The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	25	68436	5310338	terminase,holin,integrase,tail,portal,protease	Enterobacteria_phage(51.67%)	77	18399:18415	79134:79150
WP_151078003.1|25_565_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	68.3	1.9e-59
WP_047649236.1|561_963_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	82.7	3.3e-61
WP_000211140.1|973_1714_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	85.7	2.4e-110
WP_000478930.1|1770_2160_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	66.7	1.2e-39
WP_072095543.1|2168_2483_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	73.1	2.6e-37
WP_050939989.1|2466_5490_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	76.1	0.0e+00
WP_050939987.1|5489_5819_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	81.5	1.1e-46
WP_001152670.1|5828_6527_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	85.3	2.5e-117
WP_072095542.1|6531_7275_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	91.9	1.4e-142
WP_063113317.1|7172_7820_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	80.9	7.8e-97
WP_063113316.1|7880_11294_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.9	0.0e+00
WP_050939977.1|11363_11963_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	1.3e-109
WP_072095541.1|12027_15099_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001443470.1|15098_15680_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	6.8e-100
WP_172636179.1|16470_17706_+	YadA-like family protein	NA	NA	NA	NA	NA
18399:18415	attL	TTCAGGCGCAGGTTGAT	NA	NA	NA	NA
WP_001396447.1|19160_20180_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.0	4.4e-86
WP_000273158.1|20148_20400_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_151039303.1|20466_22938_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	3.8e-59
WP_001090193.1|23018_23222_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449183.1|23218_23407_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000373330.1|24100_24547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345627.1|24625_25000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047649242.1|25011_25164_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.6e-07
WP_059222065.1|25479_25956_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|26079_26376_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693884.1|26398_26824_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_047649206.1|26895_27966_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	1.0e-64
WP_047649207.1|28011_28806_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	50.2	5.9e-54
WP_047649208.1|28822_29245_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.4e-64
WP_040072812.1|29302_29659_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	3.9e-58
WP_047649210.1|29709_29922_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	2.4e-31
WP_042973577.1|29954_30173_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	97.2	1.2e-30
WP_001229296.1|30174_30540_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000350274.1|30647_30881_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000220601.1|31085_31385_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_047649213.1|31390_31648_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.9e-30
WP_047649247.1|31783_32056_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.1e-11
WP_047649215.1|32057_33107_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.2e-109
WP_000510632.1|33119_33479_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	2.4e-39
WP_047649217.1|33475_34141_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	5.4e-61
WP_047649218.1|34396_35110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917767.1|35283_35481_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_151039305.1|35631_36678_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	86.0	8.0e-176
WP_047649221.1|37445_37835_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	87.7	9.9e-47
WP_047649223.1|37824_38103_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	83.7	2.4e-34
WP_047649225.1|38104_38650_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.1	2.9e-92
WP_040073338.1|39025_39307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000417401.1|39378_39561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137455798.1|39717_39900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000826254.1|40073_40298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373032.1|40338_40554_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	63.6	2.8e-19
WP_047649229.1|40616_41009_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	95.8	4.1e-48
WP_157777103.1|41168_41327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421825.1|41584_42124_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001396463.1|42132_44232_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.7	0.0e+00
WP_001072973.1|44228_44441_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_077630415.1|44368_45949_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.8	3.6e-289
WP_087514505.1|45893_47921_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097045.1|48007_48331_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|48323_48599_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677112.1|48610_49189_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001079419.1|49185_49587_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211106.1|49597_50341_+	Ig-like domain-containing protein	NA	K7PGT7	Enterobacteria_phage	100.0	1.6e-133
WP_096970531.1|50400_50787_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	3.4e-63
WP_001161009.1|50795_51125_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_089613568.1|51096_54168_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	90.7	0.0e+00
WP_000447259.1|54167_54497_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	98.2	5.6e-59
WP_047089946.1|54506_55205_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	95.3	1.1e-128
WP_089613593.1|55210_55954_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.7	9.2e-142
WP_000090862.1|55890_56493_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	6.2e-88
WP_151039306.1|56553_60033_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	90.1	0.0e+00
WP_089613414.1|60091_62677_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	50.1	5.5e-125
WP_047089940.1|62680_63211_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	75.4	2.1e-71
WP_001058323.1|64217_65336_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|65332_67126_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|67144_67852_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|67848_68436_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
79134:79150	attR	TTCAGGCGCAGGTTGAT	NA	NA	NA	NA
>prophage 2
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	338037	398385	5310338	terminase,holin,integrase,tail,portal,protease	Enterobacteria_phage(41.3%)	72	331454:331468	342183:342197
331454:331468	attL	GGCAATGAATACCAC	NA	NA	NA	NA
WP_151077956.1|338037_339168_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	3.4e-103
WP_000113182.1|339145_339394_-	excisionase	NA	NA	NA	NA	NA
WP_151077958.1|339458_341912_-	3'-5' exoribonuclease	NA	V5UQJ3	Shigella_phage	42.4	7.3e-103
WP_050940247.1|341989_342193_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032215066.1|342189_342378_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
342183:342197	attR	GTGGTATTCATTGCC	NA	NA	NA	NA
WP_000373330.1|343079_343526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345627.1|343604_343979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151077960.1|343990_344143_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.6e-07
WP_032214969.1|344424_344706_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032214970.1|344709_344898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032214971.1|344927_345326_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032214972.1|345442_345721_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	50.0	3.3e-12
WP_033559708.1|345704_346226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033559707.1|346206_347172_+	phage O protein family	NA	U5P0A0	Shigella_phage	61.2	3.7e-58
WP_033559706.1|347178_347925_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_151077962.1|347939_348332_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	55.0	4.5e-31
WP_074154310.1|348328_348625_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	92.7	4.1e-45
WP_097418813.1|348817_349129_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	84.5	1.8e-51
WP_172636468.1|349539_350145_+	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	41.7	9.1e-39
WP_061351717.1|350452_350785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151077964.1|350966_351239_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	38.7	1.0e-05
WP_151077966.1|351240_352290_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	7.2e-108
WP_151077968.1|352302_352674_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	2.8e-38
WP_001421054.1|352663_353029_+	phage antitermination Q family protein	NA	Q777W5	Enterobacteria_phage	79.8	5.6e-52
WP_001421055.1|353073_353553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917767.1|353834_354032_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_151077970.1|354182_355229_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	91.9	1.5e-190
WP_001294586.1|355996_356389_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	88.5	5.7e-50
WP_000950571.1|356378_356657_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	1.9e-44
WP_000836779.1|356658_357204_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.1	8.3e-92
WP_040073338.1|357579_357861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000417401.1|357932_358115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133158975.1|358271_358454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151077972.1|358881_359097_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	63.6	3.7e-19
WP_063103133.1|359159_359456_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	96.9	1.9e-50
WP_077881373.1|359754_360285_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	96.6	1.3e-89
WP_151077974.1|360302_362402_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	93.8	0.0e+00
WP_047649231.1|362398_362611_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	90.0	3.3e-28
WP_151077976.1|362610_364116_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	88.8	4.9e-259
WP_151077978.1|364060_366124_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A291AWT6	Escherichia_phage	91.0	0.0e+00
WP_057697875.1|366210_366534_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	87.9	3.1e-46
WP_057697874.1|366526_366802_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	93.4	3.6e-43
WP_151077980.1|366813_367392_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	89.6	9.8e-91
WP_040073329.1|367388_367790_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	82.0	1.2e-58
WP_040073328.1|367804_368545_+	Ig domain-containing protein	NA	A0A291AWU6	Escherichia_phage	85.7	1.1e-110
WP_137658807.1|368605_368995_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	65.2	5.8e-39
WP_151077982.1|369003_369318_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	73.3	8.9e-38
WP_151077985.1|369301_372325_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	75.7	0.0e+00
WP_000402323.1|372324_372654_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	82.4	4.9e-47
WP_063103116.1|372663_373362_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	84.9	9.6e-117
WP_040073325.1|373366_374110_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	91.5	1.2e-141
WP_047656448.1|374007_374655_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	80.9	1.2e-97
WP_151077987.1|374715_378111_+	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	88.7	0.0e+00
WP_151077989.1|378178_378778_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	2.0e-107
WP_151077991.1|378842_381428_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	49.9	1.2e-124
WP_001164143.1|381431_381962_+|tail	tail fiber assembly protein	tail	A0A0F7LBP0	Escherichia_phage	75.4	2.1e-71
WP_001079499.1|382721_383228_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|383273_383774_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|383859_384039_-	general stress protein	NA	NA	NA	NA	NA
WP_000443065.1|384419_385226_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_050939457.1|385225_386419_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|386430_387792_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|387792_389388_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194590.1|389387_390950_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|391041_391086_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285663.1|391223_392105_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|392101_392722_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_050939459.1|392749_394645_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|394855_395731_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_050939464.1|395770_396361_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559286.1|396357_397116_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|397335_398385_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 3
