The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	444922	515606	5483867	protease,tRNA,head,capsid,terminase,transposase,tail,portal,integrase	uncultured_Caudovirales_phage(57.89%)	75	462530:462547	478525:478542
WP_002919147.1|444922_445870_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|445884_446394_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|446522_447647_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|447618_448092_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|448117_448660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|448664_449237_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|449240_450059_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|450055_450313_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|450288_450843_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|456638_456860_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|457153_460264_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|460276_461416_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|461794_462445_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
462530:462547	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|462720_463947_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|464039_464981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|465162_465447_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|465457_466237_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|466360_466555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|466688_466958_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|466950_467139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|467131_467446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|467442_467811_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|467807_468173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|468172_470308_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|470650_470986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|471034_471547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|471810_472977_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|473028_473589_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|473590_474832_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|474828_475164_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|475160_475460_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|475459_475903_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004198610.1|476029_476221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113647.1|476178_476535_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|476518_478180_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_004150954.1|478182_478374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|478527_478824_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
478525:478542	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004144972.1|478848_479814_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_086549907.1|479971_480199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918745.1|480171_481053_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002918742.1|481064_482516_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918740.1|482505_482748_-	YhdT family protein	NA	NA	NA	NA	NA
WP_002918738.1|482858_484208_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918736.1|484218_484686_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918732.1|484708_485161_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918689.1|485384_485993_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918688.1|485992_486994_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_151090907.1|487222_487408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|487443_488635_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_002918686.1|488799_490740_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918653.1|491045_492089_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004149974.1|492159_493152_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918648.1|493151_493640_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002918646.1|493647_494229_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918644.1|494231_495701_+	ribonuclease G	NA	NA	NA	NA	NA
WP_004150952.1|495738_499536_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918642.1|499624_501070_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918641.1|501105_502035_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|502166_502370_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002918639.1|502377_503310_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918632.1|503315_505283_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918629.1|505362_505638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918627.1|505688_505955_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918626.1|506053_506317_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918625.1|506692_507163_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918570.1|507577_508516_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918568.1|508652_509711_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_062954970.1|509798_511166_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918565.1|511339_511738_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004144945.1|511928_513056_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|513321_513750_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|513765_514158_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_135801240.1|514215_514500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918467.1|514469_515108_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002918465.1|515111_515606_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	1173074	1259713	5483867	tRNA,head,coat,capsid,transposase,terminase,tail,portal,lysis,plate,integrase	Salmonella_phage(67.92%)	100	1188134:1188153	1236814:1236833
WP_002914765.1|1173074_1175702_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_099119228.1|1175773_1175956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|1175999_1177192_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_000906486.1|1177371_1177557_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914359.1|1179078_1179393_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_002914355.1|1180081_1180510_+	DedA family protein	NA	NA	NA	NA	NA
WP_002914353.1|1180576_1182133_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002914351.1|1182289_1182805_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002914345.1|1182857_1183625_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914344.1|1183603_1185280_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002914342.1|1185416_1186955_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_002914339.1|1186970_1188143_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
1188134:1188153	attL	TTGCACTCATGTTATTCTCC	NA	NA	NA	NA
WP_002914337.1|1188268_1188799_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_002914335.1|1188889_1189225_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_002914333.1|1189214_1189961_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002914330.1|1190138_1191137_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_004151038.1|1191215_1192283_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_002914328.1|1192275_1193478_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
WP_002914327.1|1193834_1194797_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914325.1|1194807_1196949_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914321.1|1196921_1197332_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914320.1|1197328_1197574_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_004151037.1|1197757_1198189_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004149442.1|1198277_1199630_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002914293.1|1199773_1200121_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002914291.1|1200270_1200633_+	YgaC family protein	NA	NA	NA	NA	NA
WP_002914289.1|1200718_1201168_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_004217499.1|1201286_1201472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914287.1|1201896_1202298_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_002914284.1|1202370_1202550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914281.1|1202755_1203658_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
