The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	8676	47799	2267305	holin,transposase,tRNA	Paenibacillus_phage(13.33%)	27	NA	NA
WP_062813529.1|8676_9975_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.1	6.2e-93
WP_151130114.1|10351_11602_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	3.1e-57
WP_021349476.1|11675_12104_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	46.4	9.6e-27
WP_021349475.1|12455_13469_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035436592.1|13726_14980_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.0	3.9e-84
WP_048340425.1|15447_16902_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_024500615.1|16905_17649_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	9.2e-33
WP_014562076.1|17968_19342_+	amino acid permease	NA	NA	NA	NA	NA
WP_107504371.1|21156_21246_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_035437017.1|21713_23063_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.6	1.2e-123
WP_151130115.1|24245_25433_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	1.5e-37
WP_151130116.1|25520_25952_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	72.0	4.9e-47
WP_151130117.1|25948_27112_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	3.1e-160
WP_014562078.1|27647_28847_+	nucleoside transporter	NA	NA	NA	NA	NA
WP_003685735.1|29081_30002_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_021815521.1|30190_30928_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_003682414.1|30946_31882_+	nucleoid occlusion protein	NA	I3NLC2	Bifidobacterium_phage	33.6	6.2e-10
WP_151130118.1|31895_32729_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.9	1.8e-16
WP_015638459.1|32741_32942_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_151130119.1|32957_34055_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_042513946.1|34088_34862_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_114698819.1|35132_36275_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	32.4	2.2e-57
WP_021353998.1|36590_37568_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_151130120.1|37720_41458_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_151130121.1|41464_45478_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.3	2.0e-12
WP_003685671.1|45477_46341_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.4	5.6e-58
WP_014562705.1|46611_47799_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
>prophage 3
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	158671	226912	2267305	transposase,tRNA	Bacillus_phage(20.0%)	51	NA	NA
WP_151130148.1|158671_159811_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	1.1e-42
WP_048340463.1|161430_162309_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	1.2e-42
WP_003688751.1|162332_162620_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031746.1|163237_163693_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	1.6e-32
WP_015638522.1|164259_164454_-	CsbD family protein	NA	NA	NA	NA	NA
WP_151130149.1|165422_166403_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_151130150.1|167100_167757_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	25.0	1.2e-12
WP_151130151.1|167854_168253_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_114684400.1|168312_168492_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151130152.1|168486_168876_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_151130153.1|169014_170013_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_151130154.1|171296_172283_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_083276525.1|172429_174304_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_023487886.1|175480_176668_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_080558596.1|176981_177566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024500651.1|177617_177839_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003686653.1|178006_178345_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_151130155.1|179021_180548_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_151130156.1|180743_182606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130157.1|182595_183387_+	cell surface protein	NA	NA	NA	NA	NA
WP_014562110.1|183401_184280_+	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
WP_151130158.1|184281_185208_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_024272103.1|185200_185962_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	8.0e-16
WP_151130159.1|186056_187196_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.1	2.0e-42
WP_151130160.1|187510_188815_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.2	1.4e-44
WP_101889081.1|189180_189480_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_003684277.1|191346_192186_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	62.8	1.9e-98
WP_114684021.1|197990_198962_+	hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.3	1.9e-25
WP_051295765.1|200515_201136_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151130161.1|202206_203085_+	hydantoinase/carbamoylase family amidase	NA	NA	NA	NA	NA
WP_151130162.1|203104_204169_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_151130163.1|204205_204418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130164.1|204535_205474_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_151130165.1|205550_206198_+	nitroreductase	NA	NA	NA	NA	NA
WP_003683956.1|206207_206939_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003683957.1|206949_207264_+	DNA-binding protein	NA	A0A2R3ZXQ3	Staphylococcus_phage	40.4	6.6e-17
WP_151130166.1|207388_208429_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_054173691.1|208633_211159_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.6	2.7e-68
WP_054173692.1|211320_211842_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003683963.1|211876_212422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130167.1|212489_213254_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003683967.1|213930_214779_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003683968.1|214921_216085_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_021349602.1|216127_218449_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003683970.1|218648_219587_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_151130168.1|219579_220857_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003683972.1|220837_221821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683973.1|221823_222522_+	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	31.7	1.4e-19
WP_003683974.1|222737_223913_+	MFS transporter	NA	NA	NA	NA	NA
WP_003686431.1|223968_224811_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003686432.1|224911_226912_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	5.4e-88
>prophage 4
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	245840	278792	2267305	transposase,protease,tRNA	Lactobacillus_phage(18.18%)	25	NA	NA
WP_012390701.1|245840_246293_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_042513824.1|246371_247622_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.3	1.8e-57
WP_021349723.1|247807_248272_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003684020.1|248408_248966_+	LemA family protein	NA	NA	NA	NA	NA
WP_003686466.1|248976_249876_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_021349724.1|250050_251430_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_012390801.1|251600_253079_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	37.8	9.6e-66
WP_003684028.1|253082_253442_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_021349725.1|253444_254566_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.9	3.2e-29
WP_015638559.1|254577_254931_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9VCH5	Lactobacillus_phage	38.5	2.3e-10
WP_003686479.1|255063_255699_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003684038.1|255886_256447_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_021349726.1|256464_260007_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_012390804.1|260003_260276_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003686487.1|260364_260721_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003684046.1|260849_261356_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_012390805.1|261355_262705_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	24.4	3.1e-10
WP_003684053.1|262721_263270_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.1	8.0e-10
WP_151130170.1|263353_265519_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	48.8	5.6e-107
WP_151130171.1|265595_266477_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003684059.1|266565_267567_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_021349729.1|267582_269076_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	41.4	2.8e-89
WP_042513854.1|275199_276486_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_107504382.1|277190_277571_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	60.3	2.1e-41
WP_021349514.1|277604_278792_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.3	1.2e-37
>prophage 5
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	355859	403515	2267305	holin,transposase,tRNA	Streptococcus_phage(33.33%)	49	NA	NA
WP_012390844.1|355859_356591_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_021349227.1|356580_357180_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003682528.1|357148_358183_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.5	2.5e-60
WP_035428539.1|358544_358784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004563311.1|359156_359603_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_015638606.1|359678_360119_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021349229.1|360142_361102_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003682540.1|361130_361379_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_014562165.1|361378_362326_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_024500709.1|362309_363041_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	9.7e-19
WP_003682547.1|363053_364292_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024500710.1|364294_364741_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_086031841.1|364755_365178_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_151130181.1|365198_366596_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_004563305.1|366564_367413_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_003682558.1|367405_368179_+	AccA family protein	NA	NA	NA	NA	NA
WP_003682560.1|368196_368961_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_003682562.1|369012_369615_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_003682563.1|369614_370577_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_004563301.1|370690_372634_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.3	1.8e-59
WP_003682567.1|372800_373451_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003682569.1|373763_374045_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	43.0	2.6e-12
WP_003682571.1|374069_375701_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	1.1e-158
WP_024500711.1|375841_377680_+	APC family permease	NA	NA	NA	NA	NA
WP_024500712.1|377886_378153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021815699.1|378349_378988_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.0	6.0e-41
WP_024500713.1|379051_380368_+	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	42.9	7.2e-81
WP_070447046.1|380364_381039_+	ComF family protein	NA	NA	NA	NA	NA
WP_003682582.1|381174_381720_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003682585.1|381890_384260_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_100184032.1|384362_385436_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_003682588.1|385491_385821_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_003682589.1|385820_386174_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003682590.1|386188_387151_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_024500716.1|387143_387989_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003682592.1|387985_388999_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003682593.1|389061_389973_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.1	3.9e-70
