The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	1253403	1323713	4860533	transposase,protease,tRNA	Escherichia_phage(15.38%)	55	NA	NA
WP_001295836.1|1253403_1254027_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1253997_1254684_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1254680_1257095_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_151043889.1|1257525_1261806_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_001118615.1|1261847_1262771_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
WP_000877768.1|1262911_1263280_+	immunity protein	NA	NA	NA	NA	NA
WP_085947917.1|1263444_1264717_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001529777.1|1265306_1265567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1266797_1267892_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_130065564.1|1267960_1268887_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|1269116_1269599_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1269676_1270492_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1270581_1272363_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1272375_1273152_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1273251_1274130_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_021570710.1|1274298_1275753_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1275812_1277174_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1277230_1278532_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1278553_1279699_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|1279926_1280712_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1280722_1281958_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_001339197.1|1282398_1283607_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000580840.1|1284683_1286351_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|1286360_1287620_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001469952.1|1287630_1288446_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855388.1|1288442_1289336_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815566.1|1289530_1290598_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001351650.1|1290594_1291104_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|1291221_1291944_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1291946_1292441_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|1292614_1294000_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|1294035_1294557_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1294664_1294877_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1294878_1295745_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1296215_1296758_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988365.1|1296977_1297670_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001118615.1|1299004_1299928_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
WP_001350487.1|1302131_1303172_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|1303182_1303698_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|1303700_1304333_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_151043893.1|1304697_1305471_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001224575.1|1305653_1306544_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000253838.1|1307864_1309313_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770953.1|1309302_1309986_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074234.1|1310142_1311516_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709870.1|1311673_1312006_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717157.1|1312021_1313245_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573945.1|1313256_1316400_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000786320.1|1316501_1317878_+	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
WP_001153148.1|1317945_1319193_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000351480.1|1319300_1319954_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|1320047_1320416_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682524.1|1320480_1320729_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130653.1|1320794_1321913_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_151043896.1|1322344_1323713_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
>prophage 2
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	1811102	1860516	4860533	integrase,transposase	Bluetongue_virus(22.22%)	33	1810996:1811055	1860564:1861892
1810996:1811055	attL	CTGATGAATCCCCTAATGATTTTGGTAAAAATCATTAAGTTAAGGTGGATACACATCTTG	NA	NA	NA	NA
WP_001339197.1|1811102_1812311_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_085947771.1|1812516_1813679_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000389396.1|1813764_1814088_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_021570754.1|1814084_1815071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100212142.1|1815210_1815441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279862.1|1815799_1817008_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.2	6.5e-44
WP_001349431.1|1819589_1819838_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_095140861.1|1819938_1821762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063084858.1|1822969_1823533_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_151043937.1|1823797_1824721_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	2.4e-176
WP_086598315.1|1824767_1826162_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.1	1.3e-19
WP_020219275.1|1826747_1829168_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_095140852.1|1829176_1831195_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_071961403.1|1831187_1832513_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_020219278.1|1832514_1832928_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_063108289.1|1832978_1833851_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.7	3.3e-90
WP_001313178.1|1833857_1834889_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.9	1.5e-166
WP_000053329.1|1835269_1836280_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	5.1e-18
WP_000433621.1|1836373_1838500_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001099190.1|1838554_1839832_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813683.1|1839828_1841259_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_000523728.1|1841322_1841838_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_151043941.1|1841843_1842047_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001313183.1|1842108_1842420_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000108760.1|1842449_1843376_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000716410.1|1843475_1844972_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_032142224.1|1846787_1847159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545263.1|1849974_1851528_-	L-lactate permease	NA	NA	NA	NA	NA
WP_095140851.1|1851958_1853656_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001102105.1|1853730_1854450_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_050019109.1|1854460_1855888_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_065304411.1|1855880_1856576_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001339197.1|1859307_1860516_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
1860564:1861892	attR	CAAGATGTGTATCCACCTTAACTTAATGATTTTTACCAAAATCATTAGGGGATTCATCAGCGCTTAGCTTCACCAGTAGCAGCATCAGTAAAGCCTTCCATATACTCTGCATAACTCTTTTCTAACACTACATTTTTGGTGTTTTTGTCACCAAACAGCGTTATGGCATCGATGGTTGAGCGTTCCAGATCGCGGAAAGTGACGATATTACCGAAGGTTTTAGTTGCATCATAAATACGGTTGGTGCGGGAAAATGCCTGCATCAGGCCGTGAAAACGCAAGTTTTTATCGACGAATAGCGTGTTCAATGTTGGAGCATCGAAACCGGTTAAAAACATCCCCACGACAATTAACAGATCGATATCCTGATTTTTAACCCGTTGGGCTAAATCACGATAGTAGTTCTGAAAACCGTTACTGTCGGTGCTAAAGTTAGTTTTAAAATGGCTGTTATATTCACGAATTGCAGCGTCCAGAAACTCTTTAGCACTGCTGTCCATTGCGCTGGTATCAAAAGTTTCATCGGAAATTTCACCAATGGCATTTTGTTCTTCATTGGCGGCAAAGGAGAAGATTGTCGCAATACGCAGCGGTTTATAGGTAGCCGATTTATTAGCGGCTTCTTCTTGTAACCGTTTAAACGTCGCATAATAGGCTTTCGCGGCATCCACGCTGCTCACTGCCAACATAGCATTAAAACCTTTTGAGCCAGGGAAGGTACGGTGGGTTTTCTGGCGGAAATTATTCAGAATATATTGCGTGATTTCCTGAATACGCATGGGATGAAGAAACGCCTGCTGATTTTCAGCCGCACTCAGTTTTTTCTCGTCAGTTTCTGTCTCTAAAGACTTAAACTGTGGCCGCACATCGTTGTAGTCCACCTTGAATTTGAGCACTTTTTCGTCACGAATCGCATCGGTAATTACATACGAATGCAATTCACGACCAAATACGCTGGCGGTTGTTTCTGAGCCTAAGGCGTTTTCCGGGAAAATAGGGGTGCCGGTAAAACCAAACTGATAATAGCGTTTGAATTTCTTCTTCAGGTTTTTCTGCGCTTCTCCAAACTGGCTGCGGTGGCATTCATCAAATATAAACACCACTTGCTGATTATATACAGGCAGATCGCTTTCTGCTTTCATCAGGTTATTGAGTTTCTGAATAGTAGTGACGATAATTTTGTTATCGTCCTTATCCAGATTTCGTTTAAGGCCTGCGGTATTTTCCGAGCCGTTGACGCTGTCTGGCGAAAAACGCTGATATTCCTTCATGGTCTGGTAATCGAGGTCTTTCCTGTCGACCACAAAGAAGACTTTATCAATAAAGTCC	NA	NA	NA	NA
