The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	341261	348401	5444105		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|341261_341900_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590407.1|341896_343159_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	1.4e-134
WP_000847985.1|343155_344064_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|344259_345027_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|345077_345734_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272924.1|345839_348401_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	484281	525314	5444105	integrase,holin,plate,tail,terminase	Salmonella_phage(48.89%)	52	484495:484512	527205:527222
WP_000054752.1|484281_484542_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
484495:484512	attL	TTCACACATATCACAATT	NA	NA	NA	NA
WP_001138330.1|484756_486154_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001135919.1|486347_487742_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.4	3.2e-212
WP_001288450.1|487852_488782_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	38.1	2.5e-48
WP_001213770.1|488784_489798_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	52.5	2.2e-101
WP_000312945.1|489770_490064_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	6.6e-27
WP_000637723.1|490053_490353_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	64.2	4.2e-29
WP_000008820.1|490349_490565_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000065469.1|490570_492634_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	8.7e-275
WP_000551021.1|492680_493310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000769005.1|493362_493911_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_001113516.1|493926_495228_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	4.0e-132
WP_000051355.1|495230_496133_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_000801965.1|496129_496279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001288046.1|496503_497028_+	hypothetical protein	NA	K7P861	Enterobacteria_phage	47.5	1.4e-35
WP_000567466.1|497446_498121_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	51.1	1.8e-59
WP_000016209.1|498262_498463_+	transcriptional regulator	NA	K7RWG7	Bacteriophage	50.0	1.0e-07
WP_001520086.1|498466_500653_+	replication protein	NA	B6SD37	Bacteriophage	72.4	2.4e-174
WP_001244506.1|500941_501364_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001174014.1|501395_501737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781776.1|502182_502524_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194119.1|502527_503004_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000779566.1|502987_503512_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_000162796.1|503573_504146_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_001130793.1|504148_505771_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000113491.1|505770_507237_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	3.9e-261
WP_000873185.1|507877_509098_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.3	1.1e-200
WP_001066733.1|509101_509608_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	9.8e-71
WP_000627490.1|509619_510561_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	1.4e-155
WP_001040697.1|510601_510970_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	88.5	1.4e-53
WP_000042170.1|510935_511343_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	4.3e-69
WP_000008726.1|511339_511894_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	71.7	2.5e-67
WP_001142484.1|511880_512270_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_012816811.1|512244_512808_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.0e-80
WP_000046933.1|512811_513957_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	6.1e-161
WP_000109249.1|513967_514408_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393954.1|514411_514864_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000990884.1|515041_517030_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.8	1.0e-272
WP_001300247.1|517029_517617_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	2.6e-83
WP_001007341.1|517616_517919_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	8.2e-49
WP_000081745.1|517921_518986_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.7	3.0e-154
WP_000832849.1|518988_519336_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.1	3.5e-27
WP_000044737.1|519343_519898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000213605.1|519901_520072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001007933.1|520134_520887_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.3	5.9e-88
WP_001270633.1|520886_521240_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_001197085.1|521239_522439_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.4	8.3e-185
WP_000049950.1|522435_523116_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_001096968.1|523115_523814_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	68.9	2.4e-27
WP_000376434.1|523817_524237_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.7	4.2e-35
WP_001030532.1|524208_524811_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.0	4.6e-99
WP_024179951.1|524810_525314_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	55.8	4.9e-46
527205:527222	attR	TTCACACATATCACAATT	NA	NA	NA	NA
>prophage 3
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	979216	988658	5444105		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|979216_980143_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|980147_980879_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|980859_980967_-	protein YohO	NA	NA	NA	NA	NA
WP_001240402.1|981026_981758_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|981979_983665_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|983661_984381_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|984427_984898_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|984938_985400_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001298843.1|985524_987525_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292774.1|987521_988658_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 4
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	1139826	1204808	5444105	transposase,tail,head,integrase	Escherichia_phage(46.15%)	50	1142888:1142903	1180037:1180052
WP_162829241.1|1139826_1141040_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001435023.1|1141103_1141277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221623.1|1141264_1141672_+	hypothetical protein	NA	NA	NA	NA	NA
1142888:1142903	attL	TTTCAGGGAAATATCC	NA	NA	NA	NA
WP_000656344.1|1143986_1145021_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_000739825.1|1145023_1145989_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001066367.1|1146045_1146804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973179.1|1151699_1152245_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1152241_1152985_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193798.1|1152996_1154076_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986308.1|1154137_1155073_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011461.1|1155529_1156447_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011007.1|1156548_1157499_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122994120.1|1157616_1159260_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|1159887_1160604_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1160946_1162401_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378571.1|1162502_1163819_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000477878.1|1164133_1165186_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_162829241.1|1171364_1172577_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001300307.1|1174327_1175125_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_155701499.1|1175360_1176386_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.6e-102
WP_000096346.1|1176385_1176589_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048403.1|1176647_1179119_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	1.7e-59
WP_001090200.1|1179211_1179403_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1179399_1179588_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1180158_1180368_+	hypothetical protein	NA	NA	NA	NA	NA
1180037:1180052	attR	TTTCAGGGAAATATCC	NA	NA	NA	NA
WP_023982533.1|1180368_1181007_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|1181018_1181171_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_024173647.1|1181463_1181802_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	1.5e-06
WP_000747951.1|1182193_1182436_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693883.1|1182419_1182845_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262348.1|1182916_1183999_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788760.1|1184005_1184752_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_000450617.1|1184773_1185490_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_042353845.1|1185522_1185804_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000699809.1|1185800_1186028_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|1186020_1186332_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|1186459_1186678_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|1186679_1187237_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1187470_1187683_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1187802_1188147_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|1188268_1188541_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|1188542_1189592_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|1189604_1189964_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|1189972_1190527_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|1190752_1190950_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|1191085_1191799_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000259002.1|1199266_1199473_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000256824.1|1202591_1202939_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_000201501.1|1204078_1204462_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|1204454_1204808_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
>prophage 5
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	1266764	1301153	5444105	portal,head,holin,integrase,plate,capsid,tail,terminase	Enterobacteria_phage(90.0%)	48	1265699:1265758	1301260:1301383
1265699:1265758	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|1266764_1266905_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|1267094_1267355_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132840.1|1267397_1268507_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	8.2e-195
WP_000005405.1|1268664_1269849_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	4.0e-224