WP_003682594.1|390496_391276_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_127429155.1|391291_392470_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_151130182.1|392494_393469_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_151130183.1|394092_395343_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.4e-57
WP_004563287.1|395567_395984_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_127429153.1|396552_397458_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	7.7e-34
WP_151130184.1|397626_398568_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.7	4.1e-78
WP_041812616.1|398580_399399_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_004563285.1|399419_400346_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	58.0	2.2e-100
WP_103205328.1|400396_400849_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	6.1e-32
WP_151130185.1|400888_402109_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	9.0e-94
WP_012391038.1|402264_403515_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
>prophage 6
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	431539	549835	2267305	transposase,integrase,protease,tRNA	Lactobacillus_phage(17.07%)	118	441797:441856	546013:546027
WP_021350004.1|431539_432619_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	40.6	6.3e-67
WP_151130187.1|432620_434912_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_151130492.1|434932_437467_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_035436491.1|437456_439586_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_151130188.1|439614_441402_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_003645712.1|441792_442329_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
441797:441856	attL	CTAAATTTAATTTAGAGTTACGAATTTCTATTGTGACACAATATTTAACGGGTATTAGTT	NA	NA	NA	NA
WP_107504374.1|442271_443213_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	1.8e-33
441797:441856	attL	CTAAATTTAATTTAGAGTTACGAATTTCTATTGTGACACAATATTTAACGGGTATTAGTT	NA	NA	NA	NA
WP_080965012.1|443230_443794_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	33.1	1.4e-09
WP_012390875.1|444619_445633_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003682636.1|445714_446920_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_003682638.1|447025_447793_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_012390876.1|447909_449232_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	70.3	2.0e-171
WP_003682642.1|449425_450820_+	amino acid permease	NA	NA	NA	NA	NA
WP_014562187.1|450908_452459_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003682647.1|452536_452761_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_070446864.1|452813_455207_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.1	6.5e-88
WP_003682651.1|455227_455701_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.8	4.0e-42
WP_050755175.1|455728_456313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004563264.1|456450_457140_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	45.6	2.3e-46
WP_003682658.1|457172_458147_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003682659.1|458155_458608_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003682660.1|458607_459123_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004563262.1|459252_459792_-	exonuclease	NA	M1PFD8	Streptococcus_phage	35.6	2.0e-21
WP_003682662.1|459919_460816_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_035423877.1|460830_461673_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_003682664.1|461662_462541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682665.1|462580_463939_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	26.9	3.6e-19
WP_102116091.1|464152_465973_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	35.5	3.4e-89
WP_004563258.1|466253_466565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130189.1|466574_468425_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.9	5.4e-26
WP_014562193.1|468446_469274_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021350141.1|469594_470209_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	48.5	1.2e-22
WP_003682672.1|470605_471634_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_012390889.1|471754_472660_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	41.2	7.5e-05
WP_021350140.1|472756_473719_-	class I mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_102116089.1|473805_474645_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	39.8	1.5e-47
WP_003682679.1|474807_475323_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_100184169.1|475556_476498_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_014562195.1|476972_477956_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_014562196.1|477975_478779_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003682688.1|478807_479728_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003682690.1|479728_480079_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_014562199.1|480695_481418_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	2.3e-36
WP_003682693.1|481417_482920_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.6	5.2e-35
WP_003682694.1|483122_483983_+	sugar transporter	NA	NA	NA	NA	NA
WP_151130190.1|484070_485048_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_014562705.1|485258_486446_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
485140:485201	attR	CTAAATTTAATTTAGAGTTACGAATTTCTATTGTGACACAATATTTAACGGGTATTAGTTCC	NA	NA	NA	NA
WP_151130493.1|486516_487038_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
485140:485201	attR	CTAAATTTAATTTAGAGTTACGAATTTCTATTGTGACACAATATTTAACGGGTATTAGTTCC	NA	NA	NA	NA
WP_107504375.1|486980_487922_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	1.0e-33
WP_042514038.1|488033_488489_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	2.4e-31
WP_048340477.1|488562_489813_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	1.8e-57
WP_003685822.1|490336_490900_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_151130191.1|490915_492580_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	37.8	8.6e-47
WP_042513939.1|492717_494070_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003682700.1|494076_494274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682701.1|494434_494917_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003682702.1|494934_495636_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003682703.1|495668_496517_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	32.2	4.1e-29
WP_003685830.1|496656_497433_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_023465639.1|497540_498248_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_151130192.1|498499_498829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031274141.1|499208_499859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130193.1|499999_501343_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003682713.1|501572_502034_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023465642.1|502026_503778_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	2.0e-41
WP_151130194.1|503752_505594_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.1	8.0e-54
WP_012390909.1|505688_506708_+	serine hydrolase	NA	NA	NA	NA	NA
WP_069776058.1|506707_508195_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003682722.1|508501_508807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682725.1|508818_509550_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003682727.1|509549_510887_-	Mur ligase family protein	NA	NA	NA	NA	NA
WP_012390912.1|511165_511756_+	thymidine kinase	NA	A0A060AH87	Cronobacter_phage	55.1	4.7e-48
WP_003682731.1|511755_512844_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	37.4	6.9e-05
WP_003682732.1|512836_513688_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_151130195.1|513706_514738_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.4	2.1e-51
WP_151130196.1|514861_516097_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.2	1.5e-96
WP_003682736.1|516236_516872_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003685862.1|517066_518185_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_003685864.1|518181_518955_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_012390919.1|519088_520357_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.5	3.5e-64
WP_003682740.1|520683_521394_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003682741.1|521422_521635_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_012390920.1|521680_522187_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003682743.1|522179_522725_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_003682744.1|522752_524291_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003685874.1|524322_525258_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_003682746.1|525280_526702_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_021350206.1|526713_527136_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_003682748.1|527371_527593_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_024500749.1|527602_528826_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003682753.1|528900_529917_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_021350209.1|529917_530160_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_003682755.1|530169_530394_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_003685881.1|530448_531651_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003685883.1|531662_531950_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_012390926.1|532157_533135_+	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_003682759.1|533204_534338_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_024500750.1|534756_535602_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015638694.1|535657_536137_-	universal stress protein	NA	NA	NA	NA	NA
WP_069776063.1|536215_536620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682766.1|536781_538074_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	51.3	5.0e-103
WP_003682767.1|538070_538544_-	YueI family protein	NA	NA	NA	NA	NA
WP_003682768.1|538633_539044_-	VOC family protein	NA	NA	NA	NA	NA
WP_003685897.1|539080_539827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003685899.1|540062_540908_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	27.9	3.7e-14
WP_101888719.1|541603_541786_+	hypothetical protein	NA	A0A1P8BMG7	Lactococcus_phage	47.4	1.9e-08
WP_003685903.1|542139_543261_-|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	45.3	5.4e-85
WP_151130197.1|543486_544407_-	hypothetical protein	NA	A1KWY5	Staphylococcus_virus	27.9	2.0e-29
WP_151130198.1|544440_544968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099032245.1|545043_545451_-	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	96.2	3.7e-68
WP_012391046.1|545454_545769_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	54.3	1.8e-22
WP_021815904.1|545949_546180_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151130199.1|546176_546962_+	Rha family transcriptional regulator	NA	E9LUL6	Lactobacillus_phage	66.9	2.1e-96
WP_151130200.1|547408_547618_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_151130201.1|547677_547998_+	hypothetical protein	NA	B8R678	Lactobacillus_phage	31.5	1.2e-05
WP_151130202.1|548342_548552_+	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	73.9	1.4e-23
WP_012391055.1|548607_549129_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	54.3	2.3e-30
WP_021349171.1|549142_549835_+	helix-turn-helix domain-containing protein	NA	Q8SDH3	Lactococcus_phage	41.9	3.3e-16
>prophage 7
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	554166	596934	2267305	terminase,transposase,head,portal,tail,capsid,tRNA	Lactobacillus_phage(70.0%)	35	NA	NA
WP_151130208.1|554166_554673_+	HNH endonuclease	NA	B8R694	Lactobacillus_phage	57.9	1.7e-43
WP_151130494.1|554875_555337_+|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	52.3	6.3e-40
WP_151130209.1|555333_557238_+|terminase	terminase large subunit	terminase	B8R649	Lactobacillus_phage	64.0	5.6e-244
WP_151130210.1|557252_557435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130211.1|557434_558655_+|portal	phage portal protein	portal	B8R650	Lactobacillus_phage	48.5	1.3e-95
WP_151130212.1|558587_560345_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	51.8	5.5e-137
WP_151130213.1|560365_560668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130214.1|560639_561008_+|head	phage head closure protein	head	B8R652	Lactobacillus_phage	44.1	7.5e-20