>prophage 3
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	2074583	2141097	4860533	terminase,holin,tail,protease,integrase,head,capsid,portal	Enterobacteria_phage(81.36%)	79	2074381:2074397	2121359:2121375
2074381:2074397	attL	AGAACACTTTCTTAAAT	NA	NA	NA	NA
WP_000627155.1|2074583_2075777_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
WP_000340953.1|2075773_2075971_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	100.0	8.3e-34
WP_001237029.1|2076012_2076255_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	100.0	4.0e-38
WP_000432226.1|2076293_2077406_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	100.0	3.9e-205
WP_128550293.1|2077417_2080807_-	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	94.0	0.0e+00
WP_000407050.1|2080947_2081235_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	100.0	1.0e-48
WP_000711201.1|2081320_2081479_-	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	100.0	1.4e-23
WP_000248003.1|2081512_2081719_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	100.0	4.3e-33
WP_112974623.1|2081880_2082549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021571182.1|2083125_2083878_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	64.4	5.4e-73
WP_000102594.1|2083919_2084153_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
WP_000555792.1|2084170_2084716_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	100.0	3.0e-97
WP_097331700.1|2084801_2085671_+	replication protein	NA	K7PGT1	Enterobacteria_phage	51.2	7.9e-68
WP_151043947.1|2085655_2086528_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	67.9	4.9e-94
WP_089584592.1|2086524_2086869_+	winged helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	91.2	2.4e-52
WP_151043950.1|2087350_2087689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045337220.1|2088538_2088793_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	78.8	3.9e-28
WP_151043953.1|2088802_2089387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045350997.1|2089567_2090023_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	76.2	8.0e-64
WP_000106777.1|2090022_2090193_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	100.0	1.1e-23
WP_151044291.1|2090189_2090858_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	99.1	2.9e-131
WP_000048137.1|2090850_2091135_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	100.0	4.5e-49
WP_016063446.1|2091131_2091488_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	100.0	1.1e-65
WP_000801961.1|2091484_2091622_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	3.2e-08
WP_151043955.1|2091621_2092437_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	99.3	2.6e-145
WP_016066212.1|2092904_2093546_+	hypothetical protein	NA	K7PJU1	Enterobacteria_phage	100.0	8.5e-120
WP_003832349.1|2093702_2093981_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	100.0	3.9e-45
WP_061350480.1|2093958_2094525_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	100.0	1.9e-107
WP_151043958.1|2094524_2095061_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	92.7	1.0e-73
WP_001568787.1|2095635_2096538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096912103.1|2096694_2097423_+	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	97.9	2.6e-117
WP_123009619.1|2097391_2097574_+	hypothetical protein	NA	K7PM54	Enterobacteria_phage	83.1	4.8e-20
WP_000453626.1|2097668_2098214_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	100.0	1.1e-94
WP_023062984.1|2098188_2100111_+|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	99.8	0.0e+00
WP_000235410.1|2100110_2100317_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	100.0	4.5e-30
WP_000701346.1|2100313_2101906_+|portal	phage portal protein	portal	K7PHD3	Enterobacteria_phage	100.0	1.0e-310
WP_000929808.1|2101886_2103230_+|capsid	phage capsid assembly protein	capsid	K7PKQ1	Enterobacteria_phage	100.0	7.1e-217
WP_001018610.1|2103239_2103572_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	100.0	9.0e-57
WP_000118198.1|2103639_2104665_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	100.0	9.2e-193
WP_000136479.1|2104710_2105127_+	hypothetical protein	NA	K7P7M3	Enterobacteria_phage	93.5	1.2e-42
WP_000753023.1|2105137_2105491_+|tail	tail attachment protein	tail	K7PHD8	Enterobacteria_phage	100.0	1.7e-61
WP_000023111.1|2105500_2106055_+|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	100.0	1.8e-81
WP_000682752.1|2106051_2106450_+|tail	tail protein	tail	K7PJT1	Enterobacteria_phage	100.0	1.0e-70
WP_000235018.1|2106457_2107195_+|tail	phage tail protein	tail	K7PGX1	Enterobacteria_phage	99.6	2.1e-130
WP_000479021.1|2107231_2107654_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	100.0	6.7e-57
WP_151043962.1|2107662_2107983_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	99.1	6.2e-55
WP_000079423.1|2107960_2110477_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	93.0	0.0e+00
WP_000151491.1|2110482_2110830_+|tail	phage tail protein	tail	K7P7G7	Enterobacteria_phage	100.0	4.8e-61
WP_000055652.1|2110826_2111582_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	99.6	8.7e-148
WP_001249260.1|2111583_2112315_+	peptidase P60	NA	K7PM21	Enterobacteria_phage	100.0	3.7e-151
WP_001374340.1|2112302_2112893_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	100.0	3.5e-104
WP_151043965.1|2112945_2116401_+	host specificity protein J	NA	K7P840	Enterobacteria_phage	97.7	0.0e+00
WP_015980130.1|2116402_2116705_+	hypothetical protein	NA	E4WL40	Enterobacteria_phage	100.0	7.4e-50
WP_016042213.1|2116704_2117343_+	hypothetical protein	NA	G8C7K3	Escherichia_phage	100.0	5.5e-119
WP_015980120.1|2117450_2117684_+	cor protein	NA	K7PH20	Enterobacteria_phage	100.0	2.7e-39
WP_151043968.1|2117742_2119146_+|tail	phage tail protein	tail	K7PHF0	Enterobacteria_phage	76.4	5.1e-202
WP_151044294.1|2119316_2119856_+|tail	tail fiber domain-containing protein	tail	H6VUB9	Escherichia_phage	49.5	1.6e-18
WP_109555117.1|2119860_2120241_-|tail	tail fiber domain-containing protein	tail	K7PGY2	Enterobacteria_phage	58.0	4.2e-34
WP_016247139.1|2120689_2121238_+	recombinase family protein	NA	K7PGS7	Enterobacteria_phage	99.5	4.3e-96
WP_000967595.1|2121356_2121653_-	YciI family protein	NA	NA	NA	NA	NA
2121359:2121375	attR	AGAACACTTTCTTAAAT	NA	NA	NA	NA
WP_001360141.1|2121876_2122596_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|2122635_2123034_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|2123138_2123678_-	septation protein A	NA	NA	NA	NA	NA
WP_000028545.1|2123707_2124451_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737226.1|2124807_2125446_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000807651.1|2126571_2126751_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|2127131_2127938_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|2127937_2129131_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_021570766.1|2129142_2130501_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
WP_000763511.1|2130504_2132100_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194582.1|2132099_2133662_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2133753_2133798_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|2133935_2134817_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2134813_2135434_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001326916.1|2135461_2137357_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|2137567_2138443_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|2138482_2139073_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559286.1|2139069_2139828_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|2140047_2141097_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	2372850	2478347	4860533	terminase,lysis,tail,protease,integrase,transposase	Escherichia_phage(21.43%)	109	2369531:2369547	2467876:2467892
2369531:2369547	attL	TATCTCCATGCGAAAAC	NA	NA	NA	NA
WP_001339197.1|2372850_2374059_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_151044017.1|2374162_2375794_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
WP_120795387.1|2375996_2376119_+	protein YneP	NA	NA	NA	NA	NA
WP_001299007.1|2376084_2377242_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_001295684.1|2377293_2378976_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_151044020.1|2379377_2380139_-	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_000543389.1|2380213_2380411_-	two-component system connector SafA	NA	NA	NA	NA	NA