WP_000290462.1|1269848_1270361_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651570.1|1270416_1270791_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	5.8e-36
WP_000333503.1|1270799_1270955_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853415.1|1270941_1273749_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.0	0.0e+00
WP_000979946.1|1273761_1274250_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954201.1|1274406_1274979_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000885642.1|1275022_1275601_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	87.4	5.5e-94
WP_000108490.1|1275600_1277871_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	1.3e-146
WP_000071720.1|1277873_1278404_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_155701510.1|1278396_1279293_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.0	2.8e-153
WP_152927524.1|1279296_1279626_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	2.2e-55
WP_001435012.1|1279643_1280210_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.8	3.3e-99
WP_000356339.1|1280221_1280857_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920586.1|1280849_1281317_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000780544.1|1281454_1281862_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	3.2e-64
WP_000072346.1|1281858_1282251_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	1.4e-69
WP_000104350.1|1282247_1282571_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1282573_1282774_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063094.1|1282773_1283268_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000632362.1|1283369_1284170_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.3e-130
WP_001055104.1|1284215_1285268_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_001262654.1|1285291_1286128_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_000613800.1|1286282_1288034_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|1288033_1289080_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000711113.1|1289610_1290141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211256.1|1290677_1290989_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	5.0e-49
WP_000686553.1|1290993_1291953_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	6.4e-180
WP_001288348.1|1292029_1294870_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.9	0.0e+00
WP_000564228.1|1294866_1295256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372767.1|1295252_1295870_-	ash family protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000104293.1|1295881_1296181_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	4.0e-40
WP_000153700.1|1296177_1296444_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|1296440_1296644_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543032.1|1296667_1297078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021659.1|1297171_1297285_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	4.0e-09
WP_000357028.1|1297281_1297524_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000159456.1|1297535_1297814_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000739029.1|1297824_1298175_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|1298196_1298400_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|1298471_1298609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|1298698_1299103_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290349.1|1299118_1299769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865207.1|1299798_1300146_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|1300151_1301153_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
1301260:1301383	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 6
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	1330556	1429565	5444105	tRNA,protease,portal,head,holin,lysis,capsid,tail,terminase	Enterobacteria_phage(42.19%)	109	NA	NA
WP_001025336.1|1330556_1332290_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001300190.1|1332505_1333072_+	VOC family protein	NA	NA	NA	NA	NA
WP_001214304.1|1334218_1335319_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000176771.1|1335343_1337773_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564746.1|1337937_1338909_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|1338905_1339649_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|1339689_1340085_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_042854221.1|1340137_1340908_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_096954720.1|1340889_1342203_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	96.8	8.1e-250
WP_000073102.1|1342258_1342495_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.7	8.4e-41
WP_001030139.1|1342503_1342650_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000492057.1|1342653_1342896_-	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	2.4e-35
WP_001091864.1|1342927_1343299_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	98.4	3.8e-64
WP_000566773.1|1343916_1344309_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.9	4.7e-36
WP_000002321.1|1344495_1344711_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	63.4	1.2e-17
WP_000312938.1|1344710_1345070_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	73.1	1.4e-42
WP_000147365.1|1345269_1345470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816784.1|1345475_1346168_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	69.2	1.1e-40
WP_000800135.1|1346312_1347002_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	8.0e-116
WP_001399865.1|1347135_1347408_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	89.6	2.1e-35
WP_000867909.1|1347478_1347772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587263.1|1348707_1349370_+	ash family protein	NA	Q8W643	Enterobacteria_phage	83.2	4.2e-98
WP_000626792.1|1349366_1349561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621936.1|1349557_1349791_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	50.0	9.5e-13
WP_001247847.1|1349777_1350671_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	45.9	2.1e-60
WP_000181080.1|1350688_1351579_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.3	2.6e-82
WP_000184331.1|1351575_1352976_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	94.8	5.4e-252
WP_001435004.1|1352972_1353230_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	96.2	1.8e-33
WP_001215507.1|1353229_1353589_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.3	4.3e-36
WP_000640037.1|1353597_1354152_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	3.0e-65
WP_001382053.1|1354374_1354572_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.4	2.3e-28
WP_000185911.1|1354722_1355781_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	90.6	1.2e-190
WP_000466957.1|1356239_1356671_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000411813.1|1359291_1359498_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000731216.1|1359502_1360492_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.7	1.2e-107
WP_001092850.1|1360534_1361068_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	3.9e-102
WP_032140280.1|1361622_1361709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816783.1|1361710_1362205_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	97.4	1.9e-74
WP_000736383.1|1362201_1362426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347012.1|1362782_1362920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032164595.1|1363059_1363245_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.3	6.4e-20
WP_001429103.1|1363672_1364179_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.9	1.5e-34
WP_024182572.1|1364150_1366079_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
WP_155701515.1|1366062_1366269_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.4	2.3e-10
WP_109114055.1|1366265_1367858_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253979.1|1367847_1369353_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_000256824.1|1369389_1369737_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_000522591.1|1369794_1370823_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|1370874_1371258_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|1371250_1371604_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974986.1|1371619_1372153_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.2e-58
WP_000683079.1|1372149_1372545_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235112.1|1372552_1373305_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000479108.1|1373318_1373750_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533411.1|1373776_1374190_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_047087948.1|1374170_1376732_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.8	0.0e+00
WP_000847345.1|1376728_1377058_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152532.1|1377057_1377756_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000140735.1|1377760_1378504_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.4e-144
WP_071790928.1|1378440_1379073_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.1	5.7e-92
WP_032362296.1|1379133_1382613_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_032162956.1|1382679_1383279_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	3.7e-109
WP_032362297.1|1383343_1384657_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	98.4	9.7e-78
WP_001101700.1|1384658_1384928_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_012816780.1|1385689_1386325_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001434995.1|1386452_1387511_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144084.1|1387589_1388240_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	40.7	1.1e-37
WP_001132098.1|1388423_1389014_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_099561169.1|1389000_1389123_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001217551.1|1389259_1389508_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	93.9	3.8e-36
WP_000891620.1|1389861_1390428_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|1390737_1392510_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001443602.1|1392627_1393080_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907248.1|1393108_1393849_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|1393883_1394405_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001386853.1|1395079_1395145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|1395283_1395895_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|1395903_1396914_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|1397060_1397846_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|1397842_1398598_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|1398676_1399609_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|1399624_1400947_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|1401066_1402038_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091148.1|1402168_1403611_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056706.1|1403738_1404608_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301729.1|1404945_1406421_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	3.4e-79