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	473371	525221	5310338	terminase,holin,tRNA,plate,tail	Escherichia_phage(80.36%)	60	NA	NA
WP_000628065.1|473371_474604_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|474858_475842_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|476319_477693_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157377.1|477821_478757_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_072017917.1|478808_480044_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	100.0	1.5e-242
WP_000079604.1|480045_480261_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_151039308.1|480360_480549_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	9.4e-27
WP_021500490.1|480541_480736_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_021529594.1|480799_481888_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	100.0	7.7e-206
WP_042973008.1|481902_484977_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	84.5	0.0e+00
WP_001349883.1|485427_485598_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	6.7e-24
WP_000560209.1|485597_485819_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	8.1e-38
WP_052318200.1|486239_486392_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_042973012.1|486773_487238_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	70.2	8.2e-56
WP_000171139.1|487342_487618_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_045174332.1|487601_488024_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.3e-68
WP_010358686.1|488101_488890_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	6.7e-42
WP_042972910.1|488896_489643_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	7.3e-115
WP_042972909.1|489663_490425_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	3.6e-117
WP_042972908.1|490440_490863_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	97.1	7.7e-69
WP_151039310.1|490859_491114_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	86.9	7.2e-38
WP_042972904.1|491106_491418_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	5.3e-51
WP_000018421.1|492486_492699_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000687438.1|492919_493093_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	70.4	1.4e-16
WP_045174340.1|493152_493752_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	7.7e-107
WP_045174342.1|493751_494042_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	9.6e-47
WP_045174344.1|494038_494581_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	2.1e-74
WP_001285363.1|495034_495748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151039312.1|497866_498259_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	80.0	6.5e-46
WP_000016408.1|498248_498524_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	95.6	3.6e-43
WP_000014549.1|498526_498904_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	1.3e-64
WP_000087514.1|498918_499101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045174350.1|499505_500297_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	5.7e-49
WP_045174352.1|500289_501222_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.6e-82
WP_170815536.1|501157_501409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151039314.1|501412_502504_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	90.8	1.3e-144
WP_061354756.1|502493_503822_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.6	5.4e-262
WP_001559065.1|503840_505277_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	96.2	2.7e-267
WP_045174362.1|505221_506055_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.4	5.8e-153
WP_042972883.1|506035_507358_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.9	3.2e-190
WP_042972882.1|507350_507968_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	97.1	2.7e-115
WP_001272364.1|507982_509011_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.1	1.6e-189
WP_000780862.1|509068_509539_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	99.4	4.2e-84
WP_000175376.1|509538_509979_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_042972881.1|510403_511348_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.0	1.1e-171
WP_042972877.1|511347_512685_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	97.3	2.5e-246
WP_042972875.1|512708_513140_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	9.6e-75
WP_042972873.1|513136_513754_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	75.0	3.0e-82
WP_151039316.1|513818_515894_+	lytic transglycosylase domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	43.1	5.6e-128
WP_000056327.1|515897_516566_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	97.3	4.0e-120
WP_000209263.1|516562_516829_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	98.9	2.8e-45
WP_001271166.1|516828_517836_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	91.0	8.0e-181
WP_000063620.1|517835_518549_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	94.5	4.1e-123
WP_001261327.1|518831_519179_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	2.2e-61
WP_000426902.1|519328_520489_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	30.3	2.2e-33
WP_071790993.1|520529_521756_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	98.8	1.3e-225
WP_001199731.1|521739_522366_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	100.0	2.0e-121
WP_047613457.1|522362_523916_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	77.7	9.0e-224
WP_000902858.1|523918_524464_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	74.7	2.7e-74
WP_001434761.1|524897_525221_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	78.5	4.7e-42
>prophage 4
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	722818	771029	5310338	terminase,capsid,holin,lysis,transposase,integrase,tail,portal,head	Enterobacteria_phage(40.0%)	61	719706:719722	771368:771384
719706:719722	attL	GCCAGATGGGTTTTCCC	NA	NA	NA	NA
WP_050939537.1|722818_723562_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	8.0e-146
WP_001152619.1|723567_724266_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_050939578.1|724265_724595_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	2.4e-57
WP_050939581.1|724591_727141_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.9	0.0e+00
WP_072095516.1|727121_727535_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	86.3	4.6e-42
WP_047624210.1|727561_727990_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	66.9	6.2e-42
WP_050939599.1|728005_728755_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	93.2	9.0e-129
WP_001357870.1|728762_729158_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	2.9e-70
WP_050939586.1|729154_729733_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	91.7	1.7e-79
WP_001204540.1|729744_730098_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_050939589.1|730090_730465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522651.1|730516_731545_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_050939591.1|731602_731941_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	51.9	1.5e-22
WP_151039322.1|731937_733443_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.8e-99
WP_135259093.1|733432_735025_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	9.3e-184
WP_000259002.1|735021_735228_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_063113294.1|735211_737140_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.3	7.4e-260
WP_050940352.1|737111_737660_-|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	62.8	1.4e-59
WP_047089466.1|738048_738288_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	76.6	6.3e-20
WP_077782553.1|738499_738682_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	72.4	4.4e-13
WP_047672888.1|738898_739432_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	2.4e-96
WP_072033262.1|739545_739806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047672890.1|739753_740305_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	66.7	2.0e-37
WP_050940350.1|740309_740525_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	93.0	8.5e-32
WP_050940343.1|741616_742678_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	91.1	8.4e-189
WP_000917767.1|742828_743026_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_050940339.1|743250_743817_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	63.9	7.2e-46
WP_050940359.1|744098_744482_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	2.9e-59
WP_047654522.1|744474_744852_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.8e-37
WP_050940337.1|744852_745911_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	3.7e-88
WP_050940336.1|745912_746191_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_050940333.1|746257_746509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050940330.1|746725_746938_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_050940328.1|747463_748051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151252.1|748323_748725_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	6.0e-63
WP_000054495.1|748765_749731_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_000705360.1|749711_750233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|750216_750444_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|750524_750932_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379591.1|751100_751253_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_170990527.1|751252_751630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|751598_751799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|752301_752490_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|752486_752678_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_050940326.1|752771_755243_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|755315_755567_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_050940323.1|755601_756882_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	8.6e-156
WP_001360138.1|756901_757012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836059.1|757069_758089_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_050940321.1|758100_759315_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	4.1e-46
WP_000598292.1|759520_759847_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|759981_760323_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|760357_760918_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|760920_761631_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|761738_762044_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_050940319.1|762242_764669_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.0e-213
WP_072095568.1|764729_767153_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|767163_767781_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|767782_768637_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|768679_769294_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000255944.1|770006_771029_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
771368:771384	attR	GGGAAAACCCATCTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	1010489	1101304	5310338	capsid,tRNA,terminase,lysis,holin,transposase,integrase,tail,protease,portal,head	Escherichia_phage(43.06%)	108	1082330:1082346	1105731:1105747
WP_000984517.1|1010489_1011371_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|1011562_1013611_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|1013630_1014329_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|1014425_1014923_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207284.1|1015052_1016336_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_050939622.1|1016304_1018938_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001307251.1|1019017_1020457_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1020574_1020811_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|1020915_1021107_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|1021107_1021764_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|1022159_1022501_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|1022513_1023386_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1023389_1023764_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1023902_1024133_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|1024234_1024891_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_050939619.1|1024914_1025577_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	1.2e-07