WP_001556575.1|2380658_2382938_-	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_000520659.1|2383271_2384186_-	fimbrial protein	NA	NA	NA	NA	NA
WP_064670492.1|2384245_2384749_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876770.1|2384761_2385292_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_085947917.1|2385958_2387232_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_041124212.1|2387262_2388870_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_089566769.1|2389085_2390247_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001125439.1|2391855_2393178_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|2393177_2393444_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001083595.1|2393666_2395067_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
WP_000113145.1|2399616_2401209_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154352.1|2401287_2402241_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_021570792.1|2402489_2404025_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	2.2e-20
WP_000911166.1|2404018_2405047_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222729.1|2405046_2406039_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172488.1|2406050_2407073_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774183.1|2407099_2407975_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|2407998_2408289_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|2408345_2409104_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_130065497.1|2409107_2410022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854633.1|2410228_2411680_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558029.1|2411906_2413325_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
WP_001191027.1|2413463_2413823_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|2413822_2414749_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156615.1|2414812_2416201_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366501.1|2416301_2417183_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064670495.1|2417260_2418376_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|2418525_2419716_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|2419740_2420406_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843414.1|2420617_2421052_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|2421071_2421455_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803657.1|2421486_2421705_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087214.1|2421735_2422635_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054183.1|2422829_2424017_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|2424143_2424239_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592814.1|2424457_2425348_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_151044023.1|2425602_2425947_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001339197.1|2426019_2427228_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001024746.1|2427608_2428127_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000210373.1|2428170_2430216_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|2430352_2431099_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|2431187_2431874_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|2432050_2432254_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|2432288_2433749_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|2433837_2435121_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2435723_2435837_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2435905_2436139_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086531.1|2436455_2437046_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	1.1e-23
WP_000885634.1|2437143_2437719_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	9.4e-102
WP_151044026.1|2439321_2439840_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	96.2	1.7e-78
WP_001368374.1|2440228_2440462_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2440519_2440930_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2441081_2441255_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2441426_2441582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2441661_2441727_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2441729_2441918_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2441928_2442141_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2442503_2443001_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2442997_2443531_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2443527_2443839_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2443843_2444059_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2444812_2445028_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2445328_2445541_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2445595_2445685_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2445962_2446715_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_064670548.1|2446711_2447770_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.1	8.3e-112
WP_012304870.1|2447771_2448050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2448116_2448368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2448584_2448740_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2448811_2449099_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2449098_2449338_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2449362_2449668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2449870_2450203_+	protein FlxA	NA	NA	NA	NA	NA
WP_089566769.1|2450680_2451842_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000589005.1|2451900_2453214_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|2453391_2453574_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000854559.1|2453693_2453882_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|2453878_2454070_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_021570798.1|2454162_2456634_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	4.2e-58
WP_001296941.1|2456721_2456958_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876986.1|2456992_2458273_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001389342.1|2458274_2458403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|2458460_2459480_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2459491_2460706_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2460911_2461238_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2461372_2461714_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2461748_2462309_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2462311_2463022_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|2463129_2463435_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041681.1|2463633_2466060_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001340362.1|2466120_2468544_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
2467876:2467892	attR	TATCTCCATGCGAAAAC	NA	NA	NA	NA
WP_000213028.1|2468554_2469172_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_151044029.1|2469173_2470028_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2470070_2470685_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071593517.1|2470843_2472136_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|2472088_2472784_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|2472908_2474129_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019530.1|2474263_2475157_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091828.1|2475263_2476517_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743942.1|2476914_2477250_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|2477342_2477426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260835.1|2477525_2478347_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	2870402	2880320	4860533	transposase	Burkholderia_phage(33.33%)	11	NA	NA
WP_001564714.1|2870402_2872097_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
WP_071525573.1|2872057_2872252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000009306.1|2872334_2872517_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2872595_2873513_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001507517.1|2873685_2874606_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2874594_2875065_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157230.1|2875045_2876464_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	3.0e-101