WP_151130215.1|560991_561438_+	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	49.0	1.9e-25
WP_151130216.1|561437_561809_+	DUF806 family protein	NA	NA	NA	NA	NA
WP_151130217.1|561820_562438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130218.1|562509_562839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130219.1|563043_567246_+	tape measure protein	NA	E9LUR1	Lactobacillus_phage	39.4	5.6e-26
WP_151130220.1|567309_568149_+|tail	phage tail family protein	tail	A0A1W6JQE9	Staphylococcus_phage	26.1	4.8e-14
WP_151130495.1|569145_570750_+	hypothetical protein	NA	E9LUJ4	Lactobacillus_phage	25.7	1.0e-36
WP_151130221.1|570736_574255_+	hypothetical protein	NA	E9LUJ5	Lactobacillus_phage	44.9	1.3e-57
WP_151130222.1|574461_574701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130223.1|574714_575185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130224.1|575184_575568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130225.1|575581_576070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130226.1|576227_576482_+	hypothetical protein	NA	D2KRC5	Lactobacillus_phage	49.4	1.5e-14
WP_151130227.1|576478_576913_+	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	41.7	1.1e-14
WP_151130228.1|576863_578027_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KJD2	Lactobacillus_phage	37.4	1.2e-39
WP_003682773.1|578217_578823_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_151130229.1|579152_580862_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_003685978.1|581042_582191_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	30.3	2.0e-31
WP_003682780.1|582203_583424_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_151130230.1|583630_584905_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003682784.1|586587_587730_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	2.2e-38
WP_080503624.1|588784_589240_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	68.8	3.9e-50
WP_151130231.1|590287_590743_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	1.6e-32
WP_151130232.1|590816_592067_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	2.4e-57
WP_014562233.1|592715_593327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350273.1|593478_593973_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_003682790.1|594279_596934_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.5	4.6e-159
>prophage 8
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	694882	756510	2267305	transposase,protease,tRNA	Hokovirus(11.76%)	60	NA	NA
WP_101888844.1|694882_696016_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_014562263.1|696553_698149_+	amidohydrolase	NA	NA	NA	NA	NA
WP_012391006.1|698256_699189_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_024500784.1|699397_700054_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003682106.1|700068_700758_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003686358.1|700758_703305_+	AAA family ATPase	NA	A0A1P8DII4	Virus_Rctr197k	29.1	2.4e-32
WP_003686361.1|703375_704362_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	33.9	8.1e-37
WP_003686362.1|704394_704823_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_003682102.1|705062_706037_-	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_003682101.1|706296_706512_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_003682098.1|706638_707085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682096.1|707195_707765_-	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	41.3	4.4e-11
WP_003682094.1|707892_708180_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_024500786.1|708183_708948_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_003682090.1|709025_710873_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_101888845.1|710975_712175_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_003686372.1|712161_712458_+	YlbG family protein	NA	NA	NA	NA	NA
WP_003682085.1|712460_713021_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003686377.1|713025_713547_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.0	1.1e-24
WP_012391013.1|713530_714580_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_035430806.1|714646_715321_+	competence protein	NA	NA	NA	NA	NA
WP_003682078.1|715375_715855_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	56.7	4.1e-34
WP_151130241.1|715855_718093_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.0	1.6e-27
WP_003682073.1|718110_719139_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_003682071.1|719377_719632_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003682069.1|719877_720147_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_015638746.1|720694_722494_+	ribonuclease J	NA	NA	NA	NA	NA
WP_151130242.1|722584_723481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349940.1|723661_724852_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.0	1.1e-32
WP_003682058.1|725022_726330_+	trigger factor	NA	NA	NA	NA	NA
WP_003682055.1|726480_727731_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.1	3.7e-135
WP_012391020.1|727744_728338_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003682052.1|728337_728637_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.5	6.9e-24
WP_014562275.1|729237_729984_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	9.5e-30
WP_003682047.1|730261_732073_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003682046.1|732137_733445_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003682045.1|733471_734404_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_003682044.1|734424_735264_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012391024.1|735336_737634_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	2.6e-70
WP_003682042.1|737647_738175_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	2.3e-30
WP_151130243.1|738506_738890_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003682040.1|738964_739963_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	36.3	7.7e-51
WP_151130244.1|740464_741274_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_151130245.1|741621_742065_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151130246.1|742039_743002_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003682034.1|743117_743654_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_151130247.1|743960_745181_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.8e-95
WP_003682030.1|745284_745614_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_151130248.1|745841_746774_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	1.5e-27
WP_151130249.1|746891_748415_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	27.7	6.1e-07
WP_003686704.1|748482_748839_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003686706.1|748828_749023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682029.1|749319_749628_-	membrane protein	NA	NA	NA	NA	NA
WP_035433292.1|750329_750677_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.9	1.0e-10
WP_151130250.1|750828_751920_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_151130496.1|752178_752358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101888949.1|752720_753581_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_101888948.1|754498_754864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012391034.1|755121_755490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130251.1|755625_756510_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	768205	813508	2267305	integrase,transposase,protease,tRNA	Lactobacillus_phage(26.67%)	45	769680:769739	778820:779863
WP_003682001.1|768205_768652_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	36.7	2.4e-20
WP_004563379.1|768769_769390_+	hypothetical protein	NA	NA	NA	NA	NA
769680:769739	attL	ACCTGAAATGTCAATTTAAGTTAGAAAAAAGTTGTCGTTGATCCTCTGTGATATGTTCCA	NA	NA	NA	NA
WP_021353998.1|769689_770667_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_151130254.1|770724_771798_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	53.4	3.5e-102
WP_151130497.1|771904_772441_-	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	71.9	1.1e-56
WP_151130255.1|772635_773553_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	J7KDP1	Streptococcus_phage	26.9	2.0e-13
WP_151130256.1|773645_774380_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	47.6	5.9e-32
WP_049183325.1|774376_774658_-	hypothetical protein	NA	D2KRD5	Lactobacillus_phage	72.7	2.9e-32
WP_151130257.1|774687_775332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055307866.1|775420_776107_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.7	9.3e-64
WP_012391429.1|776551_777772_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_151130258.1|777864_778578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021353998.1|778829_779807_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_128484817.1|780061_780325_+	aldo/keto reductase	NA	NA	NA	NA	NA
778820:779863	attR	ACCTGAAATGTCAATTTAAGTTAGAAAAAAGTTGTCGTTGATCCTCTGTGATATGTTCCATAAATACCTCATAAGGTGTCCGATAGTCTAGTGACTTTCTTGGAATTCGATTCCGCTTACTCATGAGCTGGTTCACTAACTCATCTGGAAGGTTACGTAAGTCACGATCCTTGGTCAAACCGTCGCGACGAAGAAGGCCATTGTTGTTCTCGTTGAGCCCCCGTTGATTTGGGGCACCAACCTCGGCGAAGTAGGTGTGGATGTCAAATTGGTTGGCAATCTCCCGCCACCCAGCGAACTCCTTCCCGTTGTCAAAGGTGATCGACTTGAAAAAGTGGCGCGGAAACTTACTTAACCATTCACTTAGGTGGCGGTTGATATTCTCAGTCTTCTTAGCGTGAACGTTTAGGACAATTTCGACCTTAGATAAGTGCTCAACTAAGGTCATAACCGCCCCTTGATGGTGCTTACCTTGAACGGTATCACCTTCGAGATGGCCAAACTCCTTAGTGTAGTTGGGAAAATCTTCATAGCGCTCGTAGATACTCCGACCTAATTGACCAGCCTTTCCACGATGTTCCACATAGCCATTAGGGTGACGATTACCGTGCATTGGTAAATCCTTAGCGTCAAAGCCAAACTGACCCCGTTTAAACATCCGGTAAAGAGTCCGTCGATTACAACTAATCGATCGGTCGCCACGCCCAATGATGGTGTCAGGTGTCCAACCTTGTGCAACCATCTCATTGATGTAGACAACCTCATCCTGCGGTAATTGGGCTAGCTTACGACCACAACGCTTCTTATTGCTTATGTACTGTTGTTGGTAATCGACAATCGTTGCCCCGGTCTTCAGATAGCGATAGACACGGTAGATCGTCTCAACACTACGCTTAAGCATTTGCGCCACCTTGTAGGCTTTCGTCCCCTGAGTGAAGAAATTTACGATTGTAGTGAGTTCAGCTGTGGTAAGATGAGAGTAGGTCATTTGTGGTGTCCTTTCTTTTGTCTAGAGGTATTCAAAAGTTTACCACAAATGGCTTT	NA	NA	NA	NA
WP_151130259.1|780594_781299_+	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	42.5	5.3e-38
WP_151130260.1|781349_781802_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_012391060.1|781902_782487_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.9	8.2e-21
WP_021815920.1|783866_784376_+	membrane protein	NA	NA	NA	NA	NA
WP_014562466.1|785141_786140_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_151130261.1|786230_787517_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_012391429.1|788441_789662_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
WP_151130262.1|789813_790071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667032.1|790295_790976_+	serine dehydratase	NA	NA	NA	NA	NA
WP_128492571.1|790976_791864_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_151130263.1|791860_792175_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_151130264.1|792647_793049_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_151130265.1|793055_794825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130266.1|796009_797008_+	mucin-binding protein	NA	NA	NA	NA	NA
WP_003685243.1|797375_798110_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_151130267.1|798102_799620_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_021349108.1|800679_801849_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003685235.1|802318_802945_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	52.9	6.6e-16
WP_012391088.1|803100_803352_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003685231.1|803428_803656_+	YneF family protein	NA	NA	NA	NA	NA
WP_003685229.1|803723_804356_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_035436535.1|804451_805204_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003681959.1|805196_805487_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003681957.1|805640_806420_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003681955.1|806510_807389_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_151130268.1|807469_808195_+	UMP kinase	NA	NA	NA	NA	NA
WP_024500830.1|808191_808755_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003681952.1|808881_809655_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	34.6	1.1e-17
WP_003681950.1|809671_810460_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_035436539.1|810481_811753_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_015638806.1|811786_813508_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	25.9	1.8e-07