WP_000936936.1|1025573_1027634_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|1027842_1028502_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|1028828_1029185_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|1029251_1029542_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|1029675_1030854_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|1030909_1031551_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|1031587_1033399_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|1033633_1035109_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|1035446_1036316_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091176.1|1036443_1037886_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|1038016_1038988_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|1039107_1040430_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_050939628.1|1040445_1041378_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1041456_1042212_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|1042208_1042994_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1043140_1044151_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1044159_1044771_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|1044909_1044975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|1045045_1045648_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1045649_1046171_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|1046205_1046946_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|1046974_1047427_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|1047419_1049192_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|1049501_1050068_+	hydrolase	NA	NA	NA	NA	NA
WP_001217534.1|1050385_1050634_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	87.8	8.0e-34
WP_050939615.1|1050903_1051575_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.9	1.1e-106
WP_050939614.1|1051643_1052912_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	98.2	1.9e-54
WP_000078855.1|1053056_1053197_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_123130871.1|1057323_1057956_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	7.9e-102
WP_050939605.1|1057901_1058645_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	1.2e-149
WP_001499019.1|1058655_1059354_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_000847279.1|1059353_1059683_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_050939603.1|1059679_1062253_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.3	0.0e+00
WP_000533402.1|1062233_1062647_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|1062673_1063105_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235046.1|1063118_1063871_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.0e-132
WP_000683079.1|1063878_1064274_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_024213759.1|1064270_1064846_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	9.8e-51
WP_001204554.1|1064861_1065215_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|1065207_1065591_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|1065642_1066671_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_024213760.1|1066728_1067076_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	1.5e-22
WP_032285156.1|1067112_1068618_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	2.5e-98
WP_032285154.1|1068607_1070200_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
WP_000259002.1|1070196_1070403_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_032285152.1|1070386_1072315_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.5e-260
WP_000235436.1|1072286_1072796_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|1073190_1073385_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738423.1|1073745_1074039_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_077628513.1|1074129_1074312_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	2.5e-16
WP_032285289.1|1074528_1075026_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_032285291.1|1075025_1075241_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001290230.1|1075318_1075564_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_032285293.1|1075604_1075784_-	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	91.5	7.8e-23
WP_050940079.1|1075920_1077885_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	78.6	3.8e-296
WP_000752026.1|1078389_1078659_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_050940076.1|1078668_1079616_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	9.2e-171
WP_001204859.1|1080122_1080557_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144764.1|1080549_1080744_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|1080740_1081346_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_050940073.1|1081345_1082068_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.2	3.3e-128
WP_050940070.1|1082142_1082877_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	99.2	1.8e-121
1082330:1082346	attL	TGAATCAGTTTTAATGC	NA	NA	NA	NA
WP_001254256.1|1083151_1083334_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_050940068.1|1083330_1083858_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	3.6e-100
WP_000736913.1|1083854_1084295_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_050940065.1|1084569_1084860_-	protein ren	NA	O48423	Enterobacteria_phage	99.0	1.6e-46
WP_050940062.1|1084856_1085558_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	6.4e-129
WP_135259131.1|1085554_1086493_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.7	3.7e-172
WP_000442609.1|1086525_1086822_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|1086963_1087179_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096002361.1|1087252_1087948_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.6	3.3e-133
WP_001062368.1|1087987_1088545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968517.1|1088541_1089294_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|1089570_1089753_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088203.1|1089730_1090003_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_050940058.1|1090061_1090511_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.9e-70
WP_000776961.1|1090699_1091011_+	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
WP_001549082.1|1091086_1091257_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	82.1	2.5e-18
WP_001549081.1|1091253_1091418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000604110.1|1091502_1091811_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_000065845.1|1091807_1092710_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	88.1	3.3e-146
WP_050940056.1|1092693_1093176_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	9.3e-79
WP_000753560.1|1093187_1093502_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	2.7e-50
WP_001323403.1|1093661_1094441_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|1094440_1095463_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001214456.1|1095755_1095920_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_050939314.1|1095916_1096591_+	hypothetical protein	NA	K7P729	Enterobacteria_phage	52.7	1.8e-51
WP_072018156.1|1096587_1096821_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_050939321.1|1096807_1097512_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	61.2	1.1e-32
WP_032285306.1|1097514_1098006_+	hypothetical protein	NA	G9L661	Escherichia_phage	93.3	9.8e-84
WP_151039328.1|1099614_1100523_+|integrase	tyrosine-type recombinase/integrase	integrase	Q859D2	Escherichia_coli_phage	95.5	2.3e-150
WP_172636180.1|1100488_1101304_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.4e-72
1105731:1105747	attR	TGAATCAGTTTTAATGC	NA	NA	NA	NA
>prophage 6
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	1109152	1175774	5310338	terminase,tRNA,capsid,holin,plate,integrase,tail,portal,head	Enterobacteria_phage(73.47%)	81	1140062:1140121	1176717:1176840
WP_001025342.1|1109152_1110886_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001297434.1|1111062_1111551_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|1111670_1112063_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066983.1|1112062_1114141_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|1114133_1115282_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|1115483_1116128_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1116138_1116528_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1116542_1117592_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1117594_1118455_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483220.1|1118473_1120075_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001297437.1|1120120_1121782_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1121926_1122430_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_072095501.1|1122450_1124415_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|1124419_1125346_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|1125342_1126230_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1126356_1126935_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1126937_1127288_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|1128067_1128496_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|1128502_1129927_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_021563705.1|1129901_1130702_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|1130868_1131855_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_050939309.1|1131869_1133384_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|1133453_1134443_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|1135239_1135743_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|1135821_1136073_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1136187_1136274_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|1136536_1136860_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|1137030_1137528_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377223.1|1137565_1137805_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|1137996_1139208_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|1139269_1139935_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1140062:1140121	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|1140291_1141293_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865207.1|1141298_1141646_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290349.1|1141675_1142326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|1142341_1142746_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|1142835_1142973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|1143044_1143248_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739030.1|1143269_1143620_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	1.5e-49
WP_000159456.1|1143630_1143909_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000357028.1|1143920_1144163_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021659.1|1144159_1144273_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	4.0e-09
WP_000543031.1|1144366_1144777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|1144800_1145004_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|1145000_1145267_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104296.1|1145263_1145563_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	2.8e-41
WP_001372767.1|1145574_1146192_+	ash family protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_032083492.1|1146188_1146578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151039330.1|1146574_1149415_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.9	0.0e+00
WP_000686536.1|1149491_1150451_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	3.8e-180
WP_000211291.1|1150455_1150767_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	7.7e-50
WP_000759755.1|1150827_1151352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021520797.1|1151348_1151939_+	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	54.4	2.3e-31
WP_000087812.1|1152429_1153476_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613782.1|1153475_1155227_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_021520799.1|1155381_1156218_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	3.0e-149
WP_001055104.1|1156241_1157294_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_021520800.1|1157339_1158140_+|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	90.2	2.8e-128
WP_000063103.1|1158241_1158736_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_021520801.1|1158735_1158936_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	5.1e-31
WP_000104350.1|1158938_1159262_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1159258_1159651_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780560.1|1159647_1160055_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000920594.1|1160192_1160660_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356358.1|1160652_1161288_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001705833.1|1161299_1161866_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.9	2.3e-100
WP_170997562.1|1161883_1162213_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	1.9e-54
WP_021520802.1|1162216_1163113_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.0e-155
WP_078331657.1|1163105_1163636_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	7.3e-93
WP_112065116.1|1163638_1165789_+|tail	tail fiber protein	tail	Q7Y4D4	Escherichia_virus	82.5	3.7e-300
WP_021520805.1|1165792_1166320_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	96.0	2.0e-90
WP_021520804.1|1166348_1166882_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	5.5e-96