WP_000365561.1|2876530_2877226_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|2877265_2877631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072134966.1|2878194_2879004_+	porin	NA	Q1MVN1	Enterobacteria_phage	50.3	8.1e-67
WP_085947917.1|2879047_2880320_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 6
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	2890757	2978747	4860533	terminase,holin,lysis,tail,protease,integrase,head,capsid,portal,transposase	Enterobacteria_phage(54.93%)	104	2886496:2886511	2985487:2985502
2886496:2886511	attL	CCTGCCGGATGCGGCG	NA	NA	NA	NA
WP_001292569.1|2890757_2891396_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
WP_071593939.1|2892033_2892237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053263355.1|2892706_2893591_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_122988990.1|2894506_2899960_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_100224574.1|2899963_2900254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105078436.1|2900278_2901475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000477907.1|2901723_2902776_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378572.1|2903090_2904407_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2904508_2905963_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532923.1|2906305_2907022_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122985555.1|2907653_2909297_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_047662175.1|2909414_2910365_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011447.1|2910466_2911384_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_122985809.1|2911841_2912777_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193786.1|2912838_2913918_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025670340.1|2913929_2914673_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2914669_2915215_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001339197.1|2917412_2918621_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_016244794.1|2918870_2919818_+	ribokinase	NA	NA	NA	NA	NA
WP_001066368.1|2919831_2920590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656352.1|2921614_2922649_+	phosphotriesterase	NA	NA	NA	NA	NA
WP_001221617.1|2924963_2925374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270974.1|2925361_2925763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102643.1|2926419_2927490_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775500.1|2927625_2928309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846713.1|2928324_2928735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860076.1|2930634_2931114_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|2931129_2931606_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2931668_2931890_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285585.1|2931963_2932332_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_130065512.1|2932420_2932795_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|2932791_2932986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2932998_2933112_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016348.1|2933600_2933783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2933883_2934213_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_064670363.1|2934384_2935443_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105415.1|2935640_2936114_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_016247321.1|2936232_2937399_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	6.5e-227
WP_148049256.1|2937742_2938126_-	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	57.4	6.3e-38
WP_151044070.1|2938203_2938470_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.3	1.8e-39
WP_151044073.1|2938565_2939969_-|tail	phage tail protein	tail	K7PHF0	Enterobacteria_phage	81.7	2.6e-214
WP_015980120.1|2940027_2940261_-	cor protein	NA	K7PH20	Enterobacteria_phage	100.0	2.7e-39
WP_016042213.1|2940368_2941007_-	hypothetical protein	NA	G8C7K3	Escherichia_phage	100.0	5.5e-119
WP_015980130.1|2941006_2941309_-	hypothetical protein	NA	E4WL40	Enterobacteria_phage	100.0	7.4e-50
WP_151044076.1|2941310_2944862_-	DUF1983 domain-containing protein	NA	G8C7K1	Escherichia_phage	99.7	0.0e+00
WP_001158650.1|2944914_2945523_-|tail	tail assembly protein	tail	K7PM69	Enterobacteria_phage	100.0	1.4e-103
WP_015980116.1|2945572_2945797_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	100.0	3.6e-33
WP_151044079.1|2945844_2946555_-	peptidase P60	NA	K7PJX1	Enterobacterial_phage	98.3	1.0e-145
WP_015980114.1|2946556_2947312_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	100.0	4.8e-146
WP_015980113.1|2947308_2947647_-|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	100.0	1.0e-63
WP_016063025.1|2947646_2950067_-|tail	phage tail tape measure protein	tail	K7PGX8	Enterobacteria_phage	100.0	0.0e+00
WP_015980110.1|2950262_2950748_-	lambda gpG analog	NA	K7PJU9	Enterobacteria_phage	100.0	4.1e-66
WP_151044082.1|2950786_2951287_-|tail	phage tail protein	tail	Q9MCU9	Escherichia_phage	99.4	1.8e-88
WP_151044084.1|2951341_2951707_-	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	99.2	4.0e-66
WP_016063022.1|2951703_2952243_-	HK97 gp10 family phage protein	NA	K7PM60	Enterobacteria_phage	100.0	4.0e-94
WP_015980106.1|2952235_2952568_-|head	phage head closure protein	head	Q9MCV2	Escherichia_phage	100.0	2.0e-56
WP_016063021.1|2952569_2952767_-	hypothetical protein	NA	K7PGR0	Enterobacteria_phage	100.0	1.3e-26
WP_151044087.1|2952763_2953000_-|head	phage head closure protein	head	Q9MCV4	Escherichia_phage	97.4	2.8e-36
WP_015980103.1|2952999_2953326_-	gp6	NA	Q77W99	Escherichia_phage	100.0	2.8e-55
WP_016063987.1|2953362_2954517_-|capsid	phage major capsid protein	capsid	K7P862	Enterobacteria_phage	100.0	4.1e-213
WP_015980101.1|2954519_2955197_-|head,protease	HK97 family phage prohead protease	head,protease	Q9MCV5	Escherichia_phage	100.0	2.4e-125
WP_015980100.1|2955214_2956489_-|portal	phage portal protein	portal	Q9MCV6	Escherichia_phage	100.0	1.9e-248
WP_015980155.1|2956488_2958003_-|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	100.0	2.8e-294
WP_015980098.1|2958009_2958495_-	hypothetical protein	NA	Q77WA1	Escherichia_phage	100.0	7.0e-82
WP_151044090.1|2958512_2958740_-	hypothetical protein	NA	K7PKP7	Enterobacterial_phage	88.6	6.4e-14
WP_016063192.1|2958679_2958883_-	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	100.0	4.7e-32
WP_016063049.1|2958882_2959224_-	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	100.0	2.7e-64
WP_016063373.1|2959616_2959874_-	hypothetical protein	NA	K7PMB3	Enterobacterial_phage	100.0	5.0e-39
WP_057696221.1|2959876_2960605_-	DNA-binding protein	NA	A0A2I6PIG6	Escherichia_phage	100.0	1.1e-142
WP_151044093.1|2960811_2961249_-|lysis	lysis protein	lysis	K7P869	Enterobacteria_phage	97.9	1.1e-70
WP_000229392.1|2961245_2961722_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_001570152.1|2961705_2962029_-|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	99.1	1.1e-51
WP_015973887.1|2962490_2963009_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	100.0	9.0e-96
WP_038977035.1|2962999_2963671_-	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	97.8	3.0e-131
WP_000144614.1|2963648_2963855_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_032178589.1|2963851_2964457_-	recombination protein NinG	NA	K7PHP1	Enterobacterial_phage	99.0	9.6e-97
WP_000950963.1|2964449_2964626_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_151044095.1|2964618_2964978_-	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	73.3	3.7e-40
WP_001254220.1|2964980_2965157_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_000736913.1|2965688_2966129_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_021575659.1|2966202_2967579_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.3e-253
WP_151044297.1|2967575_2968463_-	replication protein	NA	A5VW95	Enterobacteria_phage	95.6	8.1e-145
WP_001244621.1|2968525_2968798_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|2968820_2969114_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000620665.1|2969222_2969417_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_000428318.1|2969523_2970240_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000233125.1|2970257_2970626_+	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	99.2	1.3e-56
WP_151044099.1|2970993_2971293_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	97.0	2.6e-31