WP_001069467.1|1406655_1408467_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|1408503_1409145_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173511.1|1409200_1410379_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|1410512_1410803_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|1410869_1411226_+	protein YebF	NA	NA	NA	NA	NA
WP_000024745.1|1411552_1412212_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936935.1|1412420_1414481_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|1414477_1415140_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|1415163_1415820_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|1415921_1416152_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204700.1|1416290_1416665_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|1416668_1417541_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|1417553_1417895_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812712.1|1418290_1418947_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_001296140.1|1418947_1419139_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|1419243_1419480_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057022.1|1419597_1421037_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001297532.1|1421116_1423750_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207283.1|1423718_1425002_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|1425131_1425629_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|1425725_1426424_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|1426443_1428492_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|1428683_1429565_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 7
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	1674653	1706727	5444105	transposase,holin	Escherichia_phage(36.0%)	38	NA	NA
WP_000041687.1|1674653_1677080_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001443598.1|1677690_1678401_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|1678403_1678964_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|1678998_1679340_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1679474_1679801_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|1680006_1681221_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836067.1|1681232_1682252_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_072095801.1|1682309_1682420_+	transporter	NA	NA	NA	NA	NA
WP_001369004.1|1682439_1683735_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_000005551.1|1683754_1684006_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_000990639.1|1684077_1686495_-	exonuclease	NA	V5UQJ3	Shigella_phage	59.8	4.4e-177
WP_001369006.1|1686587_1686776_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1686772_1686961_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001399959.1|1687613_1687958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368621.1|1688073_1688313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379598.1|1688472_1688628_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
WP_000787426.1|1688829_1689237_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	48.1	8.3e-28
WP_000912290.1|1689313_1689541_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705373.1|1689524_1690076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020574.1|1690047_1691088_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157904138.1|1690999_1691542_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	1.7e-84
WP_001368628.1|1691574_1692321_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	85.9	7.6e-112
WP_001443694.1|1692317_1692482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001815900.1|1693180_1693939_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1694220_1694433_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001299354.1|1694653_1694914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816774.1|1694980_1695259_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265265.1|1695260_1696310_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.2e-107
WP_032362300.1|1696322_1696697_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	8.7e-32
WP_000762928.1|1696693_1697515_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_032362301.1|1698592_1700566_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	74.8	9.5e-287
WP_001213059.1|1700713_1700896_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289716.1|1700933_1701203_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	76.4	1.6e-08
WP_000284491.1|1701278_1701494_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	98.6	2.0e-33
WP_162829241.1|1702076_1703289_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000391471.1|1703352_1703523_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	96.4	1.5e-23
WP_001299329.1|1704122_1705013_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.2	1.6e-153
WP_001120551.1|1706484_1706727_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
>prophage 8
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	1849356	1963553	5444105	transposase,tRNA,protease,portal,holin,tail,terminase	Escherichia_phage(43.75%)	112	NA	NA
WP_001372110.1|1849356_1850565_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	4.9e-209
WP_001261013.1|1851095_1851764_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586733.1|1852066_1852660_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|1852656_1853649_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234058.1|1853772_1854753_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140884.1|1854747_1855284_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1855346_1855571_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|1855710_1857366_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013786.1|1857590_1858934_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|1859150_1860074_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098524.1|1860111_1861752_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|1862150_1862300_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1862371_1862545_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|1862789_1863320_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|1863508_1864510_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115948.1|1864551_1865991_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027931.1|1866187_1866988_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139570.1|1867259_1871162_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|1871362_1871968_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627367.1|1872018_1873335_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431858.1|1873324_1875082_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890912.1|1875097_1875994_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177525.1|1875993_1876599_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000471489.1|1876769_1879076_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097794.1|1879139_1880000_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123462.1|1880231_1880822_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039882.1|1880803_1881754_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|1881854_1883168_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|1883194_1884400_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|1884399_1884822_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|1884811_1886239_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969779.1|1886240_1887029_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292341.1|1887028_1887796_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206364.1|1887792_1888863_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|1888870_1889368_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|1889382_1890129_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|1890137_1890425_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191072.1|1890436_1891366_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186465.1|1891650_1893696_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535475.1|1893943_1896217_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_162829241.1|1896612_1897826_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001067524.1|1899322_1900228_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_162137202.1|1900399_1900729_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
WP_000698145.1|1900733_1900919_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000762229.1|1903761_1904751_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001298828.1|1904861_1905284_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1905280_1905547_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628159.1|1905820_1909345_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|1909710_1910844_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|1910984_1911419_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_122988840.1|1913452_1913530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101703.1|1913640_1913910_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
WP_155701523.1|1913911_1915216_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	97.9	3.9e-79
WP_155701526.1|1915280_1915880_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_155701528.1|1915946_1919423_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_155701576.1|1919668_1920301_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	96.7	1.1e-103
WP_000194761.1|1920246_1920990_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.0e-148
WP_001414147.1|1921000_1921699_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	1.8e-131
WP_000847298.1|1921698_1922028_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_103654637.1|1922024_1924670_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	98.9	0.0e+00
WP_000532073.1|1924713_1925022_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|1925048_1925471_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|1925484_1926237_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|1926244_1926643_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_001450644.1|1926655_1927279_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	98.6	2.9e-104