WP_000905061.1|1167660_1168260_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|1168288_1168777_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_151039334.1|1168789_1171597_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.0	0.0e+00
WP_000333503.1|1171583_1171739_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|1171747_1172122_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_096936375.1|1172177_1172690_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	1.2e-92
WP_151039336.1|1172689_1173874_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	96.4	1.3e-219
WP_021520808.1|1174031_1175141_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	95.9	7.9e-198
WP_000488107.1|1175183_1175444_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|1175633_1175774_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
1176717:1176840	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 7
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	1406936	1414568	5310338		Enterobacteria_phage(100.0%)	7	NA	NA
WP_001292774.1|1406936_1408073_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_050938814.1|1408069_1410070_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|1410194_1410656_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1410696_1411167_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1411213_1411933_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1411929_1413615_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1413836_1414568_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
>prophage 8
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	1648722	1734739	5310338	integrase,transposase	Enterobacteria_phage(16.67%)	49	1662624:1662683	1733631:1735585
WP_085947598.1|1648722_1649884_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001195819.1|1650752_1651238_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_050940191.1|1651440_1653585_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|1653584_1654895_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|1655074_1655359_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|1655730_1657071_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_135259174.1|1657435_1658494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|1658675_1659431_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|1659724_1660657_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_001131474.1|1660982_1662173_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	5.8e-130
1662624:1662683	attL	TGTCACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAATCAGATCCAGGGGGTAA	NA	NA	NA	NA
WP_000255944.1|1662709_1663732_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|1663731_1664511_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_151039344.1|1664611_1665773_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
WP_000901352.1|1666130_1667147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940277.1|1667146_1668175_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	26.0	5.0e-13
WP_001066242.1|1672947_1673448_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050939755.1|1674077_1674545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088748.1|1675658_1676480_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_000116047.1|1676489_1677380_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_000414795.1|1677391_1679296_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_000665944.1|1679308_1680442_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000192889.1|1680450_1681479_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000082085.1|1681490_1683038_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	4.6e-10
WP_050939752.1|1683089_1684019_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_050939749.1|1684050_1685037_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_063113454.1|1685321_1687247_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.0	4.8e-25
WP_050939744.1|1687258_1688764_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_050939742.1|1689054_1689918_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157904463.1|1690743_1691094_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_050939729.1|1692410_1693721_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_050939726.1|1693748_1695029_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_050939722.1|1695021_1696824_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	1.8e-21
WP_050939719.1|1696810_1698523_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	26.8	4.0e-31
WP_050939716.1|1698779_1699739_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_050939713.1|1699929_1706037_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	5.2e-33
WP_050939708.1|1706124_1715616_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_050939705.1|1715612_1716713_+	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_000194282.1|1716709_1717513_+	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_001088826.1|1717516_1719094_+	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_050939701.1|1719224_1721246_+	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_050939697.1|1722104_1724075_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_050939694.1|1724093_1724891_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_050939690.1|1725066_1725720_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_050939687.1|1726331_1726970_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.6	3.6e-54
WP_050939684.1|1726954_1728184_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	1.3e-60
WP_172636182.1|1729954_1730305_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	34.3	3.8e-05
WP_050939675.1|1731327_1731621_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	89.7	6.5e-43
WP_050939672.1|1732067_1732337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|1733716_1734739_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
1733631:1735585	attR	TGTCACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAATCAGATCCAGGGGGTAATCTGCTCTCCTGATTCAGGAGAGCTTATGGTCACTTTTGAGACAGTTATGGAAATTAAAATCCTGCACAAGCAGGGAATGAGTAGCCGGGCGATTGCCAGAGAACTGGGGATCTCCCGCAATACCGTTAAACGTTATTTGCAGGCAAAATCTGAGCCGCCAAAATATACGCCGCGACCTGCTGTTGCTTCACTCCTGGATGAATACCGGGATTATATTCGTCAACGCATCGCCGATGCTCATCCTTACAAAATCCCGGCAACGGTAATCGCTCGCGAGATCAGAGACCAGGGATATCGTGGCGGAATGACCATTCTCAGGGCATTCATTCGTTCTCTCTCGGTTCCTCAGGAGCAGGAGCCTGCCGTTCGGTTCGAAACTGAACCCGGACGACAGATGCAGGTTGACTGGGGCACTATGCGTAATGGTCGCTCACCGCTTCACGTGTTCGTTGCTGTTCTCGGATACAGCCGAATGCTGTACATCGAATTCACTGACAATATGCGTTATGACACGCTGGAGACCTGCCATCGTAATGCGTTCCGCTTCTTTGGTGGTGTGCCGCGCGAAGTGTTGTATGACAATATGAAAACTGTGGTTCTGCAACGTGACGCATATCAGACCGGTCAGCACCGGTTCCATCCTTCGCTGTGGCAGTTCGGCAAGGAGATGGGCTTCTCTCCCCGACTGTGTCGCCCCTTCAGGGCACAGACTAAAGGTAAGGTGGAACGGATGGTGCAGTACACCCGTAACAGTTTTTACATCCCACTAATGACTCGCCTGCGCCCGATGGGGATCACTGTCGATGTTGAAACAGCCAACCGCCACGGTCTGCGCTGGCTGCACGATGTCGCTAACCAACGAAAGCATGAAACAATCCAGGCACGTCCCTGCGATCGCTGGCTCGAAGAGCAGCAGTCCATGCTGGCACTGCCTCCGGAGAAAAAAGAGTATGACGTGCATCTTGATGAAAATCTGGTGAACTTCGACAAACACCCCCTGCATCATCCACTCTCCATCTACGACTCATTCTGCAGAGGAGTGGCGTGATGATGGAACTGCAACATCAACGACTGATGGTGCTCGCCGGGCAGTTGCAACTGGAAAGCCTTATAAGCGCAGCGCCTGCGCTGTCACAACAGGCAGTAGACCAGGAATGGAGTTATATGGACTTCCTGGAGCATCTGCTTCATGAAGAAAAACTGGCACGTCATCAACGTAAACAGGCGATGTATACCCGAATGGCAGCCTTCCCGGCGGTGAAAACGTTCGAAGAGTATGACTTCACATTCGCCACCGGAGCACCGCAGAAGCAACTCCAGTCGTTACGCTCACTCAGCTTCATAGAACGTAATGAAAATATCGTATTACTGGGGCCATCAGGTGTGGGGAAAACCCATCTGGCAATAGCGATGGGCTATGAAGCAGTCCGTGCAGGTATCAAAGTTCGCTTCACAACAGCAGCAGATCTGTTACTTCAGTTATCTACGGCACAACGTCAGGGCCGTTATAAAACGACGCTTCAGCGTGGAGTAATGGCCCCCCGCCTGCTCATCATTGATGAAATAGGCTATCTGCCGTTCAGTCAGGAAGAAGCAAAGCTGTTCTTCCAGGTCATCGCTAAACGTTACGAAAAGAGCGCAATGATCCTGACATCCAATCTGCCGTTCGGGCAGTGGGATCAAACGTTCGCCGGTGATGCAGCACTGACCTCAGCGATGCTGGACCGTATCTTACACCACTCACATGTCGTTCAAATCAAAGGAGAAAGCTATCGACTCAGACAGAAACGAAAGGCCGGGGTTATAGCAGAAGCTAATCCTGAGTAAAACGGTGGATCAATATTGGGCCGTTGGTGGAGATATAAGTGGATCACTTTTCATCCGTCGTTGACAT	NA	NA	NA	NA
>prophage 9
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	2017258	2028707	5310338	integrase	Enterobacteria_phage(72.73%)	13	2013015:2013028	2020363:2020376
2013015:2013028	attL	CATGATAATTTCTT	NA	NA	NA	NA
WP_000162574.1|2017258_2017741_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000124726.1|2018502_2019711_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	6.6e-105
WP_001183325.1|2019714_2021673_+	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	36.3	3.9e-67
2020363:2020376	attR	CATGATAATTTCTT	NA	NA	NA	NA
WP_000446132.1|2021890_2022463_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638635.1|2022536_2023037_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283014.1|2023033_2023768_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	6.1e-130
WP_001149160.1|2024320_2024587_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_123001748.1|2024586_2025009_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	89.8	4.9e-23
WP_001365039.1|2024977_2025175_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	100.0	4.0e-28
WP_052897488.1|2025167_2025455_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	95.8	9.5e-47
WP_000459301.1|2025447_2025903_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|2026038_2026359_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_097462978.1|2026373_2028707_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 10
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	2108778	2121961	5310338		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|2108778_2111340_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|2111445_2112102_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001297141.1|2112152_2112920_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2113115_2114024_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590397.1|2114020_2115283_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2115279_2115918_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|2115922_2116699_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104429.1|2116787_2118152_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|2118245_2119238_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2119300_2120440_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2120579_2121206_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2121199_2121961_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 11
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	2450255	2555170	5310338	transposase,plate,integrase,tail,protease,head	Vibrio_phage(39.22%)	104	2450028:2450044	2503368:2503384
2450028:2450044	attL	TTCGATTCCGAGTCCGG	NA	NA	NA	NA
WP_000534924.1|2450255_2451314_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_040089466.1|2451355_2453011_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_061317333.1|2453003_2454521_-	UvrD-helicase domain-containing protein	NA	A0A126DN25	Acinetobacter_phage	30.8	1.3e-44
WP_040089481.1|2455127_2455772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151039364.1|2455792_2456107_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_040089482.1|2456141_2456780_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.0	1.0e-56
WP_040089483.1|2456764_2457997_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.5	1.9e-59
WP_170989474.1|2458137_2458782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122992006.1|2460474_2462220_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_072278218.1|2462397_2462946_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.9	8.9e-17
WP_040089554.1|2464986_2465244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151039366.1|2465240_2474219_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	39.2	8.4e-56
WP_001243916.1|2474234_2474762_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_061341861.1|2474771_2476424_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.2	1.7e-39
WP_032152656.1|2477100_2477325_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_021580257.1|2477333_2477567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050940555.1|2477653_2478277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157839846.1|2478888_2479032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040089161.1|2479151_2479664_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	39.7	4.1e-08
WP_021580263.1|2481662_2482274_+	YfdX family protein	NA	NA	NA	NA	NA
WP_151039456.1|2482479_2484090_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|2484170_2485193_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|2485192_2485972_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_040089475.1|2486433_2487225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077820601.1|2487577_2487811_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_050940575.1|2487896_2488469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940578.1|2489958_2490978_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_050940580.1|2491087_2491960_+	GTPase family protein	NA	NA	NA	NA	NA
WP_151039368.1|2492332_2495182_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_050940602.1|2495302_2497819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581504.1|2497894_2498350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|2498428_2498662_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234620.1|2498761_2499580_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_050938918.1|2499634_2500120_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.3	3.1e-13