>prophage 10
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	831994	890958	2267305	transposase,tRNA	Streptococcus_phage(21.05%)	50	NA	NA
WP_021349103.1|831994_832891_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003681923.1|832901_833867_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_035436554.1|833981_835370_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_080965014.1|835488_836187_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.3	1.5e-21
WP_080964987.1|836123_837032_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	3.2e-11
WP_070446813.1|837419_838757_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_151130269.1|838765_840460_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003681913.1|840615_841602_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_080650633.1|842537_843047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350236.1|843027_843345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562320.1|843497_844670_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003685173.1|846337_847303_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_021349142.1|847693_848014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003685171.1|849661_850015_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_021349145.1|850027_850609_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_050755181.1|850802_851423_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_151130270.1|851410_852295_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_127429593.1|852305_853064_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_086031844.1|853191_853311_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035436004.1|853373_855641_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.7	1.1e-124
WP_048340506.1|855695_856628_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.1e-27
WP_042513835.1|856831_858190_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_151130271.1|858318_859254_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_046949115.1|859293_860319_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
WP_003681906.1|861326_861692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681905.1|861817_862864_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_151130272.1|862874_863462_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_014562323.1|863499_865356_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	45.4	9.3e-135
WP_003681899.1|865467_866628_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.0	4.8e-20
WP_127429439.1|866759_867692_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	8.5e-28
WP_021349426.1|869435_869753_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_003681874.1|869754_870075_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_021349425.1|870087_871173_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.5	2.9e-11
WP_003685127.1|871240_873073_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	2.5e-23
WP_003681865.1|873585_874089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151130273.1|874124_874748_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_021349421.1|874842_875862_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015638841.1|876121_877195_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.2	5.3e-90
WP_021349420.1|877206_878382_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	41.2	1.1e-88
WP_003681857.1|878521_880273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349418.1|880310_880766_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_021349417.1|880926_881397_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.9	6.8e-26
WP_003681853.1|882569_883178_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.1	4.7e-27
WP_021349415.1|883177_884236_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.5	1.3e-40
WP_021349414.1|884645_885131_-	flavodoxin	NA	NA	NA	NA	NA
WP_035436973.1|885191_886226_-	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	26.0	7.0e-07
WP_021349411.1|886218_886770_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024500857.1|887713_888886_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_041812577.1|889176_889629_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.1e-32
WP_048340507.1|889707_890958_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	36.8	7.6e-56
>prophage 11
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	959837	1018106	2267305	integrase,transposase,tRNA	Lactobacillus_phage(12.5%)	59	985797:985814	1019707:1019724
WP_042513964.1|959837_960680_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	9.7e-156
WP_002816285.1|960733_960985_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_151130280.1|961280_961841_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003681705.1|961852_962038_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_015638904.1|962065_962608_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003681701.1|962622_962874_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003681696.1|962885_963026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111523129.1|963243_964242_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_014562363.1|964435_965722_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003683258.1|965954_966866_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_151130281.1|967068_968076_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_015638909.1|968088_969447_-	aspartate kinase	NA	NA	NA	NA	NA
WP_151130282.1|969918_971238_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003683238.1|971262_971976_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_015638911.1|971975_973130_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003683233.1|973132_974068_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_024500891.1|974060_974840_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_024500892.1|974864_976049_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014562366.1|976063_977116_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024500893.1|977251_978592_+	ATPase	NA	NA	NA	NA	NA
WP_003683222.1|978584_979259_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_101888795.1|979267_979969_+|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_101888796.1|979961_980783_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_015638918.1|980802_982044_+	peptidase T	NA	NA	NA	NA	NA
WP_003683213.1|982115_982343_-	DUF2929 family protein	NA	NA	NA	NA	NA
WP_151130283.1|982433_985733_+	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	32.1	5.7e-143
985797:985814	attL	AAAAGGTGCTATGATAGG	NA	NA	NA	NA
WP_101888798.1|985870_987292_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_003683209.1|987447_988335_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_101888799.1|988327_989206_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K830	Mycobacterium_phage	29.8	2.2e-09
WP_003684947.1|989186_989570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683203.1|989562_990351_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.5	1.2e-11
WP_003683201.1|990328_990916_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.7	7.5e-14
WP_003684943.1|990916_991642_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_151130284.1|991913_992492_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_031265319.1|992692_993757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683188.1|993746_995204_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.7	6.8e-56
WP_003683187.1|995264_995819_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003683185.1|995842_996523_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_049183029.1|996599_997832_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_024500900.1|997909_999223_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003683180.1|999446_999722_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.4e-25
WP_003684932.1|999800_1001063_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_151130285.1|1001176_1002034_-	recombinase XerD	NA	NA	NA	NA	NA
WP_046947983.1|1002199_1003402_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.6	5.8e-45
WP_049183036.1|1003414_1005301_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.8	2.2e-51
WP_003683168.1|1005366_1006326_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	63.4	9.1e-118
WP_003683166.1|1006337_1006841_+	dihydrofolate reductase	NA	A0A223LJP4	Erwinia_phage	37.8	5.6e-18
WP_003684928.1|1006820_1007450_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_049183039.1|1007616_1008459_+	DegV family protein	NA	NA	NA	NA	NA
WP_151130286.1|1008592_1009771_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	36.8	1.1e-61
WP_012391200.1|1009840_1010467_+	chloramphenicol acetyltransferase	NA	NA	NA	NA	NA
WP_049183046.1|1010597_1011515_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003683157.1|1011518_1012112_+	YpmS family protein	NA	NA	NA	NA	NA
WP_003683156.1|1012121_1012346_+	YozE family protein	NA	NA	NA	NA	NA
WP_014562383.1|1012356_1013229_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_012391201.1|1013221_1013992_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	35.2	1.1e-20
WP_023466138.1|1014044_1014920_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_101888806.1|1015002_1017135_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.0	7.5e-96
WP_100184083.1|1017209_1018106_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1019707:1019724	attR	CCTATCATAGCACCTTTT	NA	NA	NA	NA
>prophage 13
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	1208862	1327582	2267305	transposase	Streptococcus_phage(20.0%)	114	NA	NA
WP_151130319.1|1208862_1210113_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	36.8	1.5e-56
WP_151130320.1|1210186_1210642_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	47.8	8.9e-31
WP_041812814.1|1210692_1211382_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_004563123.1|1211374_1211953_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_003683514.1|1211945_1213505_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.2	9.3e-19
WP_151130499.1|1213494_1217157_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_151130321.1|1217298_1218318_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_151130322.1|1218339_1218837_+	molybdenum cofactor biosynthesis protein MoaB	NA	NA	NA	NA	NA
WP_151130323.1|1218826_1220041_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_118033637.1|1220019_1221009_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_070955631.1|1221005_1221551_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_003683499.1|1221550_1221814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683497.1|1221880_1222315_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_035431078.1|1222337_1223390_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_151130324.1|1223391_1224045_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004563142.1|1224184_1224448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130325.1|1224457_1225441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130326.1|1225437_1226355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683487.1|1226455_1226689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683485.1|1226907_1227624_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_004563145.1|1227712_1228600_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003683482.1|1228614_1228953_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_070955636.1|1228967_1230164_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_004563147.1|1230169_1231168_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_003683474.1|1231177_1231423_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003683472.1|1231422_1231824_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_080637843.1|1232163_1232577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683465.1|1232563_1233562_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_035436323.1|1233558_1234329_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	5.6e-17
WP_014562464.1|1234595_1235819_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003683457.1|1236075_1236393_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003683456.1|1236395_1236629_+	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
WP_014562465.1|1236618_1237950_+	DUF438 domain-containing protein	NA	NA	NA	NA	NA