WP_002914279.1|1203638_1204184_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_002914277.1|1204191_1204491_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914274.1|1204566_1205172_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004145715.1|1205275_1206184_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151036.1|1206266_1208054_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151035.1|1208317_1209838_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000019473.1|1210569_1211550_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1211595_1212594_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1212596_1213226_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1213348_1213591_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1213623_1214133_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1214140_1214341_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1214304_1214643_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1214710_1214944_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1214943_1215171_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1215167_1216019_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1216015_1218400_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_009483812.1|1218629_1218881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|1218880_1220365_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1220472_1220661_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1220672_1220906_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1221001_1221685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1221671_1222751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1222750_1223752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1224273_1224543_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1224599_1225643_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1225642_1227406_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1227546_1228380_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1228396_1229449_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1229452_1230106_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1230201_1230666_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1230665_1230869_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1230872_1231088_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1231068_1231578_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1231582_1231966_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1231962_1232391_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_085955118.1|1232320_1232524_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
WP_004150997.1|1232486_1232909_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1232901_1233348_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1233370_1234237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1234331_1234904_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1234900_1235263_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1235249_1236158_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1236150_1236822_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1236823_1238773_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
1236814:1236833	attR	GGAGAATAACATGAGTGCAA	NA	NA	NA	NA
WP_004200602.1|1238782_1239901_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1239952_1241026_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1241174_1242347_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1242356_1242872_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1242924_1243224_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1243238_1243358_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1243350_1245981_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1245977_1246463_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1246459_1247554_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1247620_1247839_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1247866_1248244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1248847_1249330_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1249440_1249917_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1249906_1250197_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1250263_1250605_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1250752_1252414_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1252500_1253379_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1253503_1254094_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1254213_1255500_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1255519_1256311_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1256474_1257839_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1258098_1258347_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1258365_1258914_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1258945_1259713_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	1365735	1419677	5483867	terminase,holin,transposase,tail,integrase	Salmonella_phage(38.89%)	63	1359070:1359084	1389174:1389188
1359070:1359084	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|1365735_1367202_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1367269_1368847_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1369038_1370289_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1370231_1370474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1370470_1371064_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1371060_1371723_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1371719_1371878_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1371870_1372164_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1372273_1372522_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1372570_1373452_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1373448_1374270_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1374266_1374566_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1374932_1375514_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1375668_1375902_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1376048_1376258_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1376257_1377025_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1377021_1377807_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1377926_1378274_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1378466_1378877_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1378860_1379052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1379048_1379693_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1379986_1380454_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1380453_1380747_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1380743_1381364_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1381363_1381567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1381559_1381898_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|1381994_1383479_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|1383478_1383730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418540.1|1383881_1384139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1384216_1384801_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1384797_1386273_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1386316_1386688_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_072354015.1|1386737_1386980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004141368.1|1387441_1387648_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1387662_1389345_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
1389174:1389188	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|1389341_1389638_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1389640_1390321_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1390335_1391322_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1391375_1391813_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1391823_1392165_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1392215_1392539_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1392538_1393144_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1393143_1395621_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1395620_1396085_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1396084_1396624_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1396634_1399169_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1399168_1401079_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1401078_1403835_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955134.1|1403831_1404026_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