WP_001186727.1|2500135_2500612_+	RadC family protein	NA	NA	NA	NA	NA
WP_050938919.1|2500674_2500896_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	3.2e-10
WP_001339471.1|2501058_2501427_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_050938921.1|2501516_2501894_+	toxin	NA	NA	NA	NA	NA
WP_000761721.1|2501890_2502379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839281.1|2502390_2502588_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001290246.1|2502684_2503257_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000942795.1|2503537_2504074_-	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
2503368:2503384	attR	TTCGATTCCGAGTCCGG	NA	NA	NA	NA
WP_000094974.1|2504075_2505254_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000633238.1|2505250_2506228_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_064760790.1|2506230_2506830_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000820125.1|2506826_2507198_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001115139.1|2507194_2507758_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001087296.1|2507761_2508217_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173448.1|2508233_2509457_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_040100330.1|2509966_2510470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040100331.1|2510588_2511293_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	97.0	2.0e-130
WP_001372435.1|2511243_2511429_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	72.6	7.5e-21
WP_040100333.1|2511548_2512115_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	83.5	3.9e-84
WP_052924219.1|2514706_2515237_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	70.5	1.6e-68
WP_077793277.1|2515251_2515770_-	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	64.0	5.2e-35
WP_040100337.1|2516250_2516835_-	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.2	2.5e-49
WP_040100339.1|2516819_2517896_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	51.8	7.9e-94
WP_040100341.1|2517885_2518338_-	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	41.4	3.7e-21
WP_000523890.1|2518334_2518871_-|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	40.2	4.1e-27
WP_052924218.1|2518861_2519932_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	47.2	2.0e-89
WP_052924217.1|2519931_2521206_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	36.7	3.0e-68
WP_052924216.1|2521205_2522999_-|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	51.5	1.5e-121
WP_001127483.1|2522985_2523123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924215.1|2523085_2523481_-|tail	phage tail assembly protein	tail	M4MB64	Vibrio_phage	48.3	2.1e-20
WP_001062748.1|2523482_2523839_-|tail	phage tail tube protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	35.5	2.9e-13
WP_040100351.1|2523848_2525324_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	55.9	2.5e-154
WP_052924214.1|2525323_2525509_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_052924213.1|2525489_2526101_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	43.8	7.3e-36
WP_000513058.1|2526097_2526640_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	63.1	1.6e-58
WP_000540583.1|2526639_2527077_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.7	3.7e-34
WP_001290368.1|2527076_2527388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924212.1|2527466_2528369_-|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	57.2	1.1e-99
WP_052924211.1|2528368_2529331_-	peptidase	NA	M1Q578	Vibrio_phage	46.6	1.6e-77
WP_052924210.1|2529544_2530309_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	59.7	4.0e-92
WP_052924209.1|2530301_2531873_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	57.9	6.6e-158
WP_112793722.1|2531869_2533396_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	68.3	2.1e-196
WP_052924208.1|2533401_2533983_-	DUF3486 family protein	NA	M1PJ86	Vibrio_phage	56.0	1.7e-50
WP_001080359.1|2533972_2534131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040100367.1|2534120_2534420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024168521.1|2534422_2534710_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.6	1.6e-25
WP_001557437.1|2534715_2535021_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	40.4	9.6e-13
WP_052924207.1|2535005_2535233_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_000371427.1|2535229_2535838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924206.1|2535825_2536236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924205.1|2536219_2536447_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	68.5	1.4e-24
WP_040100373.1|2536448_2537045_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	43.9	2.7e-35
WP_040100375.1|2537130_2537580_-	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	62.7	4.2e-41
WP_040100376.1|2537576_2538128_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	81.9	7.6e-85
WP_040100378.1|2538105_2538495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040100379.1|2538487_2538670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151039372.1|2538662_2539205_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	85.9	1.5e-85
WP_001107927.1|2539304_2539829_-	host-nuclease inhibitor Gam family protein	NA	A0A0C4UQY5	Shigella_phage	96.6	1.4e-88
WP_040100384.1|2539849_2540137_-	hypothetical protein	NA	A0A0C4UQR4	Shigella_phage	92.6	1.9e-42
WP_001151278.1|2540156_2540426_-	hypothetical protein	NA	C9DGL5	Escherichia_phage	60.7	1.5e-22
WP_000987801.1|2540458_2540686_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	85.3	8.9e-32
WP_001026713.1|2540699_2541638_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	88.1	1.3e-153
WP_040100386.1|2541676_2543665_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A0C4UR24	Shigella_phage	98.2	0.0e+00
WP_001473846.1|2543672_2543894_-	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	100.0	4.9e-35
WP_040100388.1|2544081_2544606_+	hypothetical protein	NA	A0A0C4UQZ2	Shigella_phage	99.4	3.3e-93
WP_000498836.1|2546107_2548168_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_050938923.1|2548197_2549157_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001324279.1|2549174_2549585_-	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_001297673.1|2549650_2550460_-	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001034492.1|2550607_2555170_-|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
>prophage 12
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	3509125	3611120	5310338	terminase,tRNA,capsid,holin,lysis,plate,integrase,head,tail,protease,portal,transposase	Escherichia_phage(39.13%)	104	3538276:3538335	3610031:3611315
WP_000560983.1|3509125_3509563_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|3509607_3510549_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|3510612_3511521_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|3511749_3512061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|3512061_3512352_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|3512956_3513175_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|3513393_3513636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399648.1|3513864_3514845_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000027708.1|3515291_3516221_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|3516217_3516853_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|3516849_3517752_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|3517764_3520815_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|3521008_3521842_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001298963.1|3521994_3523035_+	YiiG family protein	NA	NA	NA	NA	NA
WP_050938947.1|3523084_3524833_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_050938948.1|3524832_3525903_-	aminopeptidase	NA	NA	NA	NA	NA
WP_050938949.1|3525892_3527344_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729597.1|3527354_3527801_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|3528101_3528416_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|3528425_3529250_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211502.1|3529491_3530751_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144072.1|3530747_3532217_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217139.1|3532504_3533341_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|3533324_3534263_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063489.1|3534259_3535294_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|3535578_3536199_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166066.1|3536458_3537442_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270266.1|3537590_3538265_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
3538276:3538335	attL	GTAGATACTGTTATGGCCTGCAAGTTTTTTCCTGGTCCGGTTTCCCGGATTGCAGGCATG	NA	NA	NA	NA
WP_000399648.1|3538384_3539365_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000580417.1|3539696_3541070_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|3541066_3541765_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|3541914_3542415_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_021578869.1|3542601_3543582_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.7	1.0e-185
WP_000777029.1|3543651_3543945_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|3544081_3544354_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|3544523_3545024_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557701.1|3545087_3545312_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_042964138.1|3545311_3545614_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	97.0	1.9e-45
WP_001113264.1|3545613_3545838_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_024243679.1|3545834_3546110_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	1.1e-44
WP_042964139.1|3546099_3548385_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
WP_042964140.1|3548496_3550335_+	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	85.9	4.4e-310
WP_042964141.1|3550684_3551719_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	5.5e-201
WP_021538485.1|3551718_3553491_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085953.1|3553664_3554519_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_001248558.1|3554577_3555651_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_044860736.1|3555654_3556398_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_000988633.1|3556497_3557007_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|3557006_3557210_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|3557213_3557495_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144090.1|3557494_3557992_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
WP_044860737.1|3558006_3558432_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	6.1e-58
WP_044860738.1|3558419_3558845_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	2.3e-65
WP_072146842.1|3558816_3558990_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_042964144.1|3558952_3559420_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_001001786.1|3559412_3559865_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_001697715.1|3559931_3560567_+|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	100.0	3.1e-114
WP_000127172.1|3560563_3560911_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_042964146.1|3560915_3561824_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	2.0e-162
WP_042964147.1|3561816_3562347_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.3	5.6e-101
WP_151039388.1|3562357_3564613_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	60.9	3.4e-232
WP_042964149.1|3564614_3565142_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.0	5.4e-88
WP_170990657.1|3565411_3565957_+	lysogenic conversion protein	NA	Q858S7	Enterobacteria_phage	97.2	2.1e-95
WP_042964151.1|3566286_3567477_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_001251408.1|3567489_3568008_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_016235448.1|3568064_3568340_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.8e-40
WP_000785970.1|3568372_3568492_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_042964152.1|3568484_3570932_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	91.7	0.0e+00
WP_042964153.1|3570946_3571426_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.7	5.6e-84
WP_042964155.1|3571425_3572589_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	8.3e-206