WP_003683453.1|1238021_1238861_+	DMT family transporter	NA	NA	NA	NA	NA
WP_151130327.1|1238915_1239914_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	2.2e-50
WP_003683451.1|1240080_1241145_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014562468.1|1241306_1242713_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_012391345.1|1242699_1243170_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_003683448.1|1243156_1244395_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.9	1.4e-107
WP_151130328.1|1244378_1245674_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003683444.1|1245685_1246483_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.5	2.0e-09
WP_003683442.1|1246717_1246927_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_046025942.1|1246923_1248915_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_003683438.1|1248928_1249099_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_151130329.1|1249166_1250066_-	prenyltransferase	NA	NA	NA	NA	NA
WP_151130330.1|1250147_1251134_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_151130331.1|1251174_1252158_-	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	33.9	3.5e-40
WP_004563166.1|1252159_1253320_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003683428.1|1253500_1254022_-	shikimate kinase	NA	NA	NA	NA	NA
WP_003683426.1|1254018_1255104_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_004563168.1|1255104_1256403_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_151130332.1|1256377_1256923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004563169.1|1256924_1258091_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	33.4	3.1e-35
WP_003683419.1|1258084_1258354_-	chorismate mutase	NA	NA	NA	NA	NA
WP_049182723.1|1261539_1262715_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	2.3e-115
WP_014081459.1|1262714_1263113_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_151130333.1|1263738_1264554_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_151130334.1|1265655_1266270_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151130335.1|1266206_1267112_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_151130336.1|1267229_1268084_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_151130500.1|1268416_1269799_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_151130337.1|1269865_1270102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683396.1|1270286_1273187_-	YfhO family protein	NA	NA	NA	NA	NA
WP_021349324.1|1273590_1273917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151130338.1|1274045_1275296_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	3.4e-56
WP_042513934.1|1275369_1275825_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	1.8e-31
WP_004563179.1|1276085_1278095_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-66
WP_023465880.1|1278313_1278760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004563180.1|1278756_1280268_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003683382.1|1280335_1280560_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_021350278.1|1280585_1282457_-	potassium transporter	NA	NA	NA	NA	NA
WP_014562483.1|1282565_1283978_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003683378.1|1283998_1284898_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003683376.1|1284890_1286201_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003683374.1|1286369_1286639_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003683372.1|1286741_1287605_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_048340519.1|1287861_1289253_+	MFS transporter	NA	NA	NA	NA	NA
WP_024500988.1|1289268_1290510_+	MFS transporter	NA	NA	NA	NA	NA
WP_014562486.1|1290674_1292063_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_021350281.1|1292249_1293476_+	MFS transporter	NA	NA	NA	NA	NA
WP_012391371.1|1293682_1293895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102116103.1|1293867_1294176_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_004563191.1|1294224_1294383_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021350285.1|1294510_1295632_-	lipolytic enzyme	NA	NA	NA	NA	NA
WP_021350286.1|1295686_1296706_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_003683354.1|1296734_1298141_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.8	7.3e-47
WP_021350287.1|1298147_1299482_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_014562491.1|1299497_1300475_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_014562492.1|1300477_1301569_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003683348.1|1302521_1302848_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
WP_035431068.1|1303551_1305060_-	threonine synthase	NA	NA	NA	NA	NA
WP_151130339.1|1305174_1306452_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003683341.1|1306461_1307322_+	homoserine kinase	NA	NA	NA	NA	NA
WP_004563200.1|1307553_1308078_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021350288.1|1308178_1308820_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_024500994.1|1308942_1309599_+	HD domain-containing protein	NA	A0A1S5V2G8	Saudi_moumouvirus	27.9	2.9e-06
WP_021350289.1|1309595_1310339_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_024500995.1|1310606_1311218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004563204.1|1311214_1312093_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	38.2	1.2e-15
WP_021350292.1|1312283_1313990_+	fibronectin/fibrinogen-binding protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	36.2	2.5e-09
WP_003684310.1|1314144_1315395_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_151130340.1|1315689_1316847_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.3e-37
WP_003617037.1|1316991_1317627_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_012391391.1|1317819_1320324_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_015639171.1|1320325_1321408_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_054173511.1|1321437_1322313_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003683312.1|1322353_1322791_-	signal peptidase II	NA	NA	NA	NA	NA
WP_003683310.1|1322790_1323225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683308.1|1323237_1323639_+	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_151130341.1|1323794_1324397_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_151130342.1|1324620_1325484_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004563212.1|1325698_1326388_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_080650635.1|1326474_1327173_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003688751.1|1327294_1327582_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	1346566	1408356	2267305	transposase,tRNA	Paenibacillus_phage(33.33%)	43	NA	NA
WP_014562511.1|1346566_1347862_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.2	9.6e-54
WP_004563226.1|1347888_1348407_-	peptidase	NA	NA	NA	NA	NA
WP_151130344.1|1348457_1351298_-	ATP-dependent DNA helicase	NA	A0A1X9I5C8	Streptococcus_phage	34.4	1.4e-60
WP_003683265.1|1351527_1352463_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_004563229.1|1352464_1353454_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_003683263.1|1353473_1354583_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_003683262.1|1354638_1355724_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_151130345.1|1355880_1356639_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.3	1.2e-11
WP_151130346.1|1356834_1358085_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.1e-57
WP_151130501.1|1358656_1360030_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_151130347.1|1360158_1360965_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_086031786.1|1361186_1361684_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151130348.1|1362637_1363480_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	1.6e-41
WP_086031788.1|1363540_1363828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_086031789.1|1364046_1364661_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.5	4.0e-26
WP_086031790.1|1365459_1365909_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	34.1	4.1e-12
WP_086031791.1|1365871_1366813_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	1.7e-12
WP_035435979.1|1366895_1368002_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003606447.1|1369374_1369623_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_021349514.1|1369954_1371142_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.3	1.2e-37
WP_086031793.1|1375525_1375753_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035437581.1|1375929_1377702_-	oleate hydratase	NA	NA	NA	NA	NA
WP_035437582.1|1378189_1379521_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035437584.1|1380199_1381939_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_151130349.1|1384315_1385503_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	5.7e-37
WP_035437501.1|1385732_1386650_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_024501023.1|1389821_1390904_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.6	1.9e-55
WP_024501024.1|1390905_1392195_-	dihydroorotase	NA	NA	NA	NA	NA
WP_151130350.1|1392194_1393160_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	29.9	5.9e-24
WP_151130351.1|1393496_1393949_-	DUF1445 domain-containing protein	NA	NA	NA	NA	NA
WP_151130352.1|1393884_1394073_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_151130353.1|1394246_1394441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100184562.1|1396178_1397057_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_015639203.1|1397060_1397999_-	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_015639204.1|1397995_1398652_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_035436299.1|1398664_1399372_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_100184559.1|1399352_1400450_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_151130354.1|1400461_1401046_-	CRISPR-associated protein CasB	NA	NA	NA	NA	NA
WP_151130502.1|1401062_1402727_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_151130355.1|1402707_1405449_-	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
WP_003683897.1|1405679_1406039_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003683895.1|1406159_1407587_-	amino acid permease	NA	NA	NA	NA	NA
WP_003683893.1|1407597_1408356_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	1416861	1468694	2267305	transposase,protease,tRNA	Indivirus(11.11%)	52	NA	NA
WP_151130334.1|1416861_1417476_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151130335.1|1417412_1418318_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_021353998.1|1419058_1420036_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_151130359.1|1420993_1422424_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003683867.1|1422610_1422952_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_151130360.1|1422968_1424498_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_151130361.1|1424513_1428077_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_117940160.1|1428090_1428789_-	ribonuclease III	NA	A0A1V0SDK0	Indivirus	34.5	2.2e-20
WP_003683858.1|1428935_1429181_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_012391443.1|1429223_1430261_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_035436233.1|1430273_1432310_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_014562530.1|1432374_1434069_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_003683850.1|1434096_1434459_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003686278.1|1434605_1434794_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_021349888.1|1434914_1435574_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_003686276.1|1435641_1436295_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_014562531.1|1436306_1437197_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_021349887.1|1437216_1439139_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	G9BWE0	Planktothrix_phage	29.6	9.4e-21
WP_003683838.1|1439142_1439880_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_151130362.1|1439898_1441245_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003683834.1|1441237_1442188_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.7	1.5e-11
WP_151130363.1|1442210_1444628_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_151130364.1|1444603_1445830_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	37.5	1.2e-48