WP_071787028.1|1404060_1404213_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
WP_062955133.1|1404311_1404608_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_000019473.1|1406732_1407713_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_151090908.1|1407738_1408623_+	hypothetical protein	NA	A0A0A8J9B0	Klebsiella_phage	31.2	5.4e-16
WP_062955131.1|1408635_1408899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123766426.1|1408939_1409767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094959062.1|1410186_1411167_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_000608644.1|1412035_1413298_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|1414406_1415723_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1415809_1416214_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1416200_1416506_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1416495_1417125_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1417121_1417622_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1417808_1419677_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	1752028	1758933	5483867		Planktothrix_phage(33.33%)	6	NA	NA
WP_072353998.1|1752028_1752892_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_094818808.1|1752902_1753676_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_002912636.1|1753916_1754810_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1755055_1756417_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1756735_1757458_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_072353997.1|1757454_1758933_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	1784560	1815992	5483867	transposase,coat	Escherichia_phage(42.86%)	30	NA	NA
WP_000019445.1|1784560_1785541_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_151090910.1|1785585_1786716_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_071557784.1|1786716_1787151_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_151090911.1|1787167_1789165_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_151090912.1|1789080_1789284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|1789265_1790246_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_072353992.1|1790644_1792168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107317138.1|1792172_1793045_+	hypothetical protein	NA	A0A1V0SAR6	Catovirus	28.7	1.2e-20
WP_052285805.1|1793063_1794020_+	hypothetical protein	NA	A0A0N9QWP9	Chrysochromulina_ericina_virus	30.7	8.7e-36
WP_045327208.1|1794075_1795287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077273874.1|1795310_1796288_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_123677149.1|1796292_1797327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071557782.1|1797335_1798460_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_123677148.1|1798487_1799498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039819503.1|1799570_1800725_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_147094578.1|1800790_1801369_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000019473.1|1801414_1802395_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_151090913.1|1802376_1802589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151090914.1|1802518_1803388_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_000043543.1|1803693_1805100_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1805326_1806742_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1806763_1808134_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1808288_1809353_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_023278825.1|1809366_1810236_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004175259.1|1810267_1811158_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1811172_1811727_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_072353991.1|1811906_1813073_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_000019445.1|1813736_1814717_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_094818818.1|1814770_1815673_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_077255456.1|1815887_1815992_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	2808773	2819660	5483867		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2808773_2811881_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2811935_2813201_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2813231_2814320_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2814406_2814667_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2814964_2815825_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2815845_2816607_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2816867_2817770_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_032412163.1|2817781_2819047_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	1.3e-233
WP_002210516.1|2819039_2819660_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	3046224	3084690	5483867	terminase,integrase	uncultured_Caudovirales_phage(32.65%)	58	3075803:3075817	3081812:3081826
WP_004152576.1|3046224_3047091_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3047090_3047864_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3047860_3049057_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3049056_3049410_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3049411_3050065_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3050118_3050685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3050721_3050907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3050959_3051301_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3051300_3052323_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3052325_3052628_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3052628_3053228_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3053227_3055231_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3055220_3055373_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3055408_3055834_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3055837_3056278_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3056288_3057434_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3057437_3057878_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3057972_3058359_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3058358_3058865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3058861_3059281_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3059249_3059531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3059570_3060512_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3060523_3061018_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3061021_3062224_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3062275_3062824_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3062879_3064331_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3064568_3065969_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3065919_3066672_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3066773_3067094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064754420.1|3067186_3067444_-	hypothetical protein	NA	S5FXQ4	Shigella_phage	70.9	2.3e-23
WP_004153952.1|3067328_3067718_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3067714_3068245_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3068247_3068496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3068901_3069684_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3069680_3070157_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3070153_3071116_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3071117_3072776_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152163.1|3073084_3073378_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