WP_000468308.1|3572670_3572889_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076748.1|3573125_3574028_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|3574208_3575171_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_050939263.1|3575490_3576480_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708998.1|3576586_3577342_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|3577396_3578164_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|3578271_3578871_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|3578971_3579412_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|3579623_3579923_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|3579949_3580378_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|3580382_3581129_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|3581225_3582236_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|3582370_3583879_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|3583901_3584747_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3585172_3585418_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3585502_3585988_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3586080_3587007_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|3587073_3588405_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|3588414_3588945_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068837.1|3589037_3589997_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|3590088_3591114_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001341957.1|3591269_3593468_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|3593670_3593883_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_151039390.1|3594042_3598227_+	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
WP_001323627.1|3598228_3598552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797341.1|3599458_3600067_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|3600250_3600568_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_050940270.1|3600844_3602005_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110772.1|3602007_3604440_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000007523.1|3604788_3605679_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001297636.1|3606007_3608188_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_050940273.1|3608281_3609187_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_000647874.1|3609213_3609831_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|3610139_3611120_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
3610031:3611315	attR	GTAGATACTGTTATGGCCTGCAAGTTTTTTCCTGGTCCGGTTTCCCGGATTGCAGGCATGCCAGACACAGCGCCGTCAGGCGCTGTTTTTTTCATCCCTTCCGCGATTTTTACGCCGCTACCGGATTATGCCGTGACGCATCGAACGGCACGCCTGACTTCAGCACTCCATACGCCACCTGTGCCAGCTTGCGCATCATCGCGCCGAGAATCACCTTTCCTTTCTTGCCATTAGCCGCCAGACGGTCGCGGAACGCCCGTCCCCACTCAGTCTTACTGGTGGCTACCATTGCGGGCATATACAACGCCCTGCGAAGCGACACATGTCCGGCCTTACTCATCCGGCTCGCCCCTCTCACACTGCTACCTGATTCATAACGCCGTGGTGTCAGACCCGCAAAAGCGGCGAACTGTCTGGCATGGGCGAAGCGGTCCTTCAGACCGATATAAGCCAGCAATACCGCAGATGTTTTCTCTCCGATACCCGGGATGCTTTCCAGCAGTTTCCTGCGGTGTTTCATATCCGGATCATCGTCTGTCAGGTCTTTTATCTGCTTCTCAAGACGCTTCAGCTCTGCTTCAAGCCACAGAAGGTGAGCATCAATGCTCGGTCTCTGGACTTCCCGCGCCGTTTCAGTGCGATTCAGTTCCTGCGTGTGCATATCTGTCAGCGCCTGGTGGCGGACTACCAGGGCACGCAACGCGCGTTCAAGCGGGTGAGGCGCTTCCCAGGCTGCAGGGCGCTTCTGACGACAGAACTCTGCCAGCATGCGCGCATCCACGGTATCAGTCTTGTTACGCAGTCCTTCACTCTGAGCGAAAGCTTTACCCAGCGCAGGATTAATGACTGACACTATGTAGCCAGCATCGTAAAGGCACTCAGCGACAGGTTCCATATAGGTGCCGGTCGCTTCGATGCAGATATGCGCATGGTCAATCTTGTGACCTTTCAGCCAGCTCACCAGCTCATCGTGCCCTTTAGTGGTGTTAGCGAATTTTTTGGTGCGATGACGACCATCAGGACGCAACACATCGACATCCAGTTTCTCTTTAGCGGTGTCGATACCGATATAATGAAGTTCATGTTCCATAGTGAAACCAACCTTGCAAATACGGATTACCGGGAAAACCGGTCCATGATACTGTCCGGTTTATCACTTTGGGAGAAAGGCAGTCCGCTGCATAAATCTACGCAACAGGTTAGAACCCAAGGCCCGATACGGCATGCGGACTGCAGGCAGAGAAAACTGGCCGATTTTCTCTGCACTGGAGGGATAATACAAGGC	NA	NA	NA	NA
>prophage 13
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	4032863	4044708	5310338	integrase	Enterobacteria_phage(90.0%)	15	4027502:4027516	4060696:4060710
4027502:4027516	attL	TCAAAAGCCAGCTGG	NA	NA	NA	NA
WP_000776997.1|4032863_4034129_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.5	2.2e-74
WP_000418440.1|4034187_4035081_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000932801.1|4035089_4035605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205027.1|4035802_4036114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001825860.1|4036423_4036996_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_021038238.1|4037069_4037570_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_033810335.1|4037566_4038301_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	5.2e-129
WP_001149160.1|4038853_4039120_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_080213683.1|4039116_4039707_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	97.0	4.5e-67
WP_001244670.1|4039699_4039987_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_080213682.1|4039979_4040435_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856725.1|4040570_4040891_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_136829793.1|4040905_4043239_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_044815386.1|4043585_4043780_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001219054.1|4043997_4044708_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.7	1.8e-41
4060696:4060710	attR	TCAAAAGCCAGCTGG	NA	NA	NA	NA
>prophage 14
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	4136839	4208735	5310338	terminase,holin,capsid,tRNA,integrase,head,tail,protease,portal,transposase	Escherichia_phage(33.33%)	81	4131476:4131490	4166028:4166042
4131476:4131490	attL	TGCCTGACTGAACTG	NA	NA	NA	NA
WP_050940454.1|4136839_4138063_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	4.4e-234
WP_000040218.1|4138349_4139069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001404194.1|4140167_4140530_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_001401560.1|4140520_4141057_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_050940458.1|4141184_4142009_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.5	1.1e-148
WP_000135680.1|4142074_4142437_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859462.1|4143123_4143798_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4143888_4144089_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_032206597.1|4144132_4144684_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	98.9	1.3e-100
WP_050940460.1|4144680_4145517_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.3	8.4e-152
WP_000933942.1|4145509_4145746_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	100.0	1.6e-39
WP_021522644.1|4145742_4146561_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.4	6.2e-123
WP_072095577.1|4146557_4147052_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	2.1e-86
WP_050940465.1|4147051_4147705_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	9.6e-127
WP_050940467.1|4147701_4148028_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	5.9e-53
WP_000767113.1|4148024_4148414_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061414.1|4148433_4149231_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_063113543.1|4149238_4150228_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	98.5	2.3e-193
WP_050940472.1|4150245_4150599_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	87.7	1.6e-56
WP_050940475.1|4150931_4151339_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	63.2	1.1e-43
WP_001318187.1|4151374_4152106_+	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	74.4	5.2e-97
WP_024186198.1|4152656_4152872_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	2.2e-32
WP_050940478.1|4152876_4153227_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_050940480.1|4153290_4153824_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	6.2e-100
WP_001228684.1|4154040_4154226_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.0	2.7e-18
WP_001323403.1|4154449_4155229_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|4155228_4156251_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_135259168.1|4156307_4156640_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	99.0	1.7e-55
WP_050939787.1|4156787_4157270_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	1.1e-84
WP_050939785.1|4157269_4159027_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_000478567.1|4159038_4159221_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_000466244.1|4159220_4160462_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	2.2e-241
WP_001193631.1|4160439_4161090_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_050939783.1|4161104_4162310_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	98.0	3.6e-220
WP_000601355.1|4162360_4162549_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_050939781.1|4162560_4162866_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	92.1	1.6e-39
WP_050939779.1|4162874_4163213_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	98.2	4.6e-56
WP_050939778.1|4163209_4163659_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	3.9e-63
WP_050939774.1|4163655_4164000_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	99.1	2.1e-56
WP_050939772.1|4164060_4164765_+	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	96.6	7.9e-119
WP_000164661.1|4164779_4165151_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_050939796.1|4165174_4165453_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	1.6e-43
WP_077793285.1|4165499_4168775_+	tape measure protein	NA	A0A1B5FPE2	Escherichia_phage	80.2	3.2e-303
4166028:4166042	attR	CAGTTCAGTCAGGCA	NA	NA	NA	NA
WP_050939768.1|4168778_4169246_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	52.3	8.3e-40
WP_050939762.1|4169242_4169725_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	69.2	1.6e-57
WP_050939760.1|4169735_4170116_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	82.5	9.0e-61
WP_050939757.1|4170112_4172815_+	MoaD/ThiS family protein	NA	A0A286S259	Klebsiella_phage	58.1	0.0e+00
WP_157904466.1|4172857_4174768_+|tail	phage tail protein	tail	B1GS50	Salmonella_phage	46.6	5.1e-27
WP_072095528.1|4174739_4175144_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_050940596.1|4176570_4177098_+	hypothetical protein	NA	Q9LA59	Enterobacterial_phage	73.2	3.7e-60
WP_050939632.1|4177485_4177734_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	96.3	4.5e-37
WP_000202564.1|4177953_4179540_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|4179932_4180538_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|4180664_4180826_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|4180947_4182021_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563055.1|4182017_4182800_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088405.1|4182912_4183776_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_047087182.1|4183747_4185298_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|4185555_4186335_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477811.1|4186461_4187784_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_000816471.1|4187835_4189059_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|4189138_4189858_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566138.1|4190132_4190282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105865.1|4190313_4191330_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|4191357_4192002_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|4192107_4193076_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_151039448.1|4193124_4194507_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093810.1|4194527_4195760_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|4196066_4197734_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|4197944_4199882_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|4199971_4200298_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001338221.1|4200339_4200852_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_050939635.1|4200903_4201551_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|4201547_4202417_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|4202627_4203101_+	protein CreA	NA	NA	NA	NA	NA
WP_001188659.1|4203113_4203803_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219614.1|4203802_4205227_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_000920337.1|4205284_4206637_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|4206696_4207413_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|4207508_4207649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223181.1|4208048_4208735_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	4406108	4468972	5310338	plate,transposase,tRNA,protease	Escherichia_phage(20.0%)	51	NA	NA
WP_001295561.1|4406108_4407461_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4407490_4409923_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4410044_4410530_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|4410533_4411559_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4411663_4412119_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4412122_4412911_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000166360.1|4412910_4414059_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569401.1|4414055_4414652_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	3.9e-26