WP_000394299.1|2971301_2971553_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_052920491.1|2971592_2971889_+	hypothetical protein	NA	K7PH98	Enterobacteria_phage	98.0	1.2e-49
WP_000972063.1|2972230_2972365_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|2972349_2972502_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000604111.1|2972586_2972895_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_151044101.1|2972891_2973794_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	87.8	2.6e-146
WP_151044103.1|2973777_2974260_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	95.6	6.7e-77
WP_000753555.1|2974271_2974586_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_001214456.1|2974602_2974767_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_151044106.1|2975675_2976446_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	66.7	4.2e-89
WP_001276453.1|2976448_2976634_+	hypothetical protein	NA	K7PJY8	Enterobacterial_phage	100.0	4.6e-26
WP_151044108.1|2976630_2976849_+	hypothetical protein	NA	K7PKY3	Enterobacterial_phage	97.1	1.6e-33
WP_122991675.1|2976841_2977126_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	4.1e-50
WP_021823754.1|2977198_2977366_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.2e-27
WP_000132739.1|2977396_2977588_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_151044111.1|2977568_2978747_-|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.5	3.4e-231
2985487:2985502	attR	CGCCGCATCCGGCAGG	NA	NA	NA	NA
>prophage 7
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	3002886	3010853	4860533		Bathycoccus_sp._RCC1105_virus(16.67%)	8	NA	NA
WP_000564888.1|3002886_3003990_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.1	8.0e-41
WP_000971201.1|3003986_3004454_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001025599.1|3004450_3004846_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000676086.1|3004849_3005713_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.1	2.0e-111
WP_000699411.1|3005712_3006798_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.8e-101
WP_000183034.1|3007169_3008063_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_000999466.1|3008305_3009301_-	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_064670358.1|3009458_3010853_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 8
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	3098008	3107449	4860533		Enterobacteria_phage(85.71%)	10	NA	NA
WP_064670439.1|3098008_3099145_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	9.4e-162
WP_130065479.1|3099141_3101142_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001295429.1|3101266_3101728_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|3101767_3102238_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|3102284_3103004_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3103000_3104686_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_130065480.1|3104907_3105639_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	1.4e-110
WP_001216963.1|3105698_3105806_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3105786_3106518_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|3106522_3107449_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 9
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	3310328	3393609	4860533	terminase,holin,tail,protease,tRNA,integrase,head,capsid,portal,plate,transposase	Shigella_phage(60.0%)	96	3336290:3336307	3357661:3357678
WP_000156149.1|3310328_3311219_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	43.9	8.9e-67
WP_001293613.1|3311415_3312189_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|3312196_3312913_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965522.1|3312909_3313596_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000737621.1|3313685_3314468_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748271.1|3314688_3315471_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825700.1|3315736_3316306_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000334220.1|3316400_3317918_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
WP_000262113.1|3317954_3318443_-	colicin V production protein	NA	NA	NA	NA	NA
WP_000146992.1|3318701_3319364_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584546.1|3319353_3320622_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|3320691_3321606_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364335.1|3321761_3322421_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283585.1|3322503_3323316_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|3323315_3324329_-	USG-1 protein	NA	NA	NA	NA	NA
WP_130065233.1|3324394_3325531_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	2.6e-23
WP_000615834.1|3325629_3326625_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127751.1|3326621_3327800_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|3328064_3329285_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683789.1|3329443_3331450_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3331570_3331849_-	YfcL family protein	NA	NA	NA	NA	NA
WP_151044131.1|3331882_3332431_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3332430_3333240_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043825.1|3333239_3334064_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001333535.1|3334067_3335153_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001300582.1|3335187_3336120_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|3336285_3336837_+	endonuclease SmrB	NA	NA	NA	NA	NA
3336290:3336307	attL	AAAAGAAAACAACACTTA	NA	NA	NA	NA
WP_000698770.1|3336908_3337766_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844747.1|3337767_3338307_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714137.1|3338303_3338792_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018448.1|3338788_3339298_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482742.1|3339313_3340066_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_151044133.1|3340085_3342731_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033316.1|3342812_3343376_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3344056_3344542_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426176.1|3344744_3346889_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531952.1|3346888_3348199_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|3348379_3348664_-	DUF406 family protein	NA	NA	NA	NA	NA
WP_001295701.1|3349035_3350376_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776768.1|3351745_3352501_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368140.1|3352794_3353727_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_151044300.1|3354038_3355196_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.0	1.8e-221
WP_063117636.1|3355334_3355697_+	GtrA family protein	NA	U5P0S6	Shigella_phage	89.2	6.0e-54
WP_151044136.1|3355693_3356626_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	90.7	1.4e-160
WP_151044138.1|3356618_3357947_+	hypothetical protein	NA	NA	NA	NA	NA
3357661:3357678	attR	TAAGTGTTGTTTTCTTTT	NA	NA	NA	NA
WP_151044141.1|3358177_3358594_-|tail	tail assembly chaperone	tail	NA	NA	NA	NA
WP_064670568.1|3359612_3360197_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.2e-112
WP_151044144.1|3360187_3361246_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.4	6.6e-202
WP_000424747.1|3361232_3361658_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_001259084.1|3361657_3362206_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_151044147.1|3362205_3363285_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	6.9e-207
WP_151044149.1|3363281_3364658_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	95.9	4.3e-246
WP_151044151.1|3364682_3366590_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.4	0.0e+00
WP_000571713.1|3366674_3366998_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_001526906.1|3366994_3367351_-|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_151044154.1|3367350_3368847_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	98.0	3.1e-274
WP_000497751.1|3368830_3369001_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_147696759.1|3369009_3369570_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	8.8e-105
WP_151044156.1|3369566_3370073_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	3.8e-83
WP_151044158.1|3370047_3370458_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	91.9	2.4e-67