WP_004152162.1|3073352_3073574_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3073671_3074340_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3074510_3074825_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3074817_3075006_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3075175_3075541_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3075533_3075788_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3075759_3075978_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3075803:3075817	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3075974_3076400_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3076396_3076591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3076587_3077415_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3077519_3078038_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3078043_3078754_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3078743_3078968_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3078964_3079177_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3079173_3079653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3079831_3080074_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3080054_3081236_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3081432_3081981_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3081812:3081826	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3082179_3083712_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3083928_3084690_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	3117623	3171716	5483867	transposase,protease,integrase,holin	Enterobacteria_phage(33.33%)	64	3117405:3117420	3147074:3147089
3117405:3117420	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3117623_3118295_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3118481_3119309_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3119384_3120650_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3120651_3121071_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3121150_3122635_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3122634_3122886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152776.1|3123532_3123955_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3124547_3125252_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|3125867_3126215_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3126378_3127170_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|3128151_3128856_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3128892_3129180_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3129176_3129716_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3129712_3130012_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3130490_3131537_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3131762_3132452_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3132451_3132592_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3132588_3133227_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3133219_3133888_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3133884_3134052_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3134032_3134500_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3135020_3136049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3136256_3136502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3136557_3136860_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3136856_3137705_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3137701_3138562_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3138647_3138869_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3138909_3139137_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3139248_3139947_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3139969_3140089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3140234_3141311_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3141392_3141596_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3142024_3142219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3142307_3142592_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3142607_3143453_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3143449_3143737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3143738_3144419_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3144415_3144844_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3144840_3145503_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004190725.1|3145499_3145814_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_004153574.1|3145710_3146898_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3147074_3147965_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3147074:3147089	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3147964_3148957_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3148958_3149768_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004176464.1|3149812_3151243_-	cytosine permease	NA	NA	NA	NA	NA
WP_004152967.1|3151439_3151982_+	HutD family protein	NA	NA	NA	NA	NA
WP_004140277.1|3152180_3152969_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004151905.1|3153159_3154317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901787.1|3154398_3156333_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_002901786.1|3156491_3156671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901785.1|3156742_3157492_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004151906.1|3157764_3157986_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901782.1|3158117_3158444_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_004151907.1|3158443_3159181_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901781.1|3159372_3160542_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_002901780.1|3160548_3160857_-	LapA family protein	NA	NA	NA	NA	NA
WP_002901779.1|3160992_3161760_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901778.1|3161923_3162526_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901777.1|3162572_3165245_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901776.1|3165633_3165801_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901772.1|3166046_3167021_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901763.1|3167366_3169964_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901761.1|3170370_3170622_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|3170669_3171716_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 9
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	3277440	3409429	5483867	protease,tRNA,head,capsid,terminase,transposase,holin,tail,portal,integrase	Klebsiella_phage(31.18%)	154	3304243:3304257	3407240:3407254
WP_002901088.1|3277440_3277941_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3278057_3278504_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3278487_3279279_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|3279380_3280565_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3280596_3281289_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3281434_3281944_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3281930_3282287_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|3282276_3282516_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3282816_3283830_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3283887_3283989_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3283988_3284063_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3284180_3284306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3284365_3284629_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3284759_3285398_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3285487_3286402_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3287063_3288107_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3288409_3289618_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3289691_3291476_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3291482_3292373_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3292493_3294002_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3294312_3294999_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3295396_3295576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3295615_3296248_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3296814_3297012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3297127_3298138_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3298134_3299541_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3299596_3300484_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3300500_3301007_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3301033_3301528_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3301618_3301804_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3302425_3303619_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3303731_3303959_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3304243:3304257	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3304395_3304719_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3304711_3305104_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3305100_3305814_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3306086_3306239_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3306393_3307890_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3307958_3320663_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3320725_3321319_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3321345_3321768_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3321809_3322520_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3322521_3323277_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3323273_3323612_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3323611_3326947_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_071836352.1|3326946_3327165_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