WP_003683829.1|1445900_1446185_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003683827.1|1446181_1446802_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.9	2.2e-11
WP_014562535.1|1446994_1447312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130365.1|1447445_1448609_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.4	1.2e-159
WP_015638546.1|1448605_1449043_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	71.7	6.3e-50
WP_003686264.1|1449222_1450917_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_151130366.1|1450934_1451384_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151130367.1|1451397_1452213_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003683815.1|1452222_1453098_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003683813.1|1453097_1453391_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003683812.1|1453390_1454839_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.7	2.8e-33
WP_014562538.1|1454839_1455697_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.9	1.9e-37
WP_021349943.1|1455874_1456294_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_003683803.1|1456293_1456734_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_041812857.1|1456824_1457901_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003683800.1|1457986_1458268_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003683798.1|1458291_1458615_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003683797.1|1458627_1458936_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_012391458.1|1459099_1459741_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003683795.1|1460492_1461026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035423990.1|1461018_1461987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003686245.1|1461979_1462873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003686242.1|1463442_1464795_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_021349189.1|1464993_1465917_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_024271716.1|1466015_1466192_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_003686239.1|1466371_1466791_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003686237.1|1466815_1467778_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_003683770.1|1467795_1468032_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_021349191.1|1468028_1468694_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 16
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	1507960	1558344	2267305	transposase,protease,tRNA	Staphylococcus_phage(28.57%)	47	NA	NA
WP_003683688.1|1507960_1508608_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_151130370.1|1508625_1509810_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_151130371.1|1509802_1510528_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	4.2e-22
WP_003683684.1|1510676_1511105_+	HIT family protein	NA	NA	NA	NA	NA
WP_003683683.1|1511106_1511340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130372.1|1511418_1512411_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_151130373.1|1512502_1513459_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_151130374.1|1513610_1513973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151130375.1|1514031_1516152_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_003683673.1|1516765_1518454_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.0	9.0e-68
WP_003683671.1|1518872_1519232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683669.1|1519230_1519713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562558.1|1519713_1520847_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	23.8	2.8e-09
WP_012391488.1|1520830_1521421_-	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_015639259.1|1521401_1522682_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003683662.1|1522678_1523251_-	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	43.4	1.5e-35
WP_003686165.1|1523232_1523751_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_021349083.1|1523740_1524112_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_012391490.1|1524327_1525011_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003686160.1|1525029_1526037_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024501065.1|1526110_1526719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683652.1|1526848_1527481_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.8	8.6e-48
WP_151130376.1|1527580_1528699_-	glycoside hydrolase family 73 protein	NA	A0A0K2CP65	Brevibacillus_phage	43.8	3.5e-20
WP_151130377.1|1530360_1531359_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	2.9e-50
WP_003683646.1|1531425_1531926_-	universal stress protein	NA	NA	NA	NA	NA
WP_048340313.1|1532005_1533406_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_151130378.1|1533513_1534389_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003686149.1|1534382_1534760_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_015639265.1|1534804_1536451_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003683636.1|1536563_1536827_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_003683635.1|1537269_1539687_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	67.1	0.0e+00
WP_041807828.1|1540024_1540756_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_101889105.1|1541014_1542256_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	54.8	5.5e-107
WP_151130379.1|1542258_1543056_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.7	6.1e-43
WP_003686137.1|1544903_1546091_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.9	2.7e-143
WP_101889106.1|1546284_1547016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003686135.1|1547109_1547646_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_101889107.1|1547684_1549118_-	MFS transporter	NA	NA	NA	NA	NA
WP_003683620.1|1549239_1549695_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_151130380.1|1549913_1551281_-	amino acid permease	NA	NA	NA	NA	NA
WP_151130381.1|1551620_1552238_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_012391505.1|1552340_1552583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012391506.1|1552605_1552857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123799250.1|1553350_1554601_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	1.8e-57
WP_151130382.1|1554674_1555130_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	1.1e-31
WP_048340502.1|1555333_1556620_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_151130248.1|1557411_1558344_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	1.5e-27
>prophage 17
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	1572923	1708861	2267305	transposase,protease,tRNA	Streptococcus_phage(16.67%)	114	NA	NA
WP_042513914.1|1572923_1574210_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003684211.1|1580824_1581073_-	DUF1797 family protein	NA	NA	NA	NA	NA
WP_004563064.1|1581406_1582426_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003684207.1|1582427_1583453_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_035431252.1|1583445_1584663_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_070955734.1|1584878_1586609_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_004563061.1|1586610_1586877_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_051132377.1|1587006_1587249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350169.1|1587422_1589669_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	1.7e-122
WP_012391521.1|1589921_1590629_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003684192.1|1590755_1591331_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_012391523.1|1591323_1592751_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.7	2.3e-96
WP_003684189.1|1593037_1593631_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003684188.1|1593786_1594506_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_046948708.1|1594516_1595305_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.1	9.7e-25
WP_035437156.1|1595294_1596179_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004563053.1|1596260_1597502_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_004563052.1|1598143_1598842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024501090.1|1598854_1599715_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.3e-17
WP_024501091.1|1599701_1600079_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151130384.1|1600188_1601121_-	dTDP-glucose 4,6-dehydratase	NA	M1I5F1	Acanthocystis_turfacea_Chlorella_virus	40.2	1.8e-57
WP_151130503.1|1601147_1602893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049183101.1|1602983_1604681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049183103.1|1604715_1605681_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	36.1	7.4e-51
WP_031274336.1|1605776_1606685_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_100184896.1|1606702_1607734_-	sugar transferase	NA	NA	NA	NA	NA
WP_014562579.1|1607772_1609353_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	27.3	2.0e-32
WP_049183109.1|1609571_1610549_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	34.8	1.3e-47
WP_151130385.1|1610637_1611747_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_111523419.1|1611746_1612679_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	49.4	1.9e-75
WP_080558617.1|1612768_1613332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102116105.1|1613474_1614950_-	hypothetical protein	NA	A0A1J0GW44	Streptomyces_phage	43.0	3.3e-10
WP_080983497.1|1615183_1616890_-	hypothetical protein	NA	A0A0A7RUS8	Clostridium_phage	43.5	1.1e-25
WP_127429449.1|1617243_1618401_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	3.3e-37
WP_111523422.1|1618753_1620181_-	flippase	NA	NA	NA	NA	NA
WP_100184702.1|1620183_1621305_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	77.8	7.5e-172
WP_151130386.1|1621531_1622719_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	1.3e-36
WP_080983522.1|1622879_1624031_-	acyltransferase	NA	NA	NA	NA	NA
WP_004563039.1|1624089_1624707_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
WP_004563038.1|1624681_1625905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639329.1|1625915_1626677_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_012391551.1|1626688_1627363_-	sugar transferase	NA	NA	NA	NA	NA
WP_003684129.1|1627511_1628330_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003684128.1|1628423_1628630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003684127.1|1628665_1628881_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_014562591.1|1629061_1629958_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003684379.1|1630879_1631905_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.6	1.7e-45
WP_021349826.1|1634277_1635135_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004563031.1|1635247_1635694_+	flavodoxin	NA	NA	NA	NA	NA
WP_024501110.1|1635703_1636138_+	GtrA family protein	NA	NA	NA	NA	NA
WP_004563029.1|1636792_1638121_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.1	1.8e-34
WP_024501111.1|1638124_1639135_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003684113.1|1639299_1639665_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003684112.1|1639806_1640376_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_024501112.1|1640376_1641279_-	L-2-hydroxyisocaproate dehydrogenase	NA	NA	NA	NA	NA
WP_048339856.1|1641443_1642952_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_024501114.1|1643066_1643846_-	flavoprotein	NA	NA	NA	NA	NA
WP_003684108.1|1643988_1644342_+	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_014081459.1|1644918_1645317_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_021353998.1|1645963_1646941_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_151130387.1|1647837_1649463_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.3	1.7e-44
WP_023465808.1|1649610_1650078_-	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	31.5	7.1e-15
WP_118033533.1|1650158_1650719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003684096.1|1651191_1652451_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003684094.1|1652673_1653222_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151130388.1|1654226_1654595_+	MFS transporter	NA	NA	NA	NA	NA
WP_021349817.1|1654626_1655145_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	46.2	2.1e-31