WP_000927711.1|3370454_3370778_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3370780_3370981_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257507.1|3371030_3372236_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_001193631.1|3372250_3372901_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_151044161.1|3372878_3374120_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	3.8e-241
WP_000605606.1|3374119_3374302_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_065312442.1|3374313_3375810_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000929175.1|3376043_3376538_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_001583200.1|3376663_3377014_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	94.0	2.2e-61
WP_001089763.1|3377164_3377500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000613842.1|3377600_3378170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122986267.1|3378191_3378449_-	peptidase	NA	Q8SBD8	Shigella_phage	75.6	3.7e-26
WP_001356320.1|3378333_3378726_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.6	9.3e-53
WP_027661775.1|3378709_3379186_-	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	96.2	2.3e-85
WP_027661774.1|3379189_3379525_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_151044165.1|3379602_3380655_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	97.4	2.0e-203
WP_001317671.1|3380804_3380999_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	95.3	5.7e-27
WP_000966854.1|3381179_3381710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089600866.1|3381864_3382617_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	9.9e-136
WP_113416285.1|3383625_3384423_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	97.7	1.3e-146
WP_000767096.1|3384442_3384832_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.7e-68
WP_000210164.1|3384828_3385155_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_001355692.1|3385151_3385805_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_151044168.1|3385804_3386299_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.0	3.6e-86
WP_088224518.1|3386295_3387237_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	98.7	6.2e-143
WP_001250269.1|3387226_3387406_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_151044171.1|3387581_3388133_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	7.6e-101
WP_000205494.1|3388170_3388371_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3388468_3389095_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000159356.1|3389520_3389712_-	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
WP_000135680.1|3390150_3390513_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_151044174.1|3390578_3391403_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_001371719.1|3391530_3392067_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	2.0e-98
WP_000335007.1|3392057_3392936_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.1	6.3e-166
WP_151044177.1|3392932_3393277_+	DNA-binding protein	NA	U5P0J0	Shigella_phage	79.5	9.7e-30
WP_001163428.1|3393408_3393609_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 10
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	3648265	3654837	4860533	holin,portal,tail	Cronobacter_phage(80.0%)	10	NA	NA
WP_032292401.1|3648265_3648595_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.4	2.1e-37
WP_089587598.1|3648591_3650559_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.9	2.6e-268
WP_032292402.1|3650746_3651004_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	2.8e-21
WP_072007678.1|3650990_3651224_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	3.9e-30
WP_032292404.1|3651150_3651483_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	65.5	3.3e-35
WP_032292405.1|3651482_3651824_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.1	8.1e-45
WP_032292406.1|3651820_3652117_-|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	2.4e-16
WP_089587597.1|3652129_3652585_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.3e-58
WP_000746492.1|3653488_3654508_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.1	9.3e-137
WP_130065538.1|3654507_3654837_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	57.1	4.3e-27
>prophage 11
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	3757808	3770991	4860533		Escherichia_phage(50.0%)	12	NA	NA
WP_085438572.1|3757808_3760370_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	7.8e-31
WP_001141322.1|3760475_3761132_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3761182_3761950_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3762145_3763054_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|3763050_3764313_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3764309_3764948_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3764952_3765729_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3765817_3767182_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3767275_3768268_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3768330_3769470_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3769609_3770236_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3770229_3770991_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 12
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	4047068	4139750	4860533	terminase,lysis,tail,protease,tRNA,capsid,integrase,portal,transposase	Enterobacteria_phage(39.68%)	99	4120060:4120075	4147229:4147244
WP_001300563.1|4047068_4048181_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001118464.1|4048327_4049458_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|4049546_4051463_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843568.1|4051839_4052244_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|4052269_4052983_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|4053131_4053698_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|4053732_4054320_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130189.1|4054434_4055388_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001112563.1|4055666_4057097_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000906203.1|4057166_4057943_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_000738721.1|4058095_4058392_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781063.1|4058605_4059892_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241660.1|4059892_4060825_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001264697.1|4060826_4063289_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|4063369_4063435_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223167.1|4063648_4064335_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4064734_4064875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4064970_4065687_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920337.1|4065746_4067099_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219614.1|4067156_4068581_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188664.1|4068580_4069270_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
WP_000875487.1|4069282_4069756_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4069966_4070836_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4070832_4071480_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001341279.1|4071531_4072053_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4072137_4072464_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409442.1|4072553_4074491_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4074701_4076369_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093813.1|4076675_4077908_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029698.1|4077928_4079311_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132956.1|4079359_4080328_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|4080433_4081078_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105890.1|4081105_4082122_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566155.1|4082153_4082417_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224879.1|4082577_4083297_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816480.1|4083376_4084600_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|4084651_4085974_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|4086100_4086880_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143194.1|4087137_4088688_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088439.1|4088659_4089523_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563058.1|4090039_4090822_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|4090818_4091892_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4092013_4092175_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4092301_4092907_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|4093299_4094886_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217546.1|4095105_4095354_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