WP_001294757.1|4414686_4418169_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|4418181_4419141_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|4419239_4421381_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|4421437_4421827_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176525.1|4421891_4423190_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|4423238_4423499_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4423485_4423686_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185294.1|4423851_4424397_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|4424393_4424816_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|4424829_4425540_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001325359.1|4425694_4426519_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_050938964.1|4426571_4428290_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094031.1|4428400_4429108_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|4429104_4429509_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|4429626_4430442_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4430481_4431135_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|4431127_4432159_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140186.1|4432346_4432919_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|4438669_4439473_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000255944.1|4440156_4441179_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|4441178_4441958_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001230983.1|4442583_4443384_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211686.1|4443461_4444232_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4444279_4445638_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052721.1|4445709_4446465_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|4446498_4447221_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4447217_4447685_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|4447749_4448481_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086139.1|4449019_4449805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|4450431_4451346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|4451389_4451872_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|4451895_4453248_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122985538.1|4453258_4456693_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240524.1|4456801_4458214_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_050940106.1|4458218_4458962_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614400.1|4458958_4461724_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|4461732_4462494_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246444.1|4462498_4463830_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4463832_4464357_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113713.1|4464353_4465634_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_050940104.1|4465658_4466741_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|4466704_4468555_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|4468558_4468972_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 16
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	4503659	4513766	5310338	integrase	Enterobacteria_phage(100.0%)	12	4501790:4501803	4514387:4514400
4501790:4501803	attL	CTGCCGCCATTCTT	NA	NA	NA	NA
WP_075631356.1|4503659_4504826_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.9	1.5e-143
WP_072648910.1|4504837_4506082_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_072648911.1|4506074_4506728_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_151039271.1|4506941_4507514_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	4.2e-94
WP_000638628.1|4507587_4508088_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_151039273.1|4508084_4508819_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	8.8e-129
WP_001149160.1|4509371_4509638_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_151078000.1|4509634_4510234_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.0	2.5e-49
WP_052897488.1|4510226_4510514_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	95.8	9.5e-47
WP_151039701.1|4510506_4510962_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	8.0e-64
WP_000856725.1|4511097_4511418_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_136829793.1|4511432_4513766_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
4514387:4514400	attR	CTGCCGCCATTCTT	NA	NA	NA	NA
>prophage 17
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	4766464	4835854	5310338	terminase,tRNA,lysis,capsid,integrase,head,tail,protease,portal,transposase	Enterobacteria_phage(42.86%)	72	4776626:4776672	4827328:4827374
WP_000912345.1|4766464_4767850_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|4767885_4768407_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4768514_4768727_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_050938753.1|4768728_4769595_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.3e-30
WP_000776555.1|4770075_4770618_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_050938752.1|4770837_4771530_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_050938751.1|4771560_4774170_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691054.1|4774182_4775190_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|4775200_4775716_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|4775718_4776351_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
4776626:4776672	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001624790.1|4776685_4777849_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	5.2e-200
WP_000206812.1|4778075_4778381_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	9.2e-48
WP_000008165.1|4778734_4779271_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_135259079.1|4779398_4780223_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.5	1.9e-148
WP_000135680.1|4780288_4780651_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000559922.1|4781121_4781637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135259078.1|4781956_4782649_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	1.3e-126
WP_001191674.1|4782746_4783007_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515847.1|4782999_4783551_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_001250269.1|4783726_4783906_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104986.1|4783895_4784837_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	1.9e-152
WP_000255944.1|4785103_4786126_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|4786125_4786905_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000210176.1|4787287_4787614_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|4787610_4788000_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061408.1|4788019_4788817_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_089613523.1|4788824_4789814_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_001204780.1|4789831_4790215_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_151039280.1|4790404_4791502_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	1.8e-154
WP_000670959.1|4792090_4792306_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|4792305_4792803_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|4793019_4793202_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|4793292_4793586_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_089613521.1|4793876_4794287_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|4794572_4794779_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|4794943_4795138_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453587.1|4795526_4796072_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|4796046_4797972_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|4797968_4798175_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001316285.1|4798171_4799773_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_016244345.1|4799753_4801085_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	96.3	2.8e-226
WP_001565292.1|4801094_4801427_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	91.8	3.3e-51
WP_000118193.1|4801482_4802508_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_016244346.1|4802549_4802945_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	89.4	3.2e-53
WP_000753019.1|4802956_4803310_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975048.1|4803321_4803900_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_151039283.1|4803896_4804292_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	1.1e-69
WP_001349920.1|4804299_4805040_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|4805055_4805478_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|4805459_4805894_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840258.1|4805886_4808448_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|4808444_4808774_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152667.1|4808773_4809472_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
WP_001361264.1|4809477_4810221_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.1e-150
WP_000090917.1|4810157_4810790_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_151039286.1|4810850_4814249_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	89.3	0.0e+00
WP_089613516.1|4814315_4814915_+	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	98.0	6.3e-109
WP_089613515.1|4814979_4818582_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	97.7	0.0e+00
WP_000488338.1|4818881_4819772_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|4819790_4820297_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|4820333_4820834_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|4820912_4821095_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|4821592_4822261_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226371.1|4822805_4824290_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201812.1|4824476_4825430_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|4825928_4826513_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001298108.1|4826537_4826975_-	acetyltransferase	NA	NA	NA	NA	NA
WP_050938750.1|4827417_4828179_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4827328:4827374	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224567.1|4828361_4829252_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001580085.1|4829252_4832225_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|4832211_4834449_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420923.1|4834717_4835854_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP044313	Escherichia coli strain RM11911 chromosome, complete genome	5310338	5263441	5310333	5310338	terminase,holin,capsid,integrase,head,tail,protease,portal,transposase	Escherichia_phage(50.0%)	59	5259512:5259527	5298380:5298395
5259512:5259527	attL	GCCAGAACTGCGCCAG	NA	NA	NA	NA
WP_000156526.1|5263441_5265202_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|5265387_5265840_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|5265915_5266956_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|5267312_5267822_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|5268040_5268670_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_072095558.1|5268632_5270795_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|5270804_5271251_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420537.1|5271373_5273428_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|5273459_5273918_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|5274013_5274676_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|5274848_5275262_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|5275306_5275624_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|5275681_5276872_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|5276966_5277245_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|5277241_5277571_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|5277661_5278321_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_072095559.1|5278728_5279748_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	2.9e-85
WP_000273158.1|5279716_5279968_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_050940245.1|5280034_5282500_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	7.3e-103
WP_050940247.1|5282577_5282781_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032215066.1|5282777_5282966_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_050940250.1|5283520_5284033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|5284640_5285663_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|5285662_5286442_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001678562.1|5287114_5287270_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
WP_042973537.1|5287435_5287843_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	53.1	9.8e-13
WP_000920567.1|5287925_5288156_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_050940044.1|5288139_5288691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940042.1|5288662_5289703_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	92.0	9.6e-97
WP_157902152.1|5289614_5290157_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	8.3e-84
WP_050940040.1|5290191_5290977_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	47.4	7.4e-49
WP_077793295.1|5291033_5291288_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.5	1.2e-21
WP_050940036.1|5291284_5291581_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	5.4e-45