WP_001281347.1|1927281_1927563_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001097065.1|1927555_1927882_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114429.1|1927969_1929994_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974568.1|1929938_1931441_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|1931440_1931653_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|1931649_1933773_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|1933769_1934246_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|1934761_1934947_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|1935174_1935321_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1935320_1935890_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087730.1|1936160_1936694_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001072899.1|1936698_1936914_-|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|1936991_1937237_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000142777.1|1937277_1937457_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_096954730.1|1937593_1939540_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.2	0.0e+00
WP_000640170.1|1941102_1941657_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_000228038.1|1941653_1941944_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000940343.1|1941943_1942543_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
WP_000818161.1|1943050_1943536_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|1943554_1943734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967409.1|1943944_1944157_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.2e-25
WP_000373318.1|1944510_1945305_+	protein kinase	NA	A0A1S5V1U4	Saudi_moumouvirus	29.7	7.3e-12
WP_000789359.1|1945288_1946005_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001224661.1|1946264_1946438_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.2e-25
WP_000403785.1|1946533_1946890_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001118156.1|1946962_1947343_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.5	4.1e-29
WP_155701530.1|1947358_1948129_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.4	3.1e-84
WP_000788990.1|1948150_1948897_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_001359125.1|1948903_1949692_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	6.1e-43
WP_000702025.1|1949769_1950192_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_001033914.1|1950188_1950431_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|1950527_1950947_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|1951253_1951406_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000560226.1|1951814_1952036_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000245528.1|1952029_1952206_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_001452559.1|1952280_1952556_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	3.7e-40
WP_040061950.1|1952657_1955330_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	83.8	0.0e+00
WP_000166317.1|1955322_1956132_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_096245389.1|1956188_1956383_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	90.6	2.7e-29
WP_001302840.1|1956375_1956564_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|1956663_1956879_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001358842.1|1956880_1958116_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	2.3e-238
WP_001157382.1|1958167_1959103_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
WP_000123745.1|1959231_1960605_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|1960634_1960808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387395.1|1961082_1962066_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|1962320_1963553_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 9
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	2039843	2099423	5444105	protease,portal,integrase,holin,tail,terminase	Enterobacteria_phage(38.46%)	71	2053622:2053649	2099560:2099587
WP_000422045.1|2039843_2040893_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|2041112_2041871_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278904.1|2041867_2042458_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2042497_2043370_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2043470_2044091_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_096954718.1|2044087_2044969_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2045106_2045151_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194591.1|2045242_2046805_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2046804_2048400_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983911.1|2048400_2049762_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209519.1|2049773_2050967_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|2050966_2051773_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2052153_2052333_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2052418_2052919_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079494.1|2052964_2053471_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2053622:2053649	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000251936.1|2053960_2054131_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_032156508.1|2054508_2055093_-	protein kinase	NA	NA	NA	NA	NA
WP_001101703.1|2056223_2056493_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
WP_155701533.1|2056494_2057808_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.4	2.2e-82
WP_001230517.1|2057872_2058472_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.7e-109
WP_155701535.1|2058538_2062015_-	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	94.4	0.0e+00
WP_137531697.1|2062255_2062885_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.6	1.2e-102
WP_155701537.1|2062830_2063574_-	Mov34/MPN/PAD-1 family protein	NA	Q9EYE4	Enterobacteria_phage	98.4	5.9e-149
WP_001302134.1|2063584_2064283_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	5.2e-131
WP_000847298.1|2064282_2064612_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918238.1|2064608_2067254_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.4	0.0e+00
WP_000532073.1|2067297_2067606_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|2067632_2068055_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|2068068_2068821_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2068828_2069227_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974960.1|2069239_2069863_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_001281350.1|2069865_2070147_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2070139_2070466_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001365078.1|2070553_2072533_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_000974567.1|2072522_2074025_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|2074024_2074237_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|2074233_2076357_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|2076353_2076830_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|2077304_2077490_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2077717_2077864_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2077863_2078433_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087730.1|2078703_2079237_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001072899.1|2079241_2079457_-|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2079534_2079780_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000142777.1|2079820_2080000_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_096954730.1|2080136_2082083_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.2	0.0e+00
WP_000935552.1|2082586_2083645_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	1.5e-206
WP_000917735.1|2083795_2083993_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762909.1|2084219_2085041_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.5e-81
WP_000904137.1|2085037_2085412_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001265167.1|2085424_2086474_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
WP_032156506.1|2086475_2086754_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
WP_077625879.1|2086823_2087084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2087300_2087513_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000373318.1|2087866_2088661_+	protein kinase	NA	A0A1S5V1U4	Saudi_moumouvirus	29.7	7.3e-12
WP_000789359.1|2088644_2089361_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001224661.1|2089620_2089794_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.2e-25
WP_000403785.1|2089889_2090246_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001118156.1|2090318_2090699_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.5	4.1e-29
WP_000450846.1|2090714_2091485_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.4	1.4e-84
WP_157837342.1|2091518_2092061_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000020532.1|2091972_2093013_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_000705378.1|2092984_2093536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|2093519_2093747_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|2093824_2094232_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379610.1|2094421_2094574_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000449192.1|2095061_2095250_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2095246_2095438_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016241189.1|2095530_2098002_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_000113189.1|2098066_2098315_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2098292_2099423_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2099560:2099587	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 10
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	2202685	2277594	5444105	transposase,tRNA,head,integrase,holin,capsid,tail,terminase	Stx2-converting_phage(31.37%)	81	2222057:2222071	2278019:2278033
WP_001297484.1|2202685_2203792_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_096954721.1|2203827_2204469_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2204472_2205843_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|2206010_2206682_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735406.1|2206681_2208142_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|2208743_2209025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816762.1|2209280_2209823_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	43.6	1.5e-32