WP_071587313.1|4095350_4095479_-|capsid	capsid protein	capsid	Q9JFR8	Wheat_rosette_stunt_virus	83.9	4.7e-06
WP_000348577.1|4095891_4096089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124062278.1|4096231_4096813_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_124062279.1|4096812_4099836_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_096310283.1|4099900_4100500_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	3.7e-109
WP_096310285.1|4100566_4104049_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_151044225.1|4104109_4104712_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	1.4e-87
WP_089585320.1|4104648_4105392_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_001152389.1|4105397_4106096_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	3.0e-134
WP_000447253.1|4106105_4106435_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_094315057.1|4106434_4109500_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_001161009.1|4109471_4109801_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|4109809_4110196_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211109.1|4110256_4111000_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|4111011_4111413_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677106.1|4111409_4111988_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|4111999_4112275_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|4112267_4112591_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_151044229.1|4112677_4114705_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_015953980.1|4114649_4116230_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|4116157_4116370_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934084.1|4116366_4118469_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.0	0.0e+00
WP_000349509.1|4118468_4118960_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_123055983.1|4118949_4119213_-	hypothetical protein	NA	A0A291AX08	Escherichia_phage	100.0	3.7e-05
WP_001447005.1|4119118_4119319_-	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	98.5	1.4e-33
WP_001139675.1|4119635_4119788_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|4119775_4120243_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
4120060:4120075	attL	CAGCAGAACGCTGGCG	NA	NA	NA	NA
WP_001135250.1|4120239_4120737_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|4120736_4120952_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4121019_4122072_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|4122222_4122426_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001047110.1|4122679_4123432_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_063122747.1|4123445_4124435_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	5.6e-195
WP_094314736.1|4124442_4125252_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	98.5	2.9e-149
WP_000767103.1|4125271_4125661_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_000210169.1|4125657_4125984_-	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	100.0	9.2e-54
WP_094314737.1|4125980_4126634_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_094314738.1|4126633_4127128_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	8.9e-85
WP_000061531.1|4127124_4127943_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	5.2e-122
WP_094314743.1|4127939_4128164_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	93.2	4.2e-34
WP_151044232.1|4128168_4129005_-	ash family protein	NA	Q8SBF3	Shigella_phage	97.5	9.6e-148
WP_000521508.1|4129001_4129553_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|4129596_4129797_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848749.1|4129887_4130562_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_032139993.1|4130631_4130862_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.5e-13
WP_000135680.1|4131230_4131593_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081316.1|4131658_4132483_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000008209.1|4132610_4133147_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
WP_001242723.1|4133137_4133500_+	phage protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
WP_000206803.1|4133499_4134120_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_001061361.1|4134119_4134314_+	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	96.9	1.3e-31
WP_094314739.1|4134516_4138344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218277.1|4138526_4139750_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
4147229:4147244	attR	CGCCAGCGTTCTGCTG	NA	NA	NA	NA
>prophage 13
NZ_CP041448	Escherichia coli strain YPE10 chromosome, complete genome	4860533	4180775	4225152	4860533	transposase	Escherichia_phage(30.0%)	39	NA	NA
WP_089566769.1|4180775_4181938_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_021571045.1|4182665_4184429_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	40.0	1.6e-11
WP_000132621.1|4184649_4184991_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_000648228.1|4185037_4187131_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000394276.1|4187227_4187392_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_021571044.1|4187568_4188981_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_021571043.1|4189223_4190180_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	1.0e-60
WP_001136978.1|4190646_4191879_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001037408.1|4191919_4193200_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001351906.1|4193315_4194467_+	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_000222491.1|4194476_4195244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657676.1|4195240_4195498_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001298932.1|4195562_4196423_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001141202.1|4196490_4197669_+	MFS transporter	NA	NA	NA	NA	NA
WP_001151863.1|4197681_4198236_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	6.0e-37
WP_001295597.1|4198485_4199169_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|4199165_4199627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001724301.1|4199639_4200812_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340758.1|4200876_4201788_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_021571042.1|4201780_4202173_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|4202169_4202253_-	iraD leader peptide	NA	NA	NA	NA	NA
WP_000062547.1|4202844_4203675_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000833679.1|4203815_4204589_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208222.1|4204803_4206264_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	2.8e-49
WP_000438591.1|4206344_4207529_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000832229.1|4208315_4209218_-	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000872005.1|4209237_4209741_-	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_001244826.1|4209753_4210284_-	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_053286159.1|4210293_4212930_-	fimbrial biogenesis usher protein FimD	NA	NA	NA	NA	NA
WP_000066560.1|4212996_4213722_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000824105.1|4213758_4214298_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000695546.1|4214362_4214911_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000044711.1|4215391_4215988_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_085947917.1|4216213_4217486_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_151043984.1|4218224_4219400_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	1.1e-226
WP_001118615.1|4219466_4220390_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
WP_001295734.1|4222264_4222981_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_021571041.1|4223000_4224107_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_021571040.1|4224171_4225152_+|transposase	transposase	transposase	H6WZJ9	Escherichia_phage	55.4	1.6e-101
>prophage 1
NZ_CP041449	Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence	190128	42418	74887	190128	transposase,integrase	Escherichia_phage(27.27%)	30	71888:71902	76728:76742