WP_014228914.1|3327179_3327545_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3327602_3328064_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3328095_3328497_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3328493_3328883_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3328863_3329202_-	hypothetical protein	NA	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3329198_3329516_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3329496_3329757_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3329815_3331102_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3331179_3332100_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3332136_3333396_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3333395_3333575_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3333568_3335290_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3335289_3335724_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3335972_3336404_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3336400_3336724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3336675_3337038_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_000019473.1|3337705_3338686_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_049115059.1|3338827_3339265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3340214_3340565_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3340561_3341059_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_151090919.1|3341058_3341280_-|holin	holin	holin	A5LH82	Enterobacteria_phage	90.8	1.3e-27
WP_151090920.1|3341218_3341422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3341403_3342384_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004147999.1|3343391_3343541_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3344278_3344482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3344725_3345328_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3345344_3346376_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_017898980.1|3346375_3346579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025861428.1|3346575_3346968_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3347008_3347299_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3347310_3347544_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004152765.1|3347622_3349107_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3349106_3349358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954975.1|3349947_3351309_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|3351482_3352196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|3352547_3353417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|3353505_3354897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3355245_3355686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3355699_3356164_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3356156_3357161_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3357220_3357775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3357777_3358002_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3358090_3358528_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3358849_3359164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099143961.1|3359326_3359545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3359554_3359749_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3359791_3360136_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3360277_3362416_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3362468_3362714_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3362694_3363822_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_094818795.1|3363939_3364122_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	3.7e-20
WP_049182670.1|3364503_3365265_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	29.4	2.5e-09
WP_094818794.1|3366299_3367025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818793.1|3367076_3368342_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	8.1e-207
WP_042934076.1|3368344_3368764_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.2e-34
WP_064155591.1|3368842_3369085_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	81.0	1.6e-31
WP_031592310.1|3369084_3369327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094818792.1|3370102_3370855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818791.1|3370865_3373034_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.1	6.7e-100
WP_094818790.1|3373111_3376180_-	kinase	NA	A0A286S259	Klebsiella_phage	66.3	0.0e+00
WP_094818789.1|3376176_3376563_-	nitrite transporter	NA	H2BD94	Pseudomonas_phage	35.7	4.0e-16
WP_038433285.1|3376570_3377053_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
WP_032420722.1|3377039_3377513_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
WP_094818788.1|3377512_3380209_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.4	4.9e-201
WP_032420719.1|3380189_3380507_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_025714420.1|3380527_3380923_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
WP_023304948.1|3380965_3381448_-	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_020804325.1|3381455_3381854_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_048291628.1|3381850_3382402_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
WP_020317349.1|3382391_3382685_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_049186541.1|3382677_3383004_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	4.0e-33
WP_094818787.1|3383084_3385100_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.2	0.0e+00
WP_020317329.1|3385044_3386544_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_094818786.1|3386540_3386756_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	75.7	6.5e-24
WP_094818785.1|3386752_3388861_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.5	0.0e+00
WP_014228567.1|3388860_3389352_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_072002796.1|3389672_3389858_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	2.4e-11
WP_108918987.1|3389925_3390186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216876.1|3390412_3390658_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_116723292.1|3391047_3391236_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.8	6.3e-23
WP_094818783.1|3391186_3391462_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	46.7	8.6e-13
WP_094818782.1|3391458_3391806_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	3.0e-39
WP_019704505.1|3391802_3392342_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
WP_024176410.1|3392338_3392638_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_040210598.1|3392807_3393047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818781.1|3393197_3393776_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_094818780.1|3393789_3394770_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.5	2.7e-133
WP_065519871.1|3394782_3395160_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	3.9e-48
WP_094818779.1|3395169_3395979_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	5.9e-110
WP_094818778.1|3395975_3396890_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.8e-30
WP_023317571.1|3396846_3397059_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_004213338.1|3397296_3397758_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_024176406.1|3397783_3397993_-	cell division protein	NA	NA	NA	NA	NA
WP_019705289.1|3398087_3398732_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_094818777.1|3399031_3399955_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.9	1.5e-104
WP_040186300.1|3400040_3400340_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.8	1.0e-14
WP_094818776.1|3400339_3401125_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.3e-61
WP_094818775.1|3401252_3401744_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	53.4	5.1e-32