WP_000224599.1|2210028_2210442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380886.1|2210454_2210790_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907455.1|2210802_2211858_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000796962.1|2211857_2212064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|2212315_2212540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233304.1|2212666_2212939_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126687.1|2212949_2213360_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000192401.1|2213356_2213608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833618.1|2213808_2215209_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000770175.1|2215205_2215505_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204981.1|2215510_2215744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000336166.1|2215736_2216201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816761.1|2216190_2217219_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953272.1|2217276_2217465_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085258.1|2217820_2219050_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_000456506.1|2219298_2220420_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359439.1|2220565_2221795_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2222044_2223181_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2222057:2222071	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799400.1|2223164_2224028_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938111.1|2224390_2225752_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_024201799.1|2226128_2229530_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	2.3e-219
WP_001301673.1|2230121_2232470_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2232489_2232579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|2232685_2232955_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_032362337.1|2232956_2234270_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.1	4.8e-77
WP_001434935.1|2234334_2234934_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	4.4e-110
WP_155701540.1|2235001_2238475_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_047085664.1|2238713_2239346_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_032362323.1|2239291_2240035_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	1.8e-145
WP_169301903.1|2240142_2241355_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	3.5e-167
WP_032362331.1|2241395_2242052_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.8	7.9e-121
WP_000807922.1|2242051_2242393_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	6.2e-61
WP_000212998.1|2242385_2245628_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.5	0.0e+00
WP_122993730.1|2245678_2245888_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000710954.1|2245983_2246358_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	8.6e-64
WP_001275441.1|2246372_2247089_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|2247155_2247500_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2247496_2247943_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2247939_2248290_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2248300_2248627_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063096.1|2251153_2251375_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_001399867.1|2253420_2255082_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|2255078_2255642_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279814.1|2255932_2256298_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.7e-64
WP_001302977.1|2256339_2256525_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|2256654_2256795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|2257151_2257376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|2257440_2257647_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001003112.1|2258293_2258827_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_000138558.1|2258986_2259259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085954673.1|2259514_2259730_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	95.8	5.0e-32
WP_000143049.1|2260013_2261864_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|2263034_2263856_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000904098.1|2263852_2264227_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
WP_001265175.1|2264239_2265289_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_001341388.1|2265290_2265569_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000884071.1|2265736_2265949_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.1	1.2e-17
WP_001278450.1|2266137_2266242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627694.1|2266357_2266942_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.0e-34
WP_000450874.1|2267409_2268180_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.3	2.2e-82
WP_000788938.1|2268205_2268946_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095671.1|2268952_2269915_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693916.1|2269937_2270363_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2270346_2270670_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948452.1|2270794_2271271_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001443692.1|2271589_2271745_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	5.7e-06
WP_001171966.1|2271904_2272123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358071.1|2272126_2272291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2272691_2272880_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2272876_2273068_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048411.1|2273160_2275632_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|2275693_2275963_+	excisionase	NA	NA	NA	NA	NA
WP_000074973.1|2275931_2277050_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_001113310.1|2277126_2277594_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
2278019:2278033	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 11
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	2423935	2484072	5444105	transposase,protease,head,holin,tail,terminase	Escherichia_phage(41.94%)	74	NA	NA
WP_000003672.1|2423935_2424523_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186416.1|2424519_2425227_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107389.1|2425245_2427039_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023982790.1|2427035_2428154_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000938124.1|2429278_2430640_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023483.1|2431094_2431364_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000381372.1|2431401_2432973_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000624622.1|2432992_2433340_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2433339_2434017_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000268886.1|2434072_2435386_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.3	4.8e-77
WP_001434935.1|2435450_2436050_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	4.4e-110
WP_136868064.1|2436117_2439591_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.7	0.0e+00
WP_047085664.1|2439829_2440462_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_032362323.1|2440407_2441151_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	1.8e-145
WP_032362363.1|2441156_2441855_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.6	1.9e-128
WP_000807922.1|2441854_2442196_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	6.2e-61
WP_000212998.1|2442188_2445431_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.5	0.0e+00
WP_122993730.1|2445481_2445691_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000710954.1|2445786_2446161_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	8.6e-64
WP_001275441.1|2446175_2446892_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|2446958_2447303_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2447299_2447746_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2447742_2448093_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2448103_2448430_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063096.1|2450957_2451179_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_001399867.1|2453224_2454886_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|2454882_2455446_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001400346.1|2455735_2456101_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	3.8e-64
WP_001448509.1|2456142_2456367_+	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|2456448_2456763_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2457288_2457474_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000455402.1|2457701_2457851_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_044377595.1|2457850_2458420_-	antirepressor	NA	A0A2R2Z339	Escherichia_phage	98.4	2.9e-103
WP_000087730.1|2458690_2459224_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001072899.1|2459228_2459444_-|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2459521_2459767_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000142777.1|2459807_2459987_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_155701544.1|2460123_2462061_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	96.3	0.0e+00
WP_000466957.1|2462538_2462970_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|2463419_2464133_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|2464267_2464465_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640048.1|2464706_2465237_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|2465245_2465605_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265113.1|2465617_2466664_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001342259.1|2466665_2466938_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|2467073_2467331_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|2467336_2467636_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_000350274.1|2467840_2468074_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_001229296.1|2468181_2468547_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000209152.1|2468548_2468767_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001289353.1|2468854_2469490_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000753069.1|2469486_2469663_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	100.0	4.6e-28
WP_001224662.1|2469655_2469838_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|2469871_2470084_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|2470134_2470491_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001209480.1|2470468_2470930_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266133.1|2470926_2471223_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001040234.1|2471219_2471612_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_072096947.1|2472386_2472929_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000729535.1|2472840_2473851_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_000693932.1|2473937_2474375_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_001172789.1|2474371_2474632_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000578360.1|2474758_2475151_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001022415.1|2475197_2475557_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000692026.1|2475559_2475862_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_012817750.1|2476197_2476497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|2476568_2476787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2476790_2476955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2477355_2477544_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2477540_2477729_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032362341.1|2477823_2480274_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|2480341_2480584_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_162829241.1|2481462_2482675_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_155701546.1|2482758_2484072_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.4e-81