WP_001086279.1|42418_43600_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001324690.1|43814_44027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807689.1|45612_46368_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_001232452.1|47852_48926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247564.1|49002_49146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416123.1|49181_49658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111572.1|49805_50081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011074.1|50070_50271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000341067.1|50337_50730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024156253.1|51066_51324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094309312.1|52447_53365_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_094309310.1|53354_54512_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_001120888.1|54850_56344_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_136655509.1|56705_58319_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	30.9	1.1e-30
WP_136655510.1|58366_58996_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.1	8.3e-19
WP_136655511.1|59218_59674_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072051933.1|59705_61052_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|61082_61967_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_058657119.1|62183_63398_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|63425_63731_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|66569_67274_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001516695.1|67879_68536_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_077249044.1|68854_69271_-	resolvase	NA	A0A219YB42	Aeromonas_phage	44.0	1.4e-17
WP_136655513.1|69325_70030_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	9.9e-138
WP_001235713.1|70755_71313_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|71495_72356_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
71888:71902	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
WP_000844102.1|72511_72709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|72770_73475_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072041844.1|73521_73905_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|73873_74887_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
76728:76742	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
>prophage 1
NZ_CP041444	Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence	78706	1602	67148	78706	transposase,integrase	Escherichia_phage(25.93%)	55	22281:22340	70161:71947
WP_001120888.1|1602_3096_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|3207_3513_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058657119.1|3540_4755_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001447541.1|4971_5856_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|6780_7485_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_065800308.1|7569_7959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|8223_9228_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_015344976.1|9306_12258_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|12260_12821_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|12946_13297_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|13499_14513_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|14660_15158_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|15269_15560_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|15565_16357_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_072078461.1|16487_16673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336323.1|17487_17655_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_025989258.1|17773_19693_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
WP_012386611.1|19708_19795_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|20590_21295_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
22281:22340	attL	GCCGGCCGCGCAAGGCGTGCTGGCAGCCGTGCAGACCCTGCGTGAGATGAACGCCGACAA	NA	NA	NA	NA
WP_001352149.1|25788_26538_+	molecular chaperone	NA	NA	NA	NA	NA
WP_001269817.1|26539_27604_+	fimbrial protein	NA	NA	NA	NA	NA
WP_046788569.1|27646_27847_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_000599943.1|28115_28709_+	YqiJ family protein	NA	NA	NA	NA	NA
WP_001532073.1|30071_31286_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
WP_001288435.1|31319_32753_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_000844102.1|33138_33336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118615.1|33434_34358_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
WP_094320909.1|34424_34895_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001452736.1|35103_35415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000734776.1|35450_35765_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_000220560.1|36577_36859_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
WP_000121743.1|36848_37100_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_001532157.1|38164_38395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050931.1|38333_39170_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000456533.1|39792_40149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024245156.1|40145_41123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001185482.1|41147_41429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516402.1|41526_42189_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_000203396.1|42569_43214_+	resolvase	NA	A0A1V0E035	Clostridioides_phage	28.3	3.4e-07
WP_065314367.1|43501_44809_-	methyl-accepting chemotaxis protein	NA	A0A1B0VAH3	Salmonella_phage	100.0	1.6e-51
WP_001067855.1|44867_45572_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001516695.1|47255_47912_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001143760.1|49364_52370_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|52533_53091_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|53273_54134_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000015958.1|54727_55504_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|55561_55819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|56581_57448_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|57624_57894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|58308_59514_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_006797589.1|59510_60488_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_047671986.1|60569_61841_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	1.4e-150
WP_000776034.1|61840_62272_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_072143941.1|62429_62681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118624.1|66224_67148_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	1.8e-171
70161:71947	attR	TTGTCGGCGTTCATCTCACGCAGGGTCTGCACGGCTGCCAGCACGCCTTGCGCGGCCGGCCCGTGCTGTTCCCCAACTTTTCGCTCGGCGAAGAGTATGAACATGCGCCGCCGGCGACGAATCGCCAAATCTCACCGTATCTCCCGAGCGGACGATTTCGCACCGGTCTGCCCGTCGAAGGGCTTGCGATCGAACGGGGCGACCTTTTCTATGCATGTCCGCGAGCCAGCGTCTTTTATGGCACGGCGCTCGACGCCGACCTTCGGACGCGCGGCGTAAGCACGCTTGTCATGGCCGGGATAAGCACCACCGGCGTTGTTCTTTCAAGCGTCGCCTGGGCTAGTGATGCGGACTACGACGTGCGTTTGGTCCAGGACTGCTGCTACGACCCGGATCGGGATGCCCACGAAGCTCTGTTGCGTTCCGGGTTCGGCGGACGTGTACAGGTCGTGTAATTTTCGGGCCTCGCATGATCGCGGCCATAGCCGCAGGTGGATTGGTGCGAGGCAGGGCCAGTCCAAGTCAGGGTGCGGTCATCGCGGCGCCTGCAACTCTCAAAAACCCATCGCCGTAGCGGAGGTCTTGTAATCGCATGTCATTACGCACGCCCGATTTATTGTTCACAGCGATAGCACCTGCCATTTGGGGCAGCACCTACATTGTCACCACCCAATACCTGCCGAACTTCTCACCGATGACGGTCGCGATGCTGCGGGCGTTGCCGGCGGGTTTATTGCTCGTGATGATCGTCCGACAGATTCCAACGGGAATCTGGTGGATGCGCATCTTCATCCTCGGCGCACTTAATATTTCGCTATTCTGGAGCTTGTTGTTTATTTCGGTCTACCGCCTGCCGGGCGGGGTCGCGGCGACGGTAGGCGCTGTGCAGCCGCTGATGGTCGTGTTCATCTCTGCCGCTCTGCTAGGTAGCCCGATACGATTGATGGCGGTCCTGGGGGCTATTTGCGGAACTGCGGGCGTGGCGCTGTTGGTGTTGACACCAAACGCAGCGCTAGATCCTGTCGGCGTCGCAGCGGGCCTGGCGGGGGCGGTTTCCATGGCGTTCGGAACCGTGCTGACCCGCAAGTGGCAACCTCCCGTGCCTCTGCTCACCTTTACCGCCTGGCAACTGGCGGCCGGAGGACTTCTGCTCGTTCCAGTAGCTTTAGTGTTTGATCCGCCAATCCCGATGCCTACAGGAACCAATGTTCTCGGCCTGGCGTGGCTCGGCCTGATCGGAGCGGGTTTAACCTACTTCCTTTGGTTCCGGGGGATCTCGCGACTCGAACCTACAGTTGTTTCCTTACTGGGCTTTCTCAGCCCGGGGACCGCCGTGTTGCTAGGATGGTTGTTCTTGGATCAGACGCTGAGTGCGCTTCAAATCATCGGCGTCCTGCTCGTGATCGGGAGTATCTGGCTGGGCCAACGTTCCAACCGCACTCCTGGGGCGCGTATAGCTTGCCGGAAGTCGCCTTGACCCGCATGGCATAGGCCTATCGTTTCCACGATCAGCGATCGGCTCGTTGCCCTGCGCCGCTCCAAAGCCCGCGACGCAGCGCCGGCAGGCAGAGCAAGTAGAGGGCAGCGCCTGCAATCCATGCCCACCCGTTCCACGTTGTTATAGAAGCCGCATAGATCGCCGTGAAGAGGAGGGGTCCGACGATCGAGGTCAGGCTGGTGAGCGCCGCCAGTGAGCCTTGCAGCTGCCCCTGACGTTCCTCATCCACCTGCCTGGACAACATTGCTTGCAGCGCCGGCATTCCGATGCCACCCGAAGCAAGCAGGAC	NA	NA	NA	NA