WP_050940034.1|5291773_5292085_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	6.9e-51
WP_050940032.1|5292212_5292395_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	1.3e-25
WP_032215076.1|5292387_5292564_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	91.4	3.3e-26
WP_077793294.1|5292560_5292980_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	82.7	3.3e-40
WP_050940030.1|5293088_5293376_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	50.5	8.7e-16
WP_050940027.1|5294225_5294486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063113410.1|5294552_5294831_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	3.3e-12
WP_050940018.1|5294832_5295879_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	5.0e-109
WP_050940016.1|5295891_5296263_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	9.8e-36
WP_050940013.1|5296252_5296624_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_050940011.1|5296777_5297596_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917767.1|5297882_5298080_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_050940008.1|5298190_5299237_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	91.9	2.2e-189
5298380:5298395	attR	CTGGCGCAGTTCTGGC	NA	NA	NA	NA
WP_032215181.1|5300007_5300397_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	83.8	7.1e-45
WP_047649223.1|5300386_5300665_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	83.7	2.4e-34
WP_050940005.1|5300666_5301212_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.5	2.4e-91
WP_050940003.1|5301279_5301561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940000.1|5302218_5302767_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	85.6	2.1e-58
WP_050939997.1|5302738_5304655_+|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	64.8	1.5e-252
WP_000640654.1|5304658_5304868_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	49.2	1.0e-10
WP_050552957.1|5304912_5306436_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.8	6.8e-184
WP_050939995.1|5306425_5308042_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.4	1.0e-100
WP_050939993.1|5308082_5308418_+|head	head decoration protein	head	A0A0K2FIF9	Escherichia_phage	49.1	6.8e-20
WP_040073334.1|5308487_5309516_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.7	5.8e-110
WP_042973861.1|5309564_5309945_+	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	61.1	2.8e-09
WP_000753028.1|5309958_5310333_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	59.8	3.1e-29
>prophage 1
NZ_CP051656	Escherichia coli strain RM11911 plasmid pRM11911	175089	20958	159015	175089	tRNA,transposase,integrase,protease	Escherichia_phage(25.0%)	101	120127:120186	159043:160997
WP_050940639.1|20958_22494_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.6	1.1e-101
WP_000695052.1|23925_24246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032284964.1|24337_24628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032285356.1|25085_26456_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	K7P7Q7	Enterobacteria_phage	39.1	4.2e-23
WP_050437790.1|26412_26694_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_050940639.1|27683_29219_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.6	1.1e-101
WP_000255944.1|29612_30635_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|30634_31414_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_050939798.1|32752_33010_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_050939800.1|33002_33746_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_000549794.1|33870_34152_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_050939804.1|34138_34684_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_072095529.1|34613_34955_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_050939810.1|34941_35334_+	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_050939813.1|35320_36694_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_050939816.1|36690_39516_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000850423.1|40035_40767_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_069903968.1|41019_43200_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000911315.1|43208_43607_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450532.1|43606_43834_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_050939819.1|43915_49186_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_050939821.1|49205_49946_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.9	1.0e-07
WP_000868986.1|50004_50865_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000139319.1|50967_51525_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001327131.1|51679_51883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000760078.1|52627_53089_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	33.1	7.4e-17
WP_001109066.1|53191_53575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047649939.1|53797_54004_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083838.1|54284_54533_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|54779_54854_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000131011.1|54846_55704_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_157905840.1|56618_56795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050939068.1|57793_58798_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_072095473.1|59048_59714_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	27.9	2.9e-06
WP_077793267.1|59748_59907_+	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_050939063.1|60226_60694_+	DNA polymerase III subunit epsilon	NA	A2I2Z6	Vibrio_virus	49.1	2.7e-06
WP_050939085.1|61018_61477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050939060.1|62069_62351_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_050939058.1|62350_62626_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_050939055.1|62731_63013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050939053.1|63249_63501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050939047.1|66825_67344_+	alpha-hemolysin-activating lysine-acyltransferase HlyC	NA	NA	NA	NA	NA
WP_050939044.1|67344_70419_+	RTX toxin hemolysin HlyA	NA	NA	NA	NA	NA
WP_050939042.1|70489_72613_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.7	8.4e-47
WP_050939040.1|72631_74068_+	alpha-hemolysin T1SS ABC transporter subunit HlyD	NA	NA	NA	NA	NA
WP_169072621.1|76383_77085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050939030.1|78111_81156_+	cytotoxic necrotizing factor CNF2	NA	NA	NA	NA	NA
WP_072095470.1|83098_83875_+	cytolethal distending toxin type III subunit CdtA	NA	G1BEM3	Escherichia_phage	94.2	5.6e-126
WP_000759934.1|83871_84681_+	cytolethal distending toxin type III/V nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	100.0	4.0e-151
WP_050939027.1|84695_85241_+	cytolethal distending toxin type III subunit CdtC	NA	M1SNM4	Escherichia_phage	97.2	1.0e-97
WP_050939024.1|87143_88340_+	hypothetical protein	NA	W6JL68	Anomala_cuprea_entomopoxvirus	42.0	8.3e-44
WP_050939019.1|90128_91238_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_050939074.1|91309_92212_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_021573890.1|95598_96159_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	55.1	3.2e-46
WP_001253824.1|96487_97435_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000976359.1|102690_102960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172636469.1|104883_108042_-	AIDA repeat-containing protein	NA	NA	NA	NA	NA
WP_000040077.1|108034_109255_-	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_050939008.1|109772_111311_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	1.6e-297
WP_000612591.1|111360_111708_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|111704_112085_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_040072486.1|113104_114052_+|protease	omptin family outer membrane protease OmpP	protease	NA	NA	NA	NA
WP_072095474.1|114156_115644_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_135259140.1|116394_117135_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361618.1|117419_118397_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.0e-100
WP_135259203.1|119873_120200_+	hypothetical protein	NA	NA	NA	NA	NA
120127:120186	attL	GTGTCACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAATCAGATCCAGGGGGTA	NA	NA	NA	NA
WP_000255944.1|120213_121236_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|121235_122015_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_032285357.1|122637_123150_-	M agglutinin-type afimbrial adhesin BmaE/AfaE-8	NA	NA	NA	NA	NA
WP_032285358.1|123685_124105_-	adhesin	NA	NA	NA	NA	NA
WP_032285371.1|124120_126631_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_032285359.1|126877_127645_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001323645.1|127722_128067_-	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_032285360.1|128609_128798_+	dolichol monophosphate mannose synthase	NA	NA	NA	NA	NA
WP_000624722.1|130560_130911_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_032285361.1|130907_131333_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	1.7e-47
WP_050940111.1|131617_131881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050561356.1|132018_132228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940109.1|132390_136290_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.3	4.7e-237
WP_001189111.1|139995_141504_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001104898.1|142486_142708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086174.1|142708_143392_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	8.7e-30
WP_172636184.1|143589_144027_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	4.1e-25
WP_085004465.1|144026_145301_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.7	2.7e-141
WP_001278818.1|145302_145719_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_077166745.1|145711_146692_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	2.2e-79
WP_000030199.1|147105_147414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|147500_148145_-	ParA family protein	NA	NA	NA	NA	NA
WP_063121642.1|148323_149130_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	9.2e-55
WP_032285172.1|149130_149436_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813639.1|149437_149656_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_050940296.1|150504_151743_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	27.8	4.8e-26
WP_172636186.1|151726_152554_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_032280058.1|152556_153573_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000379710.1|153574_153844_+	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_135259177.1|153840_155373_+	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	5.2e-06
WP_001825139.1|155404_155857_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000371887.1|156183_156441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032285175.1|156440_157031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001323403.1|157213_157993_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|157992_159015_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
159043:160997	attR	TACCCCCTGGATCTGATTTCAGGCGTTGGGTGTGGATCACTATTGCACCGTTCGTGACACCATTCACTTCACGTGCAGGTAGCTGACTCATTTCATACTCCAGCGTCCGGGTTTCCCATGTGGTACTCCCCTGCAGCTCCATACGGGCAGTTCGTGTGCAGTACTGCTCCACCTGTAAATCCCGCTCACAGGTGTAATTCGTGTATTCACTCCTGCTAATCTCCTGCGCACTGCACTGCTGCCCGGTGTTTCCCACAATGCTGTCAGCCCGGTTCACCACATCCCTGCCGGTCTGGATAAACGGTGCATCCGGTGAAAGAATGTCTTTCGGCTTGTTCATGAATGACTCTGTAATGGTTTTTCCGGTTTCACCGGTCGCCCATTCCGTGGTGCCGTCATTTTTCAGGCCGCCATCCCCGCCGGCAGTCACGCCACCGTAATATTTTGTCTCGTCCGGATTCGCGTTATAGCCGGGGATACTCTCCTGTGGCTTAAAGCCCTGAATACTGCTGCTTCCCTGCCCTTTGATCTGGTGAGCAAAATCAGAACCGGCCCGGTAATCACTGTTGCTGTCAGCCTGTGCCATGCCGGCAACCAGAGCCAGTATCAGAGGTAAAATACGTTTCATTTCCCGGAATCTCCTTTCCCTGCCAGTAAATCATGAGCCACCTGCCGGCAGTCACCCGTGGCGGCCACTTTCTCCAGCGCCTGGCCGACCCGCAGGTTTCCCCGGATGATGTCGTATCCCTGACTGCAGAACACCACCAGTGCCGGTACAGTGCGAATGCCGTACTGTGAAAACAGCGTCGGGTCGATCTGAACACCATCAGTCGCGCCGTCTTTCACCAGGGACAACACAGCTTCAGCGGTGGTCTTCAGGTCATTGTTCACCATGCCCCGCAGTGTGGCCGGAATACCGTAGTGCCGGGTTTCGCCCAGCATTCGTTTCAGCCCCTCTTCGGGAATGGAAAACGACACAAAATACAGAGCACCCTGCCGGGGTTTCCCGTCCTGCGAAGCCTGCTGTTTACGAACCAGCTCATCCAGGAAATGGTTATCTGAACGCTGAAGGGGGTTTTCCAGCACCTGTTTCTCCGCCCAGGCTTTCAGCTGATGGTCAGGTTTTTCACGCAGTTGTCTGCTTAAATTTTCCTGCTGCTTCAGGAACTGGCGGTTTTCAGGAGTGTTCACGTTTTCTGACGCCATAACCGCCCCGTTCAGCATCATCAGCAGTGCTGCCAGAGATTTCATACTCAGCTTCATCATTCACCTCACAGGAAGACACAGTTACGTTTACGCCACATCAGGTAGCCGAAGTTTTTCTTTGTGTTGGGCGGATTTTTCCCGGTTTCCCAGCGGGTCACGCTGCGCCCGAACGGGTGGCACTGCCCGCTGTCCGGATACATATTCACCATCTGGTAACGCCAGCGTTCTTTGGGCAGGATTGGGGACGGATATTCATTACAGATGGCGTTATTTTTCCCGATGGTTTCCATAATCATGCCCTGACGGTGCAGCTTGAACGCCATGCGTTCACTGACCAGCAGGGAGGACTGCAACGGACTGGACTCATTACTCACCCAGCCATTGAACGGGTACATACTTCCCTGCGAACCGGCACACCAGAACAGAACATCGAGAGGCATATTAAAGGCGCTGGCAATCGCATCTGCTGCGCAGGCTCCCTGTGCTATCGGATTGGCAAAGATGACAGCTTCCGGATTGAGAATGGTGGTCAGGCTGCTGTCCGTCCAGGTGGGGTCGATTTCAGAAAGATAAGCGATATCCAGGTCACCACCTTCCAGACAGCCCAGCGATGTGATGATGTTCAGCCAGTACGTCAGCGGGTATTTGTACCAGTGAACGTGATAGAACGCCCCATTTACCTGCTTCTCATCCTTTTTCGCCGTTCCCTGTGCCGTTTTACCAAAAGCCGGCAGGCTGAAGCCCAGGTT	NA	NA	NA	NA