>prophage 12
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	2488417	2530526	5444105	protease,head,holin,integrase,capsid,tail,terminase	Enterobacteria_phage(34.21%)	53	2514855:2514870	2536244:2536259
WP_000649829.1|2488417_2488945_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_012816788.1|2489716_2490460_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	8.6e-148
WP_001357740.1|2490465_2491164_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|2491163_2491493_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000533415.1|2494052_2494466_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	6.0e-42
WP_000479070.1|2494492_2494924_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	1.4e-41
WP_000106786.1|2494937_2495690_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	4.6e-133
WP_000683066.1|2495697_2496093_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975041.1|2496089_2496623_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.3e-57
WP_001204554.1|2496637_2496991_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201523.1|2496983_2497358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|2497409_2498438_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000256809.1|2498495_2498843_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_155701549.1|2498879_2500385_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.7	1.1e-98
WP_000259002.1|2501961_2502168_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012816750.1|2502151_2504080_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.6e-262
WP_000235436.1|2504051_2504561_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001303878.1|2505268_2505583_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|2506110_2506296_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|2506517_2506631_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003111.1|2506851_2507385_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_000138558.1|2507544_2507817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|2508072_2508288_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000874348.1|2508728_2510579_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_106913077.1|2511345_2512059_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|2512193_2512391_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000265267.1|2512677_2513496_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|2513647_2514019_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|2514008_2514380_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|2514392_2515442_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
2514855:2514870	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_001341388.1|2515443_2515722_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813254.1|2515889_2516045_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000955173.1|2516146_2516284_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|2516649_2517423_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|2517774_2518188_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|2518203_2518974_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788749.1|2519055_2519742_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	9.8e-106
WP_001205820.1|2519748_2520864_-	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	2.2e-131
WP_000273724.1|2520942_2521398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|2521604_2522030_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|2522013_2522286_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|2522394_2522796_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|2522823_2523015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|2523014_2523302_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|2523578_2523734_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|2523875_2524265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|2524451_2524637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|2525210_2525399_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|2525395_2525587_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034468.1|2525680_2528152_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_000273151.1|2528219_2528462_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|2528439_2529459_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375136.1|2529866_2530526_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
2536244:2536259	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
>prophage 13
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	2754304	2797350	5444105	transposase,portal,head,holin,integrase,lysis,capsid,tail,terminase	Enterobacteria_phage(52.5%)	46	2749941:2749955	2805744:2805758
2749941:2749955	attL	CAGGCCATCTTCCAG	NA	NA	NA	NA
WP_001399730.1|2754304_2755594_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000767413.1|2755652_2756129_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001102750.1|2756807_2758046_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	82.3	3.6e-207
WP_001131649.1|2758383_2758959_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	76.4	1.8e-76
WP_000652078.1|2759510_2760335_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	5.8e-153
WP_000950986.1|2760558_2761440_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.1	2.3e-147
WP_096150060.1|2761603_2761735_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950792.1|2762081_2763062_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	1.7e-87
WP_001023455.1|2763238_2763508_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_072004822.1|2763509_2764823_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	98.4	1.5e-75
WP_001230425.1|2764887_2765487_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.3e-109
WP_000515380.1|2765554_2768950_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.2	0.0e+00
WP_000090913.1|2769010_2769613_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	3.6e-88
WP_001152517.1|2770299_2770998_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	88.4	5.4e-120
WP_000847379.1|2770997_2771327_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_032362273.1|2771323_2773903_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.5	0.0e+00
WP_000533411.1|2773883_2774297_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_000479115.1|2774323_2774755_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143022.1|2774768_2775521_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.1e-126
WP_000683065.1|2775528_2775924_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000975031.1|2775920_2776454_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_001204560.1|2776468_2776822_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000201513.1|2776814_2777198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522623.1|2777249_2778278_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|2778335_2778683_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253918.1|2778719_2780225_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_000831809.1|2780214_2781807_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.2	9.3e-184
WP_000259002.1|2781803_2782010_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2783879_2784389_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|2784783_2784978_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881322.1|2785165_2785783_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	86.4	3.8e-93
WP_000092314.1|2785932_2786370_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	95.9	9.4e-70
WP_000075135.1|2786366_2786864_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_024164617.1|2786863_2787079_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000023266.1|2787517_2789368_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000499453.1|2789666_2789825_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2789910_2790654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|2790838_2791528_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|2791542_2791665_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|2792003_2792963_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028841.1|2793174_2793840_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_001108024.1|2793836_2794448_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.0	8.7e-98
WP_000566868.1|2794440_2794611_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254222.1|2794607_2794790_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_162829241.1|2795065_2796278_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_042094857.1|2796330_2797350_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	3.9e-191
2805744:2805758	attR	CAGGCCATCTTCCAG	NA	NA	NA	NA
>prophage 14
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	3010476	3075643	5444105	transposase,tRNA,protease,portal,head,integrase,lysis,capsid,tail,terminase	Enterobacteria_phage(56.6%)	69	3018957:3019003	3065437:3065483
WP_000394594.1|3010476_3011613_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383945.1|3011881_3014119_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|3014105_3017078_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|3017078_3017969_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|3018151_3018913_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3018957:3019003	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|3019425_3020379_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|3020565_3022050_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239874.1|3022595_3023264_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|3023629_3023743_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|3023811_3024045_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_000087133.1|3024363_3024954_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000885588.1|3025051_3025627_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.9e-105
WP_151296748.1|3025626_3028542_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	2.5e-57
WP_001230323.1|3028606_3029206_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	2.6e-110
WP_000515573.1|3029272_3032671_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.4	0.0e+00
WP_001309913.1|3032731_3033379_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000140729.1|3033276_3034020_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.0e-150
WP_001152638.1|3034025_3034724_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	6.6e-134
