493077.1|118284_118506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|118516_118936_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493075.1|118989_119769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|120173_120680_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493073.1|120722_120914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072906.1|121100_121361_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