WP_064151808.1|3401740_3402004_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.0	1.1e-30
WP_094818774.1|3401996_3402641_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	42.8	1.1e-39
WP_004141386.1|3402640_3402853_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_038435237.1|3403648_3403867_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	3.0e-08
WP_071562415.1|3403866_3404139_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	4.4e-09
WP_000089156.1|3404167_3404404_+	excisionase	NA	NA	NA	NA	NA
WP_000741346.1|3404393_3405536_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_094818773.1|3405649_3406900_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_004150801.1|3407140_3407791_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3407240:3407254	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3407807_3408266_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3408322_3409429_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	3625408	3720269	5483867	protease,tRNA,head,capsid,terminase,tail,portal,lysis,plate,integrase	Salmonella_phage(55.93%)	96	3680934:3680952	3720344:3720362
WP_002898139.1|3625408_3626701_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3626791_3628135_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3628143_3628755_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3628877_3633131_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3633266_3633761_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_151090921.1|3634266_3635262_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3635376_3637143_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3637143_3638865_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.4	3.4e-14
WP_002898014.1|3638909_3639611_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3639964_3640183_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3640303_3642583_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3642613_3642931_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3643256_3643478_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3643554_3645495_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3645491_3646607_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3646753_3648412_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3648831_3649527_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3649642_3650542_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3650685_3652338_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3652348_3653317_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3653528_3653963_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3654114_3655833_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3655871_3656873_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3656883_3658326_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3658413_3659427_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3659423_3660254_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3660285_3661425_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3662302_3662818_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3663044_3663773_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3663793_3664525_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3664531_3665248_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3665247_3665916_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3666099_3666831_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3666873_3668346_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3668342_3669059_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3669137_3670265_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3670306_3670795_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3670852_3671698_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3671694_3672648_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3672658_3673792_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3673955_3675068_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3675416_3675896_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3675984_3676887_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3677708_3677996_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_002896352.1|3678198_3678462_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3678468_3678852_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3679118_3680804_+	transporter	NA	NA	NA	NA	NA
3680934:3680952	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3681023_3681242_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3681333_3682434_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3682430_3682916_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3682912_3685540_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3685532_3685652_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3685666_3685966_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3686018_3686534_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3686543_3687716_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3687854_3688931_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3688960_3689164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3689160_3689892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3689895_3692847_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3692848_3693448_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3693440_3694349_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3694335_3694698_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3694694_3695267_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3695361_3696054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3696050_3696497_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3696489_3696921_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3697016_3697445_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3697441_3697825_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3697829_3698339_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3698319_3698535_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3698538_3698742_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3698741_3699206_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3699301_3699952_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3699955_3701014_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3701030_3701864_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3702006_3703773_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3703772_3704798_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3704859_3706602_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3706877_3707555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3707669_3707903_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3707913_3708102_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004152765.1|3708202_3709687_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3709686_3709938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150862.1|3710165_3712580_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3712576_3713434_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3713430_3713658_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3713657_3713891_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3713958_3714300_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3714263_3714464_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3714471_3714981_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3715013_3715235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3715380_3716259_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3716270_3717215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3717313_3718798_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3718797_3719049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151720.1|3719216_3720269_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3720344:3720362	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	4372053	4383706	5483867	integrase	Enterobacteria_phage(70.0%)	13	4372503:4372517	4395559:4395573