WP_000847379.1|3034723_3035053_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000459457.1|3037522_3037957_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3037938_3038361_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001298904.1|3038376_3039117_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000683105.1|3039124_3039520_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|3039516_3040095_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|3040106_3040460_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158905.1|3040471_3040870_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000063280.1|3040911_3041937_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|3041992_3042325_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123319.1|3042334_3043654_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	1.5e-235
WP_001297098.1|3043634_3045236_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000198149.1|3045232_3045439_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|3045435_3047361_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000453580.1|3047335_3047881_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001298906.1|3048269_3048464_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	9.7e-27
WP_001031427.1|3048628_3048835_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001298896.1|3049120_3049531_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738500.1|3049821_3050115_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3050205_3050388_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3050604_3051102_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|3051101_3051317_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|3051905_3053003_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000332834.1|3053192_3053576_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	3.4e-55
WP_001360050.1|3053593_3054583_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061438.1|3054590_3055400_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767117.1|3055419_3055809_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210187.1|3055805_3056132_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|3056128_3056782_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001305611.1|3056781_3057276_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000104954.1|3057272_3058214_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|3058203_3058383_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|3058558_3059110_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|3059102_3059363_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001400137.1|3059460_3060153_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	3.9e-126
WP_000559922.1|3060472_3060988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3061458_3061821_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|3061886_3062711_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|3062838_3063375_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|3063365_3063728_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206810.1|3063727_3064033_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_001298992.1|3064259_3065423_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|3065757_3066390_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3065437:3065483	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|3066392_3066908_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691050.1|3066918_3067926_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000988366.1|3070577_3071270_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001400141.1|3071489_3072032_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|3072512_3073379_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3073380_3073593_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3073700_3074222_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3074257_3075643_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 15
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	3630636	3726144	5444105	transposase,tRNA,protease,head,holin,integrase,capsid,tail,terminase	Stx2-converting_phage(35.9%)	107	3658504:3658519	3733505:3733520
WP_000399648.1|3630636_3631617_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000738721.1|3631876_3632173_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781067.1|3632386_3633673_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241660.1|3633673_3634606_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001264697.1|3634607_3637070_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|3637150_3637216_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223177.1|3637429_3638116_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|3638515_3638656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|3638751_3639468_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920337.1|3639527_3640880_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219604.1|3640937_3642362_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188666.1|3642361_3643051_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|3643063_3643537_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|3643747_3644617_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|3644613_3645261_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001300180.1|3645312_3645834_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000068679.1|3645918_3646245_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|3646334_3648272_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|3648482_3650150_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|3650456_3651689_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|3651709_3653092_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132949.1|3653140_3654109_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|3654214_3654859_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105865.1|3654886_3655903_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566138.1|3655934_3656084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224877.1|3656358_3657078_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|3657157_3658381_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477808.1|3658432_3659755_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
3658504:3658519	attL	TCACCGCTTTCGCCGC	NA	NA	NA	NA
WP_001295412.1|3659881_3660661_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143237.1|3660918_3662469_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088403.1|3662440_3663304_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563079.1|3663718_3664501_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299187.1|3664497_3665571_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|3665692_3665854_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|3665980_3666586_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202566.1|3666978_3668565_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217548.1|3668784_3669045_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	95.3	8.1e-37
WP_001121225.1|3669637_3670288_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001101699.1|3670572_3670842_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_015740448.1|3670843_3672157_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	2.7e-80
WP_001230466.1|3672221_3672821_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_032362361.1|3672890_3676304_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	85.8	0.0e+00
WP_047085664.1|3676542_3677175_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_032362323.1|3677120_3677864_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	1.8e-145
WP_032362322.1|3677869_3678568_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.1	1.6e-127
WP_000807922.1|3678567_3678909_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	6.2e-61
WP_032357963.1|3678901_3682144_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.4	0.0e+00
WP_122993730.1|3682194_3682404_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000710954.1|3682499_3682874_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	8.6e-64
WP_001275441.1|3682888_3683605_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|3683671_3684016_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3684012_3684459_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3684455_3684806_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3684816_3685143_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063096.1|3687669_3687891_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000173093.1|3687935_3689873_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.8	0.0e+00
WP_001399867.1|3689936_3691598_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958390.1|3691594_3692158_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	1.5e-88
WP_000279817.1|3692447_3692813_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	99.2	4.4e-65
WP_000095749.1|3692854_3693082_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_012816791.1|3693506_3693692_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539794.1|3693919_3694066_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	95.8	1.7e-15
WP_001056806.1|3694065_3694635_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992166.1|3694905_3695439_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	5.6e-101
WP_000731236.1|3695489_3695834_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_024164617.1|3695838_3696054_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_032362364.1|3696492_3698343_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.5	0.0e+00
WP_000752026.1|3698842_3699112_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3699121_3700069_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204852.1|3700575_3701010_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|3701002_3701197_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001108022.1|3701193_3701799_-	recombination protein NinG	NA	G9L693	Escherichia_phage	100.0	8.6e-98
WP_001292290.1|3701798_3702521_-	phage regulatory/antirepressor protein	NA	G9L692	Escherichia_phage	100.0	9.2e-131
WP_001563210.1|3702513_3702723_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_000924600.1|3702682_3703084_-	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_000201603.1|3703158_3703833_-	phage antirepressor Ant	NA	G9L689	Escherichia_phage	100.0	1.6e-129
WP_001254258.1|3704089_3704284_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000638184.1|3704280_3704838_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	3.7e-95
WP_169301903.1|3704821_3706035_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	3.5e-167
WP_000814577.1|3706118_3706565_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	99.3	2.1e-80
WP_000103678.1|3706769_3706985_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|3707117_3707396_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145906.1|3707466_3707757_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	97.9	2.8e-46