WP_021816428.1|1655235_1655829_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_035437185.1|1655845_1656067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130389.1|1656103_1656793_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	41.6	9.1e-35
WP_012391566.1|1656955_1657528_-	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_075667505.1|1657530_1657974_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_151130390.1|1658115_1659654_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003684080.1|1659717_1660224_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_021350113.1|1660299_1661082_+	dimethylargininase	NA	NA	NA	NA	NA
WP_151130391.1|1661469_1662867_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_021815645.1|1663254_1663869_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	38.0	9.6e-28
WP_003688751.1|1664307_1664595_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_127429192.1|1664618_1665497_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_003686706.1|1665658_1665853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003686704.1|1665842_1666199_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_016370900.1|1666266_1667790_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	27.7	6.1e-07
WP_003686706.1|1667867_1668062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003686704.1|1668051_1668408_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_016370900.1|1668475_1669999_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	27.7	6.1e-07
WP_151130248.1|1670116_1671049_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	1.5e-27
WP_151130392.1|1671298_1677892_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_023465987.1|1680031_1681153_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_023465988.1|1681562_1681826_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003684069.1|1681822_1682077_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003684065.1|1682462_1683833_-	NAD(FAD)-dependent dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	1.1e-10
WP_151130393.1|1683960_1685148_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	9.8e-37
WP_003688751.1|1685940_1686228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012391547.1|1686251_1687130_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.6e-42
WP_050755181.1|1688147_1688768_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_107760586.1|1688755_1689640_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003681672.1|1689716_1690367_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681670.1|1690391_1690673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681668.1|1690724_1690952_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_151130394.1|1690974_1692903_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	2.9e-94
WP_151130395.1|1693051_1693612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151130396.1|1693769_1694693_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.4	9.6e-32
WP_015639373.1|1696138_1696642_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151130248.1|1697327_1698260_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	1.5e-27
WP_151130249.1|1698377_1699901_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	27.7	6.1e-07
WP_003686704.1|1699968_1700325_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003686706.1|1700314_1700509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151130397.1|1700747_1701968_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.1e-94
WP_151130398.1|1702084_1702942_-	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_151130399.1|1703124_1704504_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	51.7	3.3e-129
WP_070955761.1|1704612_1705626_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_070955762.1|1705638_1707063_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_070955763.1|1707077_1708541_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_070955764.1|1708540_1708861_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	1836617	1855933	2267305	transposase	unidentified_phage(42.86%)	19	NA	NA
WP_151130421.1|1836617_1837541_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.2e-31
WP_101888874.1|1837891_1839373_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_101888873.1|1839359_1839770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054173631.1|1839780_1840236_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_101888872.1|1840256_1841618_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_054173629.1|1841649_1841937_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_101888871.1|1842919_1843534_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.5	1.1e-26
WP_003688751.1|1843722_1844010_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041812692.1|1844033_1844912_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_046949115.1|1845022_1846048_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
WP_054173626.1|1846182_1847322_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	30.2	1.7e-30
WP_127429439.1|1847784_1848717_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	8.5e-28
WP_151130422.1|1848633_1850127_-	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_101889058.1|1850215_1850761_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101889059.1|1850901_1852350_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_101889060.1|1853071_1853311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101889061.1|1853635_1854364_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_024271805.1|1854466_1854700_+	cytochrome b5	NA	NA	NA	NA	NA
WP_119171375.1|1854991_1855933_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	8.0e-34
>prophage 20
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	1871178	1941941	2267305	integrase,transposase	Paenibacillus_phage(15.79%)	52	1908035:1908065	1954183:1954213
WP_151130231.1|1871178_1871634_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	1.6e-32
WP_012391038.1|1871707_1872958_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_151130427.1|1873688_1875020_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.1	4.1e-23
WP_003681362.1|1875173_1875488_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	39.6	1.4e-14
WP_012390701.1|1877866_1878319_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_003681357.1|1878507_1878756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003684331.1|1879050_1880214_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
WP_151130428.1|1880674_1881862_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	9.8e-37
WP_050755181.1|1882137_1882758_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	37.9	7.4e-28
WP_021349406.1|1883385_1884606_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_151130429.1|1885171_1885970_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_045353779.1|1886332_1887520_+	MFS transporter	NA	NA	NA	NA	NA
WP_100184397.1|1887516_1888356_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_151130430.1|1888659_1889898_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	24.8	9.0e-09
WP_100184398.1|1890066_1890345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101889220.1|1890378_1891178_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_151130431.1|1891152_1891350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151130432.1|1891369_1892368_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	6.5e-50
WP_151130433.1|1892643_1893996_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.1	2.0e-17
WP_003681354.1|1893976_1895431_-	amino acid permease	NA	NA	NA	NA	NA
WP_015639481.1|1896348_1897179_-	YbgC/FadM family acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_151130434.1|1897276_1897807_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_138464377.1|1898029_1899412_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_015639484.1|1899411_1900701_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_003681339.1|1902627_1903200_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151130435.1|1903332_1903581_+	ABC transporter	NA	NA	NA	NA	NA
WP_151130436.1|1904927_1906913_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.3	7.1e-32
WP_003681329.1|1906999_1907668_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
1908035:1908065	attL	AAGTGGGAAATGACCTTCTCGACAGACCGTA	NA	NA	NA	NA
WP_151130437.1|1908155_1908812_-	1-deoxy-d-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_151130438.1|1908985_1909303_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046025483.1|1909418_1910132_-	arginase family protein	NA	NA	NA	NA	NA
WP_069775795.1|1910239_1911190_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003681317.1|1911258_1911579_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003681316.1|1911626_1912199_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_021349577.1|1913376_1916142_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.4	1.9e-70
WP_151130439.1|1916196_1918539_-	nitric-oxide reductase large subunit	NA	NA	NA	NA	NA
WP_003575700.1|1920520_1920727_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_151130440.1|1922444_1923443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151130441.1|1923485_1923671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021353998.1|1923799_1924777_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_151130442.1|1924856_1926125_-	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_151130443.1|1926868_1927360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639502.1|1928798_1930352_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.0	3.0e-17
WP_054173610.1|1930666_1931278_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_021349574.1|1931291_1931963_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.1	8.9e-19
WP_151130444.1|1931975_1933229_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_151130445.1|1933496_1934369_-|integrase	site-specific integrase	integrase	H7BW99	unidentified_phage	31.1	8.8e-27
WP_052696664.1|1934607_1934865_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_052696665.1|1935098_1935665_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151130446.1|1935669_1938435_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	38.5	1.2e-167
WP_151130447.1|1938828_1940868_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_046949115.1|1940915_1941941_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
1954183:1954213	attR	AAGTGGGAAATGACCTTCTCGACAGACCGTA	NA	NA	NA	NA
>prophage 21
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	2037584	2156411	2267305	transposase,tRNA	Paenibacillus_phage(16.67%)	106	NA	NA
WP_080965008.1|2037584_2038493_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	1.9e-11
WP_014562701.1|2038792_2039803_-	nickel transporter NixA	NA	NA	NA	NA	NA
WP_151130467.1|2039831_2040659_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_012391743.1|2040683_2041394_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_012391744.1|2041395_2042760_-	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_012391745.1|2042759_2043518_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	47.2	3.7e-21
WP_127429624.1|2043525_2044809_-	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
WP_023466300.1|2045049_2045721_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014562705.1|2047805_2048993_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_014562706.1|2050258_2051980_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_003681137.1|2052167_2053496_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_003681135.1|2053510_2053906_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_021349696.1|2053929_2054847_-	ribokinase	NA	NA	NA	NA	NA
WP_021349649.1|2055091_2056051_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012391752.1|2056154_2056808_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_003685477.1|2056821_2057838_+	DUF4432 family protein	NA	NA	NA	NA	NA
WP_003685479.1|2057871_2058819_+	ribokinase	NA	NA	NA	NA	NA