WP_004144574.1|4372053_4373157_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4372503:4372517	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4373167_4374421_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4374773_4375964_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4375951_4376902_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4376901_4377327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4377894_4378461_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4378478_4378724_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4378720_4379458_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4379999_4380266_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4380262_4380820_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4380816_4381044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4381040_4381361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889890.1|4381372_4383706_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4395559:4395573	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 12
NZ_CP041373	Klebsiella pneumoniae strain KP58 chromosome, complete genome	5483867	4854449	4863974	5483867	transposase	Enterobacteria_phage(83.33%)	10	NA	NA
WP_004152207.1|4854449_4856783_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4856797_4857118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152205.1|4857114_4857342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4857338_4857887_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|4858710_4859448_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4859444_4859690_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4859707_4860274_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152201.1|4861014_4862094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152200.1|4862094_4862631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4862993_4863974_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP041374	Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence	197415	15236	47711	197415	transposase,integrase	Salmonella_phage(25.0%)	27	NA	NA
WP_004213558.1|15236_16166_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_004213560.1|16310_17090_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_077250520.1|17086_17899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818817.1|18452_18842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|18825_19056_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|19052_19469_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|19542_21105_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|21089_22112_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000427619.1|23645_24650_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000405672.1|24740_25175_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004213585.1|25260_27666_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000118563.1|27662_28739_+	signal peptidase II	NA	NA	NA	NA	NA
WP_004213590.1|28868_29426_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
WP_004213592.1|29428_32398_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
WP_000427619.1|32476_33481_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004213594.1|33766_34261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213850.1|34494_35418_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_048333570.1|35484_35955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333569.1|37498_37942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040217257.1|37962_38751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048333456.1|39201_40125_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	7.3e-165
WP_108970991.1|40128_40371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251286.1|40316_40736_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011251285.1|40732_41044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004212794.1|45030_45525_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.6	5.9e-20
WP_004212796.1|45861_46260_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000427619.1|46706_47711_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041374	Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence	197415	133933	196686	197415	transposase,protease,integrase	Caulobacter_phage(15.0%)	58	139642:139657	192664:192679
WP_004225018.1|133933_134929_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|135134_136148_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|136260_136788_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077250518.1|136801_139759_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
139642:139657	attL	GCAGCAGAGAATGACA	NA	NA	NA	NA
WP_004144375.1|140600_141461_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_011251321.1|143192_143828_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_011251320.1|144164_145406_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_000301240.1|145490_146066_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_004026609.1|146152_146731_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|146769_147810_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|147833_148289_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_011251319.1|148311_149463_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004196925.1|149459_150044_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_011251317.1|150354_151413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181731.1|151424_152567_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	3.7e-33
WP_004181732.1|152559_153333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026596.1|153334_154414_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
WP_011251315.1|154413_155370_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_011251314.1|155380_156604_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_004196888.1|156606_157065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251313.1|157544_158183_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|158207_158849_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004210266.1|158849_159488_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|159580_160621_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011251311.1|160620_162354_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004196935.1|162381_163881_+	kinase	NA	NA	NA	NA	NA
WP_032720951.1|164259_164742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118061.1|165017_165422_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004118062.1|165969_166248_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004181742.1|166341_166554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251307.1|167584_169084_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.1	1.8e-35
WP_004210292.1|169064_170330_-	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011154627.1|170347_170638_-	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_004210297.1|170649_171612_-	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_004210298.1|171608_172172_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004210300.1|172182_173292_-	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_004902273.1|173251_174253_-	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_004210304.1|174266_174749_-	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_004210305.1|175115_176516_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004118067.1|176891_177095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186895.1|177124_177439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026565.1|177681_178134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130984001.1|180315_180516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029884537.1|180734_181811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213836.1|182953_183208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213833.1|183385_184522_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004213829.1|184587_184905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|185056_185380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251302.1|186131_187091_-	DNA replication protein	NA	NA	NA	NA	NA
WP_004186937.1|187133_187541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213821.1|187550_187994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213807.1|189257_190226_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004902302.1|190553_192146_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|192176_192527_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|192523_192964_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
192664:192679	attR	TGTCATTCTCTGCTGC	NA	NA	NA	NA
WP_004902307.1|193160_193343_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|194548_195520_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004211841.1|195519_196686_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