WP_000788876.1|3707753_3708455_-	hypothetical protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_000185456.1|3708451_3709390_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_162829241.1|3709572_3710785_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001180318.1|3711170_3711398_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3711476_3712184_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|3712244_3712586_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_162829241.1|3712911_3714125_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000957426.1|3714421_3715468_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745483.1|3715470_3715635_+	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000198445.1|3716123_3716507_+	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000167584.1|3716565_3717036_+	hypothetical protein	NA	G9L670	Escherichia_phage	99.4	1.1e-87
WP_001198858.1|3717227_3717368_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361828.1|3717360_3717525_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	5.5e-23
WP_000995464.1|3717579_3717876_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
WP_000100845.1|3717881_3718667_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186879.1|3718663_3719344_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	99.6	6.0e-132
WP_000682315.1|3719340_3719523_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|3719495_3719687_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077630063.1|3719697_3719979_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	97.8	2.7e-46
WP_000763383.1|3720077_3720299_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289923.1|3720295_3721066_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	97.7	4.0e-140
WP_001400035.1|3721579_3722398_+	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	96.5	1.7e-120
WP_000501170.1|3723201_3724749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218294.1|3724920_3726144_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
3733505:3733520	attR	TCACCGCTTTCGCCGC	NA	NA	NA	NA
>prophage 16
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	4187393	4228994	5444105	transposase,protease,integrase	Stx2-converting_phage(27.27%)	33	4178896:4178910	4231357:4231371
4178896:4178910	attL	CCTGCTGCGAACCGG	NA	NA	NA	NA
WP_001182418.1|4187393_4188473_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|4188472_4189429_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506894.1|4189439_4190648_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|4190665_4191133_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042918.1|4191393_4191723_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957247.1|4191709_4192090_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000355324.1|4192132_4193674_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.6	1.5e-77
WP_001435098.1|4193687_4193831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001443493.1|4195206_4195878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135714.1|4196744_4196885_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
WP_000803992.1|4197186_4197450_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000024297.1|4199445_4199805_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591999.1|4199897_4201517_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134819.1|4201741_4202017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829241.1|4202094_4203307_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000424145.1|4204500_4204803_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|4204811_4205132_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065686.1|4205124_4206828_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966484.1|4206837_4207302_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|4207302_4207977_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|4207988_4208606_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001034024.1|4211260_4215352_+|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	2.6e-310
WP_024182560.1|4216083_4216464_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	3.5e-65
WP_000612591.1|4216460_4216808_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997983.1|4216857_4218396_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.9e-296
WP_000035067.1|4218462_4218651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233443.1|4218668_4221029_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	31.8	2.6e-33
WP_000282106.1|4221183_4221747_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335713.1|4222759_4224193_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000270113.1|4224288_4224516_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000248064.1|4225245_4226859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268402.1|4226951_4227548_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.9	5.9e-99
WP_000290297.1|4227677_4228994_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	6.6e-34
4231357:4231371	attR	CCTGCTGCGAACCGG	NA	NA	NA	NA
>prophage 17
NZ_CP044315	Escherichia coli strain SJ7 chromosome, complete genome	5444105	4561467	4622318	5444105	transposase,protease,head,plate,tail	Shigella_phage(55.0%)	73	NA	NA
WP_000928731.1|4561467_4562298_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_000371928.1|4562342_4562669_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_000448139.1|4562858_4564364_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000589359.1|4564415_4565021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183162.1|4565023_4565791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424549.1|4565793_4566504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985448.1|4566519_4568028_-	PstS family phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000993449.1|4568152_4570600_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
WP_001197646.1|4570618_4572052_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_000253975.1|4572051_4573347_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_000192523.1|4573364_4575338_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_001283723.1|4575334_4577521_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_000799956.1|4577793_4578897_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001002544.1|4579089_4579683_+	NAAT family transporter YhgN	NA	NA	NA	NA	NA
WP_155701561.1|4579728_4581033_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_000528254.1|4581126_4581864_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_001444515.1|4581817_4582018_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|4582132_4582597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|4582635_4582881_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|4582916_4583099_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|4583245_4585285_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|4585384_4585945_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|4586166_4586370_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|4586449_4586971_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|4587005_4587917_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|4587916_4588477_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|4588467_4589550_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|4589549_4589987_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|4589979_4590594_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|4590583_4591708_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|4591691_4593041_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_155701563.1|4593027_4595103_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|4595229_4595706_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|4595720_4596086_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000848437.1|4597594_4597840_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|4597840_4598401_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|4598397_4598817_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002057.1|4598813_4599200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|4599243_4600191_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850822.1|4600190_4601315_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_000094808.1|4601491_4601965_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000046901.1|4602086_4603418_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000532592.1|4603401_4604991_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_001057665.1|4604990_4606655_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360581.1|4606654_4607236_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279082.1|4607238_4607529_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|4607525_4607834_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342747.1|4607814_4608042_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|4608051_4608270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|4608253_4608682_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|4608716_4609217_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|4609288_4609714_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214366.1|4609783_4610293_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000378480.1|4610289_4610586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|4610575_4610773_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_001310453.1|4610765_4611098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|4611113_4611464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633440.1|4611478_4611790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032182839.1|4611786_4612338_-	SANT/Myb domain-containing protein	NA	NA	NA	NA	NA
WP_032182840.1|4612341_4612857_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_032182841.1|4612856_4613390_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	65.5	2.3e-62
WP_032306067.1|4613393_4613936_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.6	1.7e-28
WP_032180723.1|4614033_4614564_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	55.4	1.4e-46
WP_032182843.1|4614575_4614869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180721.1|4614873_4615146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000827936.1|4615142_4615424_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|4615425_4615680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268104.1|4615692_4615914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155701565.1|4615916_4616849_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.7	6.9e-70
WP_032182845.1|4616920_4619011_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.2	1.3e-164
WP_001310454.1|4619012_4619261_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_032180061.1|4619428_4620013_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	9.4e-17
WP_155701567.1|4620272_4622318_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	6.0e-42