WP_014562709.1|2058878_2060303_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_014562710.1|2060500_2061505_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_021350294.1|2062058_2063564_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_042513835.1|2064356_2065715_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014562712.1|2066306_2068706_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_012391758.1|2068911_2069709_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_151130468.1|2069715_2070444_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681115.1|2070587_2071088_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003681114.1|2071091_2071835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021349122.1|2071894_2073331_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_014562716.1|2073566_2074379_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014562717.1|2074644_2075160_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003685499.1|2075169_2075697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681106.1|2075845_2077231_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003681105.1|2077317_2077782_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_021349399.1|2078026_2078458_-	VOC family protein	NA	NA	NA	NA	NA
WP_021349400.1|2078650_2079820_+	MFS transporter	NA	NA	NA	NA	NA
WP_024501234.1|2080191_2081673_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	36.9	3.1e-72
WP_012391767.1|2081857_2083297_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	30.2	1.1e-29
WP_021350129.1|2083551_2084025_-	universal stress protein	NA	NA	NA	NA	NA
WP_021350128.1|2084186_2084642_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021350127.1|2084800_2085568_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	5.6e-17
WP_024501235.1|2085584_2086586_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_021350126.1|2086857_2088666_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_014562721.1|2088668_2089961_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_021350125.1|2090208_2090880_+	membrane protein	NA	NA	NA	NA	NA
WP_023467458.1|2092535_2094215_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_004562986.1|2094797_2095457_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	8.1e-41
WP_042513953.1|2096916_2098137_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	44.5	4.6e-90
WP_021353998.1|2098745_2099723_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_046041176.1|2099837_2099930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102116229.1|2099936_2100371_+	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_003645890.1|2100441_2100576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080650603.1|2100653_2100995_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	48.1	9.1e-12
WP_081540359.1|2101371_2102511_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.0e-43
WP_042513953.1|2103426_2104647_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	44.5	4.6e-90
WP_035437573.1|2104911_2105208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003688746.1|2105226_2105391_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_035437571.1|2105443_2107639_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	4.0e-60
WP_035437569.1|2107889_2108321_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_003685528.1|2108906_2109488_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.9	1.7e-21
WP_151130469.1|2109816_2110488_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	8.6e-30
WP_151130470.1|2110492_2111539_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_151130471.1|2111865_2113089_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	44.7	1.9e-88
WP_151130472.1|2113090_2113828_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.1	1.9e-54
WP_151130473.1|2113883_2115218_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014562705.1|2115321_2116509_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
WP_086031772.1|2116794_2117727_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.1e-27
WP_081540359.1|2118003_2119143_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.0e-43
WP_112297101.1|2119388_2120687_-	MFS transporter	NA	NA	NA	NA	NA
WP_112297102.1|2120929_2121781_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_112297103.1|2121842_2122064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130474.1|2122645_2123260_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151130475.1|2123256_2124057_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080965019.1|2124084_2124555_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	29.4	1.3e-13
WP_080965008.1|2124719_2125628_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	1.9e-11
WP_151130505.1|2125883_2127827_+	lactose permease	NA	NA	NA	NA	NA
WP_151130476.1|2127902_2130125_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_023465538.1|2130339_2131341_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.1	4.4e-06
WP_012391785.1|2131368_2132823_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_021350297.1|2132857_2134024_-	galactokinase	NA	NA	NA	NA	NA
WP_012391787.1|2134195_2135146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024272085.1|2135151_2135940_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_021350299.1|2135958_2136471_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003682205.1|2136483_2136708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350300.1|2136823_2137558_-	amino acid ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.1	1.5e-14
WP_015639612.1|2137559_2138249_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003685553.1|2138351_2139152_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003682214.1|2139290_2139617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682216.1|2139718_2140657_+	hypothetical protein	NA	A0A2R8FDS8	Brazilian_cedratvirus	33.2	7.0e-30
WP_003682220.1|2140658_2141141_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_024271731.1|2141357_2142152_+	nicotinamide mononucleotide transporter	NA	A0A0C5K6M3	Enterococcus_phage	33.1	5.8e-25
WP_003685559.1|2142258_2142768_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	50.0	1.9e-37
WP_021353558.1|2142776_2144681_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.8	3.4e-71
WP_003685564.1|2144940_2146251_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.7	1.0e-47
WP_003682227.1|2146347_2146641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042513892.1|2146633_2147794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682231.1|2147786_2148929_-	AAA domain-containing protein	NA	A0A141HRX4	Bacillus_phage	31.1	1.7e-22
WP_003682233.1|2148930_2149560_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003682235.1|2149619_2149988_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_012391797.1|2150278_2150464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003685576.1|2150464_2151139_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003682246.1|2151141_2151465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682248.1|2151558_2152185_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003682249.1|2152365_2152923_-	elongation factor P	NA	NA	NA	NA	NA
WP_021349677.1|2153069_2153702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682253.1|2153838_2154072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682254.1|2154118_2155066_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_046949115.1|2155385_2156411_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
>prophage 22
NZ_CP044354	Lactobacillus fermentum strain 2760 chromosome, complete genome	2267305	2166743	2240357	2267305	transposase,protease,tRNA	Staphylococcus_phage(15.0%)	58	NA	NA
WP_151130480.1|2166743_2168549_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	33.8	1.4e-87
WP_046025659.1|2168693_2169308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151130481.1|2169313_2170192_+	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_041813097.1|2170386_2170998_-	signal peptidase I	NA	NA	NA	NA	NA
WP_151130482.1|2171072_2172629_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_151130483.1|2172633_2174169_-	UDP-N-acetylmuramyl-tripeptide synthetase	NA	NA	NA	NA	NA
WP_123472454.1|2174168_2176079_-	asparagine synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
WP_151130506.1|2176385_2177807_+	amino acid permease	NA	NA	NA	NA	NA
WP_151130484.1|2177917_2178295_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003682279.1|2178554_2180459_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_003682281.1|2180473_2181862_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_151130485.1|2182007_2182868_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_012391813.1|2182898_2183732_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003682289.1|2183747_2184092_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003682291.1|2184207_2184342_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_130125585.1|2184415_2184778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151130486.1|2184860_2186177_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_012390650.1|2186341_2187481_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	30.6	4.7e-12
WP_003682299.1|2187702_2187921_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003682300.1|2187930_2189052_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003682301.1|2189051_2191001_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.6	5.7e-143
WP_015638408.1|2191026_2193537_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.3	2.0e-111
WP_042513824.1|2193710_2194961_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.3	1.8e-57
WP_012390701.1|2195039_2195492_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_003682303.1|2195748_2196042_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_035435868.1|2196082_2196808_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	66.4	5.6e-35
WP_003682305.1|2196846_2197083_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_035435870.1|2197207_2199241_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003685631.1|2199240_2199693_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003682308.1|2199737_2201141_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	49.3	2.7e-110
WP_021349470.1|2201224_2202400_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	28.7	1.7e-44
WP_003682310.1|2202411_2202744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562466.1|2203068_2204067_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
WP_003685635.1|2204585_2205293_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	7.9e-42
WP_048339884.1|2205304_2207164_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.2	6.5e-35
WP_003682313.1|2207147_2208446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012390658.1|2208447_2209248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682315.1|2209262_2210078_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.2	4.1e-34
WP_023465941.1|2210152_2211424_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	5.8e-19
WP_151130487.1|2211931_2212411_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003685648.1|2212625_2213051_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_151130488.1|2213056_2213992_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015638415.1|2214492_2215836_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_015638416.1|2215848_2218095_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_003682323.1|2218241_2218910_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_151130489.1|2218992_2219655_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003682326.1|2219707_2220685_-	choloylglycine hydrolase family protein	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	25.4	3.3e-14
WP_021349396.1|2220739_2221675_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_102116102.1|2221977_2222970_-	D-2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	31.5	3.1e-36
WP_024500593.1|2222985_2224170_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003682330.1|2224518_2224749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562056.1|2224863_2226957_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.4	5.1e-121
WP_012390672.1|2227257_2228718_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_021353998.1|2229148_2230126_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_151130120.1|2230278_2234016_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_151130121.1|2234022_2238036_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.3	2.0e-12
WP_003685671.1|2238035_2238899_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.4	5.6e-58
WP_014562705.1|2239169_2240357_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	4.4e-37