>prophage 1
NZ_CP041375	Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence	134972	1796	50618	134972	transposase,protease	Escherichia_phage(47.62%)	55	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013188475.1|5659_6535_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_012579081.1|6614_7538_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001067855.1|9288_9993_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|11103_11808_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000957857.1|12485_12674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|12765_13302_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|13484_14345_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|14514_15270_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067858.1|15719_16424_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_071557810.1|16414_16555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333089.1|18365_18647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|18769_19120_-	protein stbB	NA	NA	NA	NA	NA
WP_000959884.1|19122_20085_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|20231_20525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072109530.1|20465_20645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|20601_21285_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|21285_21507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|21520_21955_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_011161242.1|22654_23227_+	YubH family protein	NA	NA	NA	NA	NA
WP_001198928.1|23199_23625_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271762.1|23671_24094_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001027493.1|24090_24282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012372796.1|24595_26263_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_015059006.1|27142_27400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|27662_27893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|27944_29306_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_015059007.1|29352_29916_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	6.1e-21
WP_021537720.1|29915_30164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072206670.1|30067_30283_+	transporter	NA	NA	NA	NA	NA
WP_012881134.1|30457_30694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290834.1|30758_31286_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|31343_31577_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000845953.1|33729_34164_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276217.1|34160_34880_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|35159_35318_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001309236.1|35540_35759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012881134.1|35933_36170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272251.1|36232_36529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234445.1|36639_37461_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_015059008.1|37757_38405_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|38681_39065_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001067855.1|39345_40050_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|41683_42586_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_023148136.1|42623_42857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210513.1|42847_43609_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|43629_44490_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_099093179.1|44410_44650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138014.1|44730_47697_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|47700_48261_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_013213990.1|49803_50082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213989.1|50192_50618_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
>prophage 2
NZ_CP041375	Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence	134972	94643	105802	134972		Escherichia_phage(50.0%)	11	NA	NA
WP_004118283.1|94643_95510_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_011977818.1|96619_97825_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_086523286.1|97821_98799_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_013214011.1|98880_100152_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_001568036.1|100151_100583_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_009483812.1|100741_100993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|100992_102477_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152353.1|102725_103697_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_013214012.1|103699_104371_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|104433_104664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|105100_105802_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 1
NZ_CP041376	Klebsiella pneumoniae strain KP58 plasmid pKP58-3, complete sequence	87095	26123	65586	87095	integrase,transposase	Escherichia_phage(28.57%)	44	24114:24129	60335:61154
24114:24129	attL	TTATTTCCCGCCTGGA	NA	NA	NA	NA
WP_086556681.1|26123_26801_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	8.7e-22
24114:24129	attL	TTATTTCCCGCCTGGA	NA	NA	NA	NA
WP_032440556.1|26930_27416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440555.1|27500_27749_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	51.5	1.6e-10
WP_032440554.1|28533_29592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440553.1|29584_29794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015344981.1|29865_30150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440552.1|30289_30931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493286.1|31166_31496_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|31476_31758_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
31655:31670	attR	TTATTTCCCGCCTGGA	NA	NA	NA	NA
WP_077256884.1|31904_32480_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
31655:31670	attR	TTATTTCCCGCCTGGA	NA	NA	NA	NA
WP_012477564.1|32530_33121_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|33257_33830_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_001493761.1|33866_35258_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001516695.1|36037_36694_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_012477595.1|38290_39148_-	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
WP_040212993.1|39212_40316_-	peptidoglycan synthetase FtsI	NA	NA	NA	NA	NA
WP_001351729.1|42077_42470_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|42607_43492_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|43523_44723_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|44801_45479_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087758686.1|45510_45666_-	replication initiator protein	NA	NA	NA	NA	NA
WP_001067855.1|45656_46361_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|46504_47146_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|47295_47796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|47875_48580_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001550559.1|48613_49105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|49211_49949_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000743213.1|49945_50170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|50380_51874_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_071881958.1|51904_52156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|52049_52352_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|52438_53254_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|53583_53760_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|53941_54946_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|56842_57547_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|57793_58267_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|58422_59436_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015344971.1|59404_59689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094818827.1|59828_60353_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.4	1.2e-31
WP_001067855.1|60386_61091_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_053897648.1|61115_62672_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
WP_108970993.1|62819_63599_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	51.0	3.7e-69
WP_045325066.1|63598_64024_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	3.7e-31
WP_004152765.1|64101_65586_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
